ID: 904030745

View in Genome Browser
Species Human (GRCh38)
Location 1:27532147-27532169
Sequence AGGGAGAGGGAAGTGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1114
Summary {0: 1, 1: 0, 2: 5, 3: 139, 4: 969}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904030745_904030757 24 Left 904030745 1:27532147-27532169 CCTACCATCACTTCCCTCTCCCT 0: 1
1: 0
2: 5
3: 139
4: 969
Right 904030757 1:27532194-27532216 CCCATCTTCCCTTCGAGTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 117
904030745_904030760 26 Left 904030745 1:27532147-27532169 CCTACCATCACTTCCCTCTCCCT 0: 1
1: 0
2: 5
3: 139
4: 969
Right 904030760 1:27532196-27532218 CATCTTCCCTTCGAGTTAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 78
904030745_904030759 25 Left 904030745 1:27532147-27532169 CCTACCATCACTTCCCTCTCCCT 0: 1
1: 0
2: 5
3: 139
4: 969
Right 904030759 1:27532195-27532217 CCATCTTCCCTTCGAGTTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904030745 Original CRISPR AGGGAGAGGGAAGTGATGGT AGG (reversed) Intergenic
900428886 1:2592751-2592773 AGGGAGAGGGAAGTCAGGGCCGG - Intronic
900609342 1:3537869-3537891 AGGGAGAGGGTGGAGATGGGTGG + Intronic
901497613 1:9630877-9630899 AGAGAGGGGGAAGTGATGGGAGG + Intergenic
901508341 1:9700822-9700844 TGGGAGATGGGAGTGGTGGTGGG - Intronic
901871339 1:12140791-12140813 GGTGGGAGGGAAGTGAGGGTGGG - Intronic
901937532 1:12636851-12636873 GGGGAGAGGGCACTGAGGGTGGG + Intergenic
902222948 1:14978394-14978416 AGCTTGAGGGATGTGATGGTGGG + Intronic
902285412 1:15405281-15405303 AGGCAGAGGGAATAGATGGAAGG - Intergenic
902435053 1:16393133-16393155 AGGGAGAGGAAAGTGATGAGAGG + Intronic
902490551 1:16777880-16777902 AGGGGAAGGGAAGGGCTGGTGGG + Intronic
902516713 1:16993551-16993573 ATGGAGAGGGAAGACAGGGTGGG + Intronic
903061661 1:20672842-20672864 AGGGAGAGGGTGGTTATGGCTGG - Intronic
903559858 1:24219225-24219247 AGGGGAAGGGAAGGGAAGGTAGG - Intergenic
903575549 1:24337602-24337624 AGGGAGAGGACAGTGAGGCTGGG - Intronic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904308049 1:29602981-29603003 TGAGAGAGGGATGTGATGCTAGG - Intergenic
904536812 1:31204824-31204846 AGAGGGATGGAAGTGATGGGGGG + Intronic
904604824 1:31692561-31692583 AGGGATAGGGCAGGGATGGTGGG - Intronic
905294826 1:36947529-36947551 AGGCAGAGGGAAGGGAGGGCAGG - Intronic
905418368 1:37820605-37820627 GGGGAGAGGGAAGTGGTAGAAGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905955810 1:41994434-41994456 TGGGAAAGGGACCTGATGGTAGG + Intronic
906199670 1:43951422-43951444 AGCCAGATGGAAGTGATGGATGG + Intronic
906634471 1:47399479-47399501 AGGAAGAGGGAAATGATTGTTGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907414448 1:54304518-54304540 AGGGAGTTGCAGGTGATGGTGGG + Intronic
908093020 1:60706648-60706670 AGGGAAAGTGAAGTGACTGTGGG + Intergenic
909043923 1:70686544-70686566 AGGGAGTGAGAAGAGATGCTGGG - Intergenic
909209656 1:72807706-72807728 AAGGAGAGGGAAGAGTTGGAAGG - Intergenic
909209810 1:72808753-72808775 AGGGGGAAGAAAGTGATTGTGGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909767290 1:79372168-79372190 AGGGAAAGGGAAATGAAGGATGG - Intergenic
909779939 1:79531784-79531806 AGGGGGTGGGGAGTGAAGGTGGG - Intergenic
909842846 1:80350971-80350993 AAGGAGAGAGAAGGGGTGGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
909877918 1:80834036-80834058 AGGGTGAGGAAAGTGGTGATGGG - Intergenic
910223898 1:84917017-84917039 AGGGAGAGTGAACTGATGGGAGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910574010 1:88737780-88737802 AAGGAGAGGGAAGTGAGTGCAGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910980731 1:92958486-92958508 AGATAGAGGGAAGAGATGGAGGG - Intronic
911454691 1:98108476-98108498 AGGAAGAGGGAATAGATGGTTGG + Intergenic
911519289 1:98909220-98909242 AGGGAAAGGGAAGGGAAGGGAGG - Intronic
912229611 1:107776852-107776874 AGGGAGAGATAAGTGTGGGTTGG - Intronic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
913243114 1:116847637-116847659 AGGGAGAGAGAAATGAGGGTTGG + Intergenic
913261285 1:117000220-117000242 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
913447944 1:118969931-118969953 TGGGAGAGGGACCTGATGGGAGG + Intronic
913561244 1:120022532-120022554 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
913583954 1:120254779-120254801 AGGGAGGGGGAAGGGAGGGGAGG + Intergenic
913585569 1:120272263-120272285 AGGGGAAGGGAAGTGGAGGTGGG - Intergenic
913622615 1:120626104-120626126 AGGGGAAGGGAAGTGGAGGTGGG + Intergenic
913624227 1:120643561-120643583 AGGGAGGGGGAAGGGAGGGGAGG - Intergenic
913636883 1:120771070-120771092 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
913986051 1:143567059-143567081 ACGGAGATGGAAGTCTTGGTGGG - Intergenic
914038121 1:144022596-144022618 AGAGTGAAGGAAGTGATGGAGGG - Intergenic
914281830 1:146181942-146181964 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914542874 1:148632880-148632902 AAGAAGAGGGCAGTGAAGGTGGG - Intronic
914565941 1:148866623-148866645 AGGGAGGGGGAAGGGAGGGGAGG + Intronic
914567575 1:148884122-148884144 AGGGGAAGGGAAGTGGAGGTGGG - Intronic
914605247 1:149246123-149246145 AGGGGAAGGGAAGTGGAGGTGGG + Intergenic
914606880 1:149263613-149263635 AGGGAGGGGGAAGGGAGGGGAGG - Intergenic
914623762 1:149438363-149438385 AAGAAGAGGGCAGTGAAGGTGGG + Intergenic
914881163 1:151548161-151548183 AAGGAGAGGGTAGAGAGGGTAGG + Intronic
915087440 1:153397992-153398014 AGTGAGGGGGAAGTGATTGTTGG - Intergenic
915218165 1:154353483-154353505 ACGGAGAGGGAAATGAAGGCAGG - Intergenic
915301625 1:154954914-154954936 AGGAAAAGGGAAGTGAGGCTGGG + Intronic
915743355 1:158137107-158137129 AGAGAGAGGGAAGGGGTAGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916088443 1:161288322-161288344 AGGGACAGGGAAGTGAAGCAAGG - Intergenic
916214640 1:162384599-162384621 AGGGAGAAGGGAGTGAGGATGGG + Intronic
916673721 1:167047848-167047870 GGAGAGAGGAAAGTGATGTTGGG - Intergenic
916688435 1:167168932-167168954 AAGGAGAGGGAAGAAAAGGTGGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917463337 1:175251829-175251851 ACTGAGAGGGAACTGATGGAGGG - Intergenic
917522942 1:175763086-175763108 AGGGACAGGGAAGTAGAGGTTGG - Intergenic
917964376 1:180169185-180169207 TGGGAGAGGGAGGGGCTGGTTGG + Intronic
918606383 1:186431909-186431931 AGGGAGTGGGAAAAGTTGGTAGG + Intergenic
918774365 1:188609690-188609712 AGGGTGAGGGCAGTTGTGGTGGG + Intergenic
918892707 1:190295753-190295775 AGGGAAAGGGAAGTGAGTGTGGG - Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919105319 1:193142671-193142693 AGGGAAAAGGAAGTGAGGGAAGG - Intronic
919400745 1:197113222-197113244 AGTCAGAGGGAAGTGTGGGTTGG + Intronic
919518518 1:198557157-198557179 CGGGAGAGGGAAGGGAGGCTGGG + Intergenic
919731461 1:200916089-200916111 AGGCAGAGGGTAGAGATGGGTGG + Intergenic
919773090 1:201175467-201175489 TTGGAGAGGAAAGTGATGGAAGG + Intergenic
919880810 1:201899392-201899414 AGGGAGGGGGAGGGGGTGGTGGG + Exonic
920197287 1:204237296-204237318 AGGGTGAGGGCTATGATGGTGGG + Intronic
920289504 1:204908696-204908718 AGGAAGGGGGAGGTGGTGGTAGG - Intronic
920350194 1:205332870-205332892 GGGGAAAGAGAAGTGATGGAGGG + Intergenic
920748000 1:208647182-208647204 AGGGAGAGGGGAGGGAGGGAAGG - Intergenic
921442391 1:215203002-215203024 AGGAAGAGGGAAGGGAAGGAGGG - Intronic
921519712 1:216145086-216145108 AGGGTGAGGGAAGGGAAGGAGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921959651 1:221021524-221021546 AGACAGAGGGGAATGATGGTGGG + Intergenic
922176828 1:223203435-223203457 AGAGTGAGGGAGGTGAGGGTGGG + Intergenic
922216950 1:223527425-223527447 ATGGAGGGGGCAGTGATGGGGGG + Intergenic
922271905 1:224043162-224043184 AGGGAGGGGGGAGTGTTGGAGGG - Intergenic
922271983 1:224043367-224043389 CGGGAGAGGGGAGTGTTGGACGG - Intergenic
922272119 1:224043759-224043781 GGGGAGAGGGGAGTGCTGGAAGG - Intergenic
922272133 1:224043799-224043821 GGGGACAGGGAGGTGCTGGTGGG - Intergenic
922272155 1:224043855-224043877 GAGGAGGGGGAAGTGCTGGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923215645 1:231845685-231845707 AAGGTGAGTGAAGTGATGGATGG + Intronic
923252605 1:232191501-232191523 AGGGGCAGGGAAGTGATGGGAGG + Intergenic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923629848 1:235642614-235642636 AGGGAGAGGGCAGGGTTGGGAGG + Intronic
923865822 1:237938548-237938570 AGGAAGAGGGAGGTGATAATAGG - Intergenic
924206645 1:241718832-241718854 AGAGAGAGGGGAGAGAGGGTGGG + Intronic
924423939 1:243933814-243933836 AGGGAGAGGGAAAGGAAGGAAGG - Intergenic
1062833600 10:622303-622325 GGGGAGAGGGAAGGGAGGGAGGG + Intronic
1063000363 10:1912605-1912627 AGAGAGAGGAAAGAGAGGGTGGG - Intergenic
1063314147 10:4984972-4984994 AGGGAGTGGGAAGTAATGGGTGG + Intronic
1063908260 10:10802802-10802824 AGGGAGACAGAAGTGGAGGTGGG - Intergenic
1063915276 10:10875796-10875818 AGGCAGAGGGAAGAGATGTATGG - Intergenic
1064446651 10:15399464-15399486 AGGGAGAGGAAAGTGCAGGAAGG + Intergenic
1064483858 10:15765618-15765640 AGGGTGAGGGAAGTGCTTGGGGG + Intergenic
1064638991 10:17396604-17396626 ATAGAGAGGGATGTGATGGCAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065200998 10:23313042-23313064 AGGGAAAGAGAAGAGAGGGTGGG - Intronic
1065220521 10:23491564-23491586 AGAGAGAGGGAAGAGAGGGAGGG - Intergenic
1066295234 10:34048322-34048344 TGGGAGAAGGAAGGGATGGCTGG - Intergenic
1066334542 10:34462940-34462962 GGGGAGAGGGAAGAGAAGGGGGG + Intronic
1066641723 10:37560873-37560895 AGGGAAGGGGAAGAGAAGGTCGG - Intergenic
1066694331 10:38064548-38064570 AGAGAGAAGGAAGTGATTCTTGG - Intronic
1067296004 10:44975471-44975493 ATGGAGAGGGAAGTGGGGGTGGG - Intronic
1067825461 10:49569252-49569274 AGGGAATGGGAAATGATGATTGG + Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068221842 10:54055651-54055673 GGGGGGAGGGAAGTGGAGGTAGG - Intronic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069230921 10:66007737-66007759 AGGGAGGGGGAAAGGAAGGTAGG - Intronic
1069302769 10:66928544-66928566 AGGGAGAGGGAAGGGGAGGGGGG - Intronic
1069487581 10:68834103-68834125 GGCGAAAGGGAAGTGATGGGAGG + Intronic
1069862698 10:71481396-71481418 AAGGAGAGGTGTGTGATGGTGGG + Intronic
1070082477 10:73202659-73202681 AGGAAGAGGGAAGGGATGAAGGG - Intronic
1070220800 10:74442150-74442172 AGGGAGAGGAAAGTGGGGGTGGG - Intronic
1071221588 10:83473437-83473459 AGGGAGAGGGAAGGGTTGACTGG + Intergenic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1071617169 10:87086122-87086144 AGGGAGGGGGAAGTGAGGCATGG + Intronic
1072398988 10:95077783-95077805 AGGGAGAGGGAGGGGAGGGCAGG - Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1073044081 10:100625977-100625999 TGGGGGAGGGAGGTGAAGGTGGG + Intergenic
1073208277 10:101780067-101780089 AGGGAGAGGGAAGTCGGGGCTGG - Intronic
1073649083 10:105339947-105339969 AGGGAGAGGGGAGGGAGGGGAGG - Intergenic
1073748280 10:106494674-106494696 AGGGAGATGGCAGAGATGGAAGG - Intergenic
1073748524 10:106497439-106497461 AGGGAGTGGGAAATGTTGATTGG - Intergenic
1073977755 10:109119559-109119581 AGGGAAGGGGAAGTGAGGGGAGG + Intergenic
1074211614 10:111340484-111340506 CGAGAGAGGGAACTGATGGGAGG - Intergenic
1074388658 10:113037863-113037885 ATGGAGAGGTGAGTGTTGGTGGG + Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074950050 10:118324746-118324768 TGGAGGAGGGTAGTGATGGTTGG + Intronic
1075040177 10:119101850-119101872 AAGGAGAGGGAGATGATAGTGGG - Intergenic
1075153460 10:119955514-119955536 AAGGAGAGAGAAGTCAGGGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076135353 10:128041809-128041831 AGCAAGAGGGAAGTGGGGGTGGG + Intronic
1076577923 10:131483283-131483305 AGGGAAAGGTAGGTGATGGATGG + Intergenic
1077009723 11:374693-374715 AGGGAGGGGGAAGGGAGGGAGGG + Intronic
1077321066 11:1942153-1942175 AGGGAGAGGGAGGGGCTGATGGG + Intergenic
1077471216 11:2761564-2761586 AGGGGCAGGGAAGTGCTGGGAGG - Intronic
1077984129 11:7333207-7333229 AGTGAGAGGGAGGGGAAGGTAGG + Intronic
1078032909 11:7771382-7771404 GGAGAGAGAGAAGTGAGGGTTGG - Intergenic
1078099053 11:8318843-8318865 AGTGGAAGGGAGGTGATGGTGGG + Intergenic
1078988022 11:16613580-16613602 AGGCAGCGGGAAGTGGTGATGGG - Intronic
1079106722 11:17576744-17576766 AGGGAGGGGGAAGTGAGTGAGGG + Intronic
1079587072 11:22139421-22139443 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
1080592725 11:33737292-33737314 AGGGAGAGGGAAGGGAGGAACGG + Intergenic
1080604665 11:33855105-33855127 AGAGAGAGGGAAGGGAAGGGGGG + Intergenic
1081488556 11:43549455-43549477 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1081759776 11:45569049-45569071 AGGAAGAGTGAGGTGATGGCAGG + Intergenic
1081868450 11:46372344-46372366 AGGGAGAGGGGTGTGACTGTGGG - Intronic
1081968741 11:47184868-47184890 AGAGAGAGGGAAGGGGTGGGGGG - Intronic
1082266865 11:50128777-50128799 AGAGAGAGGCAGGTGATGGTAGG + Intergenic
1082289224 11:50349791-50349813 AGAGAGAGGCAGGTGATGGTAGG - Intergenic
1082654304 11:55834477-55834499 AGGGAGAAGGGGGTGATTGTCGG - Intergenic
1083314309 11:61804864-61804886 GGGGAGACAGAAGGGATGGTTGG - Intronic
1083541011 11:63511513-63511535 AGGGAGAAGGACATGGTGGTCGG + Intronic
1083602031 11:63954686-63954708 AGGGAGAGGGAAGAGTAGGTGGG + Exonic
1083932043 11:65851413-65851435 AGGGAGAGGGTAGGGGTGGGGGG - Intronic
1084002568 11:66305053-66305075 AGGAAGTTGGAAGTGTTGGTAGG - Intergenic
1084156742 11:67317459-67317481 AGGGAGGGGGCTGTGACGGTGGG - Intergenic
1084748585 11:71189119-71189141 AGGGAGAGGGAATGAGTGGTCGG - Intronic
1084858687 11:72004531-72004553 AGAGAGGGGGAAGTGAGGGAAGG + Intronic
1084910047 11:72381234-72381256 AAGGAGAGGGAAGTGAGGGCTGG + Intronic
1084919594 11:72458312-72458334 AGGGAGAGGGAAGGAAGGGAGGG + Intergenic
1085418608 11:76336744-76336766 AGGGAGGAGGAAGTGATAGGTGG + Intergenic
1085479097 11:76806959-76806981 AAGGAGAGGGAAGGGAGGGAAGG + Intergenic
1085508674 11:77074383-77074405 AGGGAGAGGGAAAAGGTGGGAGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085798729 11:79567427-79567449 AGGGAAAGGAAGATGATGGTTGG - Intergenic
1086261619 11:84947019-84947041 AGGGAGAGCAAAGTGATGGCTGG - Intronic
1086400387 11:86456661-86456683 AGGCAGAGGGAAGTGAACTTAGG + Intronic
1087149125 11:94842829-94842851 AGGGACAGGGAAGGGAGGGAAGG - Intronic
1087527168 11:99330212-99330234 AGGGAGAAGGAAGGGAAGGAAGG + Intronic
1087658022 11:100949718-100949740 AAGGAGTGGGAAGTGAGGGTGGG + Intronic
1088237581 11:107742026-107742048 GGGGTGAGTGAAGTGATGGCGGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088778546 11:113110790-113110812 AGGCAGAGGGAAGTGATGTCAGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089310047 11:117552013-117552035 ATGGAGGGGGAAGAGAAGGTGGG + Intronic
1089612495 11:119677328-119677350 GGAGAGAGGGAAGTGTGGGTGGG + Intronic
1089618659 11:119709673-119709695 TGGGAGAGGAGAGTGATGCTCGG + Intronic
1089841476 11:121422133-121422155 GGGGAGAGAGAAGTTTTGGTGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090227340 11:125079657-125079679 AGGGAGAGAGAAGGGAGGGTGGG - Intronic
1091038603 11:132256023-132256045 AGGGATAGAGAAGAGAAGGTGGG - Intronic
1091051605 11:132377656-132377678 AGGGAGAGGGCTATTATGGTGGG + Intergenic
1091193904 11:133716019-133716041 AGGGAGAGGGAATGCATGCTGGG + Intergenic
1091209524 11:133844447-133844469 AGGGAGAGGGGAGAGGTGGGAGG - Intronic
1091365887 11:135020039-135020061 AGACAGAGGGAAGTGGTGATGGG + Intergenic
1091751250 12:3022471-3022493 AAGGGGAGGGAAGTGTTGGATGG + Intronic
1092196730 12:6554437-6554459 AGGGAAAGGGATGTGATGCCAGG - Intronic
1092281504 12:7101229-7101251 AGGGAGAGGGAAGGGAAGGGAGG - Intronic
1092968055 12:13664264-13664286 AGGGAAAAGGAAGGGAAGGTGGG + Intronic
1094026427 12:25964110-25964132 GAGGAGAGGAAAGTTATGGTTGG + Intronic
1094583053 12:31751980-31752002 GGGGATGGGGAAGTGGTGGTAGG + Intergenic
1095260895 12:40098328-40098350 AGGGATAGGGAAGAGAGGCTGGG + Intronic
1095856844 12:46869632-46869654 AGGGAGAGAAAAATGATGCTTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1095896473 12:47285059-47285081 AGGGAAAGGGAAGGAATGGTAGG + Intergenic
1095990333 12:48029938-48029960 AGGGAGAGGGATGTGTGGGGAGG + Intergenic
1096012875 12:48236317-48236339 AGGGACTGGGGAGTGATGATTGG - Intergenic
1096191872 12:49624526-49624548 AGGGAGAGTGATGAGATGGCAGG + Intronic
1096220846 12:49827665-49827687 AGGGAGGGAGAAGGGTTGGTTGG - Intronic
1096427448 12:51516172-51516194 GGGGAGAGGGAAGCAATGGAGGG + Intergenic
1097475492 12:60051022-60051044 TGGGAGAAGGAAGTGATATTTGG + Intergenic
1098000106 12:65932131-65932153 AGGAAGAGGGAAGTGAGAGCTGG + Intronic
1098009381 12:66034154-66034176 AGGGAGAGGGAAGAGGAGGAAGG + Intergenic
1098216400 12:68224711-68224733 AGGGAGAGGGAAGGAAGGGAGGG + Intronic
1098820877 12:75227247-75227269 AGGGAGGGGGAAGGGAGGGAGGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099275912 12:80575988-80576010 AGAGAGAAGGAAGAGATGGAAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099751893 12:86784886-86784908 AGAGAAAGGGAAATGATTGTAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1101245265 12:102878631-102878653 AGGAAGAGGGAAGAGAGGGAGGG + Intronic
1101720696 12:107348065-107348087 AGGGAGAGAGAATTGCAGGTGGG + Intronic
1102167881 12:110820800-110820822 AGGGAGAGGGGAGAGAAGGAGGG - Intergenic
1102500985 12:113352343-113352365 AGGGAAAGGGAAGGGAAGGAAGG - Intronic
1102866178 12:116376920-116376942 TGGGAGAGGGACGTGATTGGAGG + Intergenic
1103221623 12:119251145-119251167 AGGGAGAGGAAGGTGTTGGTGGG - Intergenic
1103462532 12:121116532-121116554 AGGCAGAGGGTAATGATGGAGGG - Intergenic
1104178768 12:126357837-126357859 AGGGAAAGGGAAGAGAGGGGAGG + Intergenic
1104213327 12:126711519-126711541 AGGGAGAAGGGAGGGATGGAGGG + Intergenic
1104298758 12:127543211-127543233 AGGGAGAGGGAAGGGAGCCTGGG + Intergenic
1104326965 12:127808277-127808299 AGGGTGGGGAAAGTGATGGCAGG - Intergenic
1104427087 12:128686863-128686885 AGGAAGAGGGAAGGGAGGTTCGG + Intronic
1104438483 12:128775852-128775874 AGGGAGGGGGAAGTCATCGATGG + Intergenic
1104582890 12:130023696-130023718 AGGGAGGGGGGAGAGATGGAAGG + Intergenic
1104651041 12:130534232-130534254 AGGGAGTGGGAGGTGGTGGGAGG + Intronic
1104675494 12:130709575-130709597 AGGGAGAGGGAAGGAAGAGTCGG + Intronic
1104952245 12:132446493-132446515 AGGGAGTGGGGAGTGCTGGCTGG - Intergenic
1105601659 13:21893225-21893247 AGGGAAAATCAAGTGATGGTGGG + Intergenic
1105986534 13:25572718-25572740 AGGGAAAGGCAAGGGATGGCAGG - Intronic
1106789232 13:33137912-33137934 AGGGAGTGGGAAGTAGGGGTGGG + Intronic
1107104897 13:36632505-36632527 AAGGAGATGGAAAGGATGGTGGG + Intergenic
1107381507 13:39861526-39861548 AGGGAAAGGGAAGGGAGGGGAGG + Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107865870 13:44702954-44702976 AGGGAAAGGGAAGGGAAGGAAGG - Intergenic
1108074630 13:46667017-46667039 AGGGAAAGTGAAGAGCTGGTTGG + Intronic
1108410516 13:50141862-50141884 TGGGAGAGGGTGGTGGTGGTAGG + Intronic
1108430195 13:50345841-50345863 AGGGAGGGGGGAGTGAGGGAGGG - Intronic
1108517447 13:51216499-51216521 AGGGAGACAGAAATGAGGGTAGG + Intergenic
1108623503 13:52206101-52206123 AGGGTGAGGGAAGTGTTGTTAGG - Intergenic
1108663213 13:52604943-52604965 AGGGTGAGGGAAGTGTTGTTAGG + Intergenic
1108990353 13:56648505-56648527 TGGGGGAGGGAACTGATGGGAGG + Intergenic
1109357128 13:61245900-61245922 AGAGAGATGAAATTGATGGTTGG + Intergenic
1109630366 13:65037254-65037276 AGAGAGAGAAAAGAGATGGTTGG + Intergenic
1110053284 13:70932818-70932840 TGGGAGAGGGAAGTTATGCGAGG - Intergenic
1110378788 13:74825434-74825456 AGGGAGGGGGAGCTGATGGGAGG - Intergenic
1110441054 13:75525475-75525497 AGGGAGAGAGAAGGGATCTTTGG + Intronic
1110872470 13:80468422-80468444 AGGAAGAGGGAACTGAGAGTTGG + Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111073062 13:83195072-83195094 AGGGGAAAGGAAGGGATGGTGGG + Intergenic
1111086386 13:83380593-83380615 AGGGAGGGGGAAGAGAAGGAAGG - Intergenic
1111156835 13:84338406-84338428 AGGGACAGGGAAGTGATGGGAGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112019945 13:95362883-95362905 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1112435123 13:99386265-99386287 AGGGAGAGGGAAGGCAGGGGTGG + Intronic
1112442681 13:99435590-99435612 AGGGGGAGGAAAGGGATGGAAGG - Intergenic
1112672798 13:101660272-101660294 AGGGAGTGGGGAGTGCTGATTGG + Intronic
1113314433 13:109163475-109163497 AGGGAGTGGGGAGGGATGGAGGG - Intronic
1113602410 13:111579522-111579544 AGATCGATGGAAGTGATGGTTGG - Intergenic
1113704297 13:112415984-112416006 AGAGGGAGGGAAGTGAGTGTGGG - Intronic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1114405355 14:22451233-22451255 AGAGATAGGGTGGTGATGGTGGG + Intergenic
1114493620 14:23118413-23118435 AAGGAAAGGGAGGTCATGGTGGG + Intronic
1114837401 14:26219346-26219368 AGGAAGAAGAAAATGATGGTGGG + Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1115106078 14:29763388-29763410 AGGGAGAGGGGAGGGAGGGAGGG + Intronic
1115130563 14:30048175-30048197 AGGGTGAGGGCTGTTATGGTGGG + Intronic
1116292404 14:43060448-43060470 AGAGAGAGGGAAGTTTTGGAAGG + Intergenic
1116619985 14:47189196-47189218 TGGGGGAGGGAGGGGATGGTAGG - Intronic
1116867187 14:50040405-50040427 AGGGAGGGGGAACTGCTGCTGGG - Intergenic
1116873607 14:50090654-50090676 AGAGGGAGGGAAGTGAAGGTGGG - Intronic
1117646711 14:57860822-57860844 AGGGACAGGGAACAGATGGTAGG - Intronic
1118011599 14:61615633-61615655 AAGGAAAGTGAAATGATGGTGGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118798421 14:69166814-69166836 AAGGGGAGGGAAGGGAAGGTAGG + Intergenic
1118887674 14:69879981-69880003 GGGGACAGGGGAGGGATGGTGGG - Intronic
1119591065 14:75888422-75888444 AGGACGAGGGAAGTGAGGGATGG - Intronic
1119673720 14:76538880-76538902 AGGGAGGGGGAAGGGAGGGGAGG - Intergenic
1119753000 14:77093779-77093801 AGGCAGAGGCCAGTGATAGTGGG - Intergenic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120143120 14:80950693-80950715 AGGGAGAGGAAAGTGATAAGGGG + Intronic
1120371191 14:83638834-83638856 TGGAAGAGGGAACTGATGGGAGG + Intergenic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120817877 14:88882512-88882534 AGGGATAGGGACGGGATTGTGGG - Intergenic
1120818053 14:88883771-88883793 AGGGAGGAGGAAGTAATGATTGG - Intergenic
1120854604 14:89201753-89201775 AAGTGGAGAGAAGTGATGGTTGG - Intronic
1121604473 14:95230516-95230538 TGGGAGAGGGCAGTCAGGGTCGG + Intronic
1121897551 14:97662625-97662647 GGGGAGAGGGAAGAGCTGGTAGG - Intergenic
1122053933 14:99079488-99079510 AGGGTGAGAAAAGGGATGGTGGG - Intergenic
1122055567 14:99095995-99096017 TGGGAGAGGGAGCTGATGGTTGG + Intergenic
1122091572 14:99344234-99344256 GGGGAGAGGGAGGTGATGCCAGG - Intergenic
1122717987 14:103706821-103706843 AGGGAGGGGGAAGTGAGGCTGGG - Intronic
1122916426 14:104861135-104861157 AGGTGGAGGGTAGTGATGGACGG - Intergenic
1122916436 14:104861174-104861196 AGACAGAGGGTAGTGATGGATGG - Intergenic
1122916458 14:104861291-104861313 AGATAGAGGGTAGTGATGGACGG - Intergenic
1122942749 14:104989731-104989753 GGGAGGAGGGAAGTGAAGGTTGG + Intronic
1123157010 14:106236824-106236846 AGGGAGAGGCAAGTTCTTGTAGG + Intergenic
1123680582 15:22760411-22760433 AGGGGGAGGGTAGTGGTGGCGGG - Intergenic
1124233229 15:27964888-27964910 GGGAAGTGGGGAGTGATGGTTGG - Intronic
1124449890 15:29778453-29778475 AGGTAGAGGGAAGGGAAAGTGGG - Intronic
1124820015 15:33035560-33035582 AGGGAGAGGTAAGGGAATGTAGG - Intronic
1126489145 15:49216808-49216830 AGGGAGGGTGAAGTGAGTGTGGG - Intronic
1126550747 15:49926518-49926540 AGGGAGAGGGAAGCTATTGCAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127052075 15:55094947-55094969 AGGGAGGGGGAATGGATGGAAGG - Intergenic
1127160377 15:56177306-56177328 AAAGGGAGGCAAGTGATGGTGGG - Intronic
1128074576 15:64818242-64818264 AGGGAGAGGTAAGTGTTGGGAGG - Exonic
1128186942 15:65650698-65650720 ATGGAGGGGGAAGTGATGGAGGG + Exonic
1128332696 15:66766190-66766212 AGGGAGGTGGAAGGGATGGGGGG + Intronic
1128537160 15:68500173-68500195 AGGGAGTGGGAAGGAATGGAAGG - Intergenic
1128649887 15:69402873-69402895 AGGGACAGGGACGTGCTGGGTGG - Intronic
1128838864 15:70833186-70833208 AGGGATAAGGAAGTGAGGGAGGG - Intronic
1129117191 15:73370975-73370997 AGGGCGAGTGAGGTGCTGGTAGG - Intergenic
1129917417 15:79286200-79286222 AGAGAGGTGAAAGTGATGGTGGG + Intergenic
1130173368 15:81541037-81541059 AGAGAGAGGGAAGAGATGCCAGG - Intergenic
1130190068 15:81725917-81725939 AGGGAGGGGGATGAGAAGGTGGG - Intergenic
1130207785 15:81894109-81894131 AGGGAGAGGTTAGTAATGATGGG + Intergenic
1130216332 15:81973828-81973850 AAGGAAAGGGAAATGAAGGTGGG + Intergenic
1130638003 15:85643572-85643594 ACAGAGAGGGAAGTGAGGGTTGG - Intronic
1130937117 15:88480000-88480022 AGGGAGAGGGAAGAAATGCCTGG + Exonic
1131145033 15:90005288-90005310 AGGGACAGGGAGGTGATTGATGG + Intronic
1132203307 15:99969782-99969804 GGGGGGAGGTCAGTGATGGTGGG + Intergenic
1132664655 16:1076022-1076044 AGGGAGAGGGAGGGGGAGGTGGG - Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132716508 16:1292697-1292719 AGGGAGGGGGAAGTGGGGGGGGG - Intergenic
1133065058 16:3200071-3200093 AGAGAGAGGGAACTGAGGGCAGG + Intergenic
1133151907 16:3839727-3839749 AGGGGGAGGGAAGGGAGGGAAGG + Intronic
1133288110 16:4700436-4700458 AGGCAGAGGGAAGCTCTGGTTGG - Intronic
1133307956 16:4822973-4822995 AGGGAGAAGGAAGTGACCTTTGG - Intronic
1133755240 16:8757675-8757697 AGGGAGAGGGAAGGAGAGGTGGG + Intronic
1133819750 16:9226086-9226108 AGGGAGAGGGAAGGAAGGGAAGG - Intergenic
1134812209 16:17177261-17177283 AAGGAGGGGGAACTGATGGTAGG + Intronic
1134834938 16:17353343-17353365 AGGGTGGGGGAAGTGAGGGCAGG + Intronic
1135165794 16:20138172-20138194 GGGGAGAGGGAAGGGAGGGGAGG - Intergenic
1135247515 16:20869628-20869650 AGGGAGAGGGTTGATATGGTTGG + Intronic
1135624782 16:23984814-23984836 AGGGAGAGGGAGGTGAAGCTGGG + Intronic
1135777073 16:25266183-25266205 AGGGAGAGGGAATTCCTGATTGG + Intergenic
1135785551 16:25345685-25345707 AAGAAGAGGGAAATGATGCTGGG + Intergenic
1136067864 16:27770885-27770907 GGGGAGAGGGAAGTGAGAGGAGG - Intronic
1136416432 16:30107055-30107077 AGGGAGAGGGAGGAGAGGGAGGG - Intronic
1136705756 16:32187243-32187265 AGATAGAGGGAAGAGATGGAGGG + Intergenic
1136762157 16:32742162-32742184 AGATAGAGGGAAGAGATGGAGGG - Intergenic
1136805942 16:33128224-33128246 AGATAGAGGGAAGAGATGGAGGG + Intergenic
1137384988 16:48033183-48033205 AGGGAGAGGGCGGAGATGGGTGG + Intergenic
1137539162 16:49350176-49350198 AAGGAGAGGGAAGAGAAGATGGG - Intergenic
1137656696 16:50165566-50165588 AGGGAGTGGGGAGTGATAATGGG - Intronic
1138316333 16:56073305-56073327 AGGGAGAGGGAAGAGAGGAGAGG - Intergenic
1138538116 16:57670525-57670547 AGGGAGAGGGAAGAGAGGAGAGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1138929147 16:61631205-61631227 AGAGAGAGAGAAGGGATGGAGGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139120212 16:64007268-64007290 AGAGAGAGAGAAGTGGGGGTAGG - Intergenic
1139292415 16:65870720-65870742 AGGGAGAGGGAAAGGAGGGAGGG + Intergenic
1139613738 16:68076578-68076600 AGGGAGGGAGCGGTGATGGTGGG + Intronic
1140258617 16:73358037-73358059 AGGCAGAGGGAGGAAATGGTGGG - Intergenic
1140804679 16:78522117-78522139 AGGAGAAGGGAAGTGATGGAAGG + Intronic
1141235248 16:82210054-82210076 AGAGAGAGGGAAGGGAGGGAAGG - Intergenic
1142189748 16:88712446-88712468 AGGGAGAGGCCAGTGAGGCTGGG - Intronic
1142364811 16:89644657-89644679 AGGGAGGGGCTAGTGTTGGTAGG - Exonic
1203064314 16_KI270728v1_random:1002479-1002501 AGATAGAGGGAAGAGATGGAGGG - Intergenic
1143000189 17:3789464-3789486 AGAGAGAGGGAAGGGAGGGAGGG - Intronic
1143021245 17:3918109-3918131 AGGGAGAAGGAAGGGAAGGAAGG + Intergenic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143446044 17:7010142-7010164 CGGGAGAGGGAAATGACAGTTGG + Intronic
1143643649 17:8215136-8215158 AGGGAGCAGGCAGAGATGGTTGG + Intergenic
1143893565 17:10120141-10120163 ATGGAGTGGGAAGAGATGGGCGG - Intronic
1143920732 17:10329254-10329276 AGGGAGAGGGGAGTGTGGGAGGG - Intronic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1144459835 17:15449492-15449514 AGGAAGGGAGAAGTGTTGGTTGG - Intronic
1144704852 17:17361656-17361678 AGGGAGAGGGAGGTGAAGGCTGG + Intergenic
1145104447 17:20103640-20103662 TGGGAGAGGGAAGGGAAGATCGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145912690 17:28551865-28551887 AGGGTGAGGGTATTAATGGTTGG + Intronic
1145978158 17:28996265-28996287 AGGCAGAGGGAGGTCATCGTGGG + Intronic
1146008526 17:29177441-29177463 AAGGGCAGGGAAGTGAAGGTGGG + Intronic
1146377614 17:32305164-32305186 AGGGAGAGGGAGGGGAGGGGAGG + Intronic
1146722510 17:35133145-35133167 AGTGTGGGGGAAGTGGTGGTTGG - Intronic
1146791542 17:35753350-35753372 AGGGAGAGGGAGGAGAGGTTGGG + Intronic
1146915114 17:36673371-36673393 AAGGAGAGGGAAGAGAAGGAGGG + Intergenic
1147235747 17:39056172-39056194 AGGGAGTGGGAAATGCTGATTGG - Intergenic
1147248703 17:39139610-39139632 AGGGGGAGCGAAGTGGGGGTGGG - Intronic
1147430862 17:40370025-40370047 TGGGAGAGGGAAGGGGTGGAGGG + Intergenic
1147506384 17:41021627-41021649 TTGGAGAGGGAAGTGGGGGTAGG + Intergenic
1147768846 17:42854311-42854333 GGGGAGAGGGAAGAGAAGGAGGG + Intronic
1148154363 17:45414247-45414269 GGGGAGGGGGAAGGAATGGTGGG - Intronic
1148177985 17:45584515-45584537 AGGGGGAGGGCAGAGAAGGTGGG + Intergenic
1148214220 17:45825588-45825610 GGGGAGAGGTGAGTGGTGGTTGG + Intronic
1148666329 17:49377705-49377727 AGGGAAAGGGAAGGGAGGGGAGG - Intronic
1148801472 17:50229318-50229340 AGGGAGGGGGAGGGGATGGCTGG - Intergenic
1148824709 17:50384044-50384066 AGGGAGAGGCAGGTGAGGGAAGG - Intronic
1148912823 17:50952242-50952264 GGGGAGAGGGAGGTGAAGGCGGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149361890 17:55903885-55903907 TGGGATAGGTAAGTGTTGGTAGG - Intergenic
1149797078 17:59530498-59530520 AGGGAGAGAGAAGGGAGGGAGGG + Intergenic
1149967421 17:61179631-61179653 AGGGAGAGGCAAGAGATAGAGGG - Intronic
1150146467 17:62773658-62773680 GTGGAGAGGGCGGTGATGGTGGG + Intronic
1150227574 17:63532189-63532211 AGGGAGACAGAAGGAATGGTGGG - Intronic
1150519613 17:65852385-65852407 AGGGAGAGGGAAGGGAGGGAGGG - Intronic
1150676499 17:67248735-67248757 AGGAAGAGGGATGTGATGTCGGG - Intergenic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151327640 17:73388873-73388895 AGGGAGAAGGAAGAGAAGGAGGG - Intronic
1151351274 17:73533541-73533563 TGTGCCAGGGAAGTGATGGTGGG - Intronic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1151453222 17:74211954-74211976 AGGGAGAGGGGATGGAAGGTGGG - Intergenic
1151514586 17:74584614-74584636 AGGGAGGGAGAGGTAATGGTTGG - Intronic
1151523616 17:74648519-74648541 TGAGAGAGGGAAGCGAGGGTGGG + Intergenic
1151624456 17:75267911-75267933 AGGGAGAGGAAGGTGAAGGGTGG + Intronic
1151816879 17:76475509-76475531 AGGGAGAGTGAACAGCTGGTGGG - Intronic
1152211170 17:79004067-79004089 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152211216 17:79004190-79004212 AGGGAGAGGGAGGTTAGGGAGGG + Intronic
1152211257 17:79004319-79004341 AGGGAGAGGGAGGTTAGGGAGGG + Intronic
1152211290 17:79004405-79004427 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152211314 17:79004476-79004498 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152211342 17:79004549-79004571 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152211402 17:79004721-79004743 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152211499 17:79004992-79005014 AGGGAGAGGGGAGTTAGGGAGGG + Intronic
1152925735 17:83086971-83086993 TGGGAGAGGCATGGGATGGTAGG + Intronic
1153088511 18:1317650-1317672 AGGAAGAGTGAAGTGATCATGGG + Intergenic
1153552252 18:6273811-6273833 AAGGAGAGGGAAGAGCTGGGAGG + Intronic
1153761359 18:8335231-8335253 GGGGAGAGGGGAGGGAGGGTGGG - Intronic
1153912343 18:9715242-9715264 AGGGACAGGGAAGGAAAGGTGGG + Intronic
1154067893 18:11126310-11126332 GGAGAGAGGGGAGTGATGCTGGG - Intronic
1155071516 18:22320987-22321009 AGGGAGAGTTAAGAGATGGGAGG + Intergenic
1155433676 18:25788211-25788233 AGGGCGAGGGGAGAGATGGTCGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155979515 18:32165927-32165949 AGAGAGAGGGAAGGGCTTGTAGG - Intronic
1156776215 18:40792429-40792451 AGGGGAAGGGAAGTGAAGGAAGG - Intergenic
1157102457 18:44743113-44743135 AGGGAGGGGGAAGGGAAGGCAGG - Intronic
1157197592 18:45631962-45631984 AGGGAGAGAGAAGAGAGGGAAGG - Intronic
1157323262 18:46650130-46650152 AAGGACAGGGAGGTGATGGTGGG - Intronic
1157372627 18:47130502-47130524 AGGGAGAGGGAGATGGGGGTTGG + Intronic
1157448335 18:47765226-47765248 AGGGAGAGGGAGGGGAGGGGAGG + Intergenic
1157492064 18:48130387-48130409 AGGGAGAAGAAAGTGATGCTAGG + Intronic
1157612714 18:48968430-48968452 AGGGAGAGGGAAGGGAAGGAGGG + Intergenic
1157743025 18:50110011-50110033 AGGGAGTGGGGAGAGAGGGTAGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158279463 18:55805651-55805673 AAGCAGAGGGAAATCATGGTAGG - Intergenic
1158653355 18:59307396-59307418 GGTTGGAGGGAAGTGATGGTTGG + Intronic
1160597011 18:79982720-79982742 AGAGAGAGGGAAGTTACTGTGGG + Intronic
1160962376 19:1728714-1728736 AGGGAGAGGGAGGCGGAGGTTGG + Intergenic
1160975466 19:1790385-1790407 GGGGAGAGGGAAGGGAGGGGAGG - Intronic
1160975482 19:1790418-1790440 GGGGAGAGGGAAGGGAGGGGAGG - Intronic
1161061103 19:2215377-2215399 AGGCAGAGGCAGGTGCTGGTGGG + Intronic
1161214950 19:3089719-3089741 AGGTAGAGGGAGGAGGTGGTGGG + Intergenic
1161384390 19:3983280-3983302 AGGGAGATGGCACTGATGGAGGG + Exonic
1161540001 19:4844802-4844824 GGGGAGAGAGAAGTGAGGGAAGG + Intronic
1161601301 19:5185221-5185243 TGGGACAGGGAAGTGGAGGTGGG - Intronic
1161638099 19:5401903-5401925 AGGAAGAAGGAAGAGAGGGTTGG + Intergenic
1161642917 19:5435597-5435619 AGGGAGATGGAAGCCATGGAGGG - Intergenic
1161812761 19:6479942-6479964 AGGGAGTGGGAGGGGAGGGTGGG - Intronic
1162429791 19:10621397-10621419 ACAGAGAGGAAAGGGATGGTTGG + Intronic
1162620961 19:11843876-11843898 AGGGAGGAGGAGGTAATGGTTGG + Intergenic
1162787478 19:13044817-13044839 AGTGAGAGGCAAGGGATGGGAGG + Intronic
1162877637 19:13632580-13632602 AGAGAGAGGGAAGGGAGGGAGGG - Intergenic
1163358206 19:16828807-16828829 AAGGATAGGGAAGTGAAGATGGG + Intergenic
1163722400 19:18904556-18904578 AGCCAGAGCGAAGAGATGGTGGG - Intronic
1163767342 19:19170893-19170915 AAGGAGAGGGAAGTGGTTGGTGG - Intronic
1163906273 19:20151759-20151781 AGTGAGCGGGAGGGGATGGTTGG - Intergenic
1163906694 19:20154719-20154741 AGGGAGGGAGAGGTAATGGTTGG + Intergenic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164544518 19:29148613-29148635 AAGGAGAGGGAAGGAATGGAGGG + Intergenic
1164744246 19:30599423-30599445 AGGGAGGGGGAAGGGAGGGACGG - Intronic
1165349035 19:35266811-35266833 AGGGACAGGGGGGTGGTGGTCGG - Intronic
1165395221 19:35560179-35560201 TGGGAGAGGGTAGTGACAGTGGG + Intronic
1165427754 19:35755254-35755276 AGGGTTAGGGTAGTGCTGGTAGG + Exonic
1166178684 19:41091946-41091968 AGGGAGAGGGAAATCAGGATGGG + Intronic
1166231316 19:41427134-41427156 AGGGAGAGGGAGGAGATAGACGG - Intronic
1166301563 19:41914377-41914399 AGGGAGAGGGCAGTGAGGTGGGG - Intronic
1166938248 19:46347705-46347727 AGGAAAAGGAATGTGATGGTGGG + Intronic
1167636607 19:50659341-50659363 AGGGGAAGGGAGGTGATGGGGGG + Intronic
1167786913 19:51644628-51644650 ATGAGGAGGGAAGTGATGATTGG + Intronic
1167820126 19:51920227-51920249 AGGGAGAGAGAGGTAACGGTTGG - Intronic
1168094794 19:54108257-54108279 AGGGGGAGGTAGGTGATGGGTGG + Intronic
1168156153 19:54473880-54473902 AGGGAGAGGGAAGCCCAGGTAGG + Intergenic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
1168644269 19:58050023-58050045 TGGGAGGGGGAAATGAAGGTTGG + Intronic
925499542 2:4488000-4488022 AGGGTGAGGGATATTATGGTGGG - Intergenic
925905630 2:8538255-8538277 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
926151448 2:10427860-10427882 AAGGAGAGGGAAGGGCTGGGGGG - Intergenic
926195470 2:10761220-10761242 AGGTGGAGGGAAGAGATGGATGG + Intronic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926809934 2:16746996-16747018 AAGGAGTGGGAAGTGGTGGGTGG - Intergenic
926825725 2:16903451-16903473 AGGGTGAGGGCAATTATGGTGGG - Intergenic
927042280 2:19241447-19241469 CGGGAATGGGAAGTGATGCTGGG - Intergenic
927477503 2:23425347-23425369 AAGGGGAGAGAAGTGAGGGTGGG + Intronic
927860388 2:26557025-26557047 AGGGAGAGGGAGGTGTGGGCTGG - Intronic
927914927 2:26929575-26929597 AGGGATGGGGCAGTGGTGGTGGG - Intronic
927935170 2:27072073-27072095 AGGGAGAGGGCACTGAGGGCAGG - Intergenic
927955811 2:27206635-27206657 AGGAAGAGGGAAGTGAGCCTAGG - Intronic
928342661 2:30458629-30458651 TGGGAGTGGAGAGTGATGGTGGG + Intronic
928420295 2:31133065-31133087 AGGGAGTGGGAAGTATTGATTGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928673815 2:33630334-33630356 AGGGGGCGGGAAGTGCTGGAAGG + Intergenic
928920785 2:36525012-36525034 AGGGGGAGGGAAGTTGTGGAGGG - Intronic
929747826 2:44677299-44677321 AGGGACAGGGAAGAGATGTTTGG - Intronic
929968365 2:46552365-46552387 AGGGACAGGGAAATGCTGTTTGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930321945 2:49865919-49865941 AGGGAGAGGGAAATGGTAGAGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930697639 2:54428233-54428255 TTGGAGAGGGAAGTGGTGGCTGG + Intergenic
930763570 2:55061746-55061768 AGGGGCAGGGAAGTGCTGGGAGG + Intronic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930927124 2:56831819-56831841 AGGGAGAGGGGTGGGAGGGTAGG + Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931012736 2:57936012-57936034 GGGGAGAAGGAAGTGATGGTAGG + Intronic
931221860 2:60295631-60295653 AGGGAGAGGGATGTCAGGGAAGG - Intergenic
931549180 2:63424075-63424097 GGGGTGAGTGAAGTGATGGCAGG + Intronic
931838984 2:66128938-66128960 AGAAAGAGGGTAGAGATGGTCGG + Intergenic
933128035 2:78635620-78635642 AGGGAAAGGGAAGTGATGCAAGG - Intergenic
933207277 2:79521642-79521664 AGGAAGAGGTAAATGATTGTTGG + Intronic
933286680 2:80391884-80391906 AGGGAGTGGGAAAGGATGATGGG + Intronic
933349585 2:81136738-81136760 AGGCAGAGGGATGTGGAGGTTGG - Intergenic
933888787 2:86745564-86745586 AGGGAAAGGTAAATGATGGAAGG + Intronic
933997522 2:87680515-87680537 AGTGAGAGGGAAGGGAGGGGAGG + Intergenic
934097514 2:88620254-88620276 AAGGAGAGGGGAGAGAGGGTTGG - Intronic
934521515 2:95023020-95023042 AGGGGGAGGGAGGAGATTGTGGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935018945 2:99212132-99212154 AGGGAGAATGAAGTGATCATGGG - Intronic
935745995 2:106190780-106190802 GGGGAGAGGGAAATGGTGGCAGG + Intronic
936296330 2:111270397-111270419 AGTGAGAGGGAAGGGAGGGGAGG - Intergenic
936369859 2:111894871-111894893 AGGGACAGGGAGGTGAGTGTAGG + Intergenic
936824015 2:116558496-116558518 AGGTAGAAGGGAGAGATGGTAGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
936970270 2:118170081-118170103 AGTGAGAGGGAAGGGGTTGTGGG - Intergenic
937040956 2:118820291-118820313 AGGCAGAGGAAAGTGAGTGTGGG + Intergenic
938640186 2:133269592-133269614 AGGGAGAGGTCAATGAGGGTAGG + Intronic
939152223 2:138486602-138486624 AGGAAGAGGGAAGTGATCCAGGG - Intergenic
940739759 2:157493703-157493725 AGGTGGGGGGAAGTGAGGGTAGG - Intergenic
941404633 2:165073891-165073913 AGGGAGTGGGAAGTGTTGACTGG + Intergenic
941659069 2:168176517-168176539 AAGGAGAGGGAGGTGACGGAGGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941855685 2:170228048-170228070 AGGGACAGGGAAGTGAGAGGCGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943238205 2:185348964-185348986 AGATAGAGGGAAGGGATTGTTGG + Intergenic
943445150 2:187975932-187975954 TGGGGGAGTGAAGTGGTGGTGGG + Intergenic
943563867 2:189495044-189495066 TGGGGGAGGGAAGTCATGGGAGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944527279 2:200632418-200632440 AGGGAGAGGGATGTAAAGGGAGG - Intronic
944563441 2:200963876-200963898 AGGGAAAAGGAAGTGTTGTTTGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944687216 2:202128115-202128137 AGGGAGGGGGAAGGGAAGGAGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945268712 2:207917030-207917052 AGGGAGAGGGAAGAGCTATTAGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945392369 2:209279687-209279709 AGGAAGTGGGGAGTGCTGGTTGG - Intergenic
945440676 2:209875311-209875333 GTGGAGAGGGCAGTGATGGCAGG - Intronic
945555527 2:211270840-211270862 AGGGAGAGGGAAGTACTGATTGG - Intergenic
945855734 2:215067628-215067650 AGGGTGAGGTATGTGTTGGTTGG + Intronic
945918122 2:215726152-215726174 AGGGAGAGGGGAGGGAGGGAGGG + Intergenic
945978163 2:216286593-216286615 AGGAAAAAGGAAGTGATGATTGG + Intronic
946002902 2:216497979-216498001 AGGGACAGAGAATTGACGGTGGG + Intergenic
947181134 2:227412382-227412404 GGGGGGAGGTAAGTGTTGGTGGG - Intergenic
947201859 2:227621258-227621280 AGGTAGAGGCAAGTGGTGCTGGG + Intronic
947436067 2:230073411-230073433 AGGCAGAGGGAAGTGTCTGTAGG + Intergenic
947690537 2:232132137-232132159 AGGGAGAGGGAAAACATGTTTGG - Intronic
948272120 2:236682834-236682856 AGGCAGAGTGAAGTGGAGGTGGG + Intergenic
948547580 2:238743660-238743682 AGGGAGAGGTGAGTAAGGGTTGG + Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168778886 20:471941-471963 AGGGAGAAGGAGGAGACGGTAGG + Intergenic
1168953528 20:1818581-1818603 AGGGAGAGGGAGATAATGCTAGG - Intergenic
1168960203 20:1863872-1863894 AGGGAGAGGGAAGTGAGACAGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170427835 20:16252987-16253009 AAGGATGGGGAAGTGATTGTTGG - Intergenic
1170487050 20:16828898-16828920 GTGGAGAGGGTAGTGGTGGTCGG + Intergenic
1170675581 20:18477757-18477779 GGGGTGAGGGCAGGGATGGTAGG + Intronic
1170950323 20:20930785-20930807 GGGGATAGGGAGGGGATGGTGGG - Intergenic
1170950332 20:20930805-20930827 GGGGATAGGGAGGGGATGGTGGG - Intergenic
1170950341 20:20930825-20930847 GGGGATAGGGAGGGGATGGTGGG - Intergenic
1170950350 20:20930845-20930867 GGGGATAGGGAGGGGATGGTGGG - Intergenic
1170950359 20:20930865-20930887 GGGGATAGGGAGGGGATGGTGGG - Intergenic
1171497382 20:25565404-25565426 AGGGAGAGGGAAGAGAGGCAGGG + Intronic
1172088944 20:32413321-32413343 ATGGAAATGGAAGGGATGGTGGG + Intronic
1173294882 20:41747774-41747796 TGGGAGAGGGCAGGGAAGGTGGG + Intergenic
1173584641 20:44173432-44173454 AGGGAGAGGGAAATGTTGATTGG - Intronic
1173735768 20:45360261-45360283 AGGGAGAGGGAAATAAAGGAAGG - Intergenic
1173758605 20:45539927-45539949 AGAGAGAGGGAAGTGAAGGGCGG - Intronic
1173928727 20:46800398-46800420 AGAGAGACGGAAGGGATGGAGGG + Intergenic
1174215184 20:48911163-48911185 AGGGTCAGGGAAGTGCTGGTGGG - Intergenic
1174267293 20:49341096-49341118 GGGGAGAGGGAAGTGGGGGAGGG - Intergenic
1174410223 20:50330430-50330452 TGAGAGAGGGAAGGGATGGATGG + Intergenic
1174662787 20:52228816-52228838 ATGGACAGGGCAGTGAGGGTGGG - Intergenic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175051035 20:56155543-56155565 AGGGAGAGGAACCTGAGGGTTGG - Intergenic
1175413253 20:58785215-58785237 AGGGAGAGGGTGAAGATGGTGGG - Intergenic
1175483196 20:59326316-59326338 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175483212 20:59326382-59326404 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175483249 20:59326546-59326568 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175483291 20:59326712-59326734 AGGGAGAGGGCACTGCTGGGGGG + Intergenic
1175483314 20:59326811-59326833 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177283959 21:19023011-19023033 AGGGAGCAGCAGGTGATGGTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178462940 21:32819302-32819324 AGGGAGAGGGAAGCGGTGAGGGG - Intergenic
1178493380 21:33068325-33068347 AGAGAGAGGGAAGCCTTGGTAGG - Intergenic
1178928090 21:36792474-36792496 AGGGGGAGGGAAGGGATGGAAGG + Intronic
1179061467 21:37983188-37983210 AAGGAGAGGGAAGAGAAGGAAGG - Intronic
1179215897 21:39366895-39366917 AGGGAGAGGGAAGGGAAGAGAGG - Intergenic
1179468258 21:41592798-41592820 AGGGAGATGGAAGATATGGTCGG - Intergenic
1179944960 21:44666912-44666934 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1179946588 21:44682149-44682171 AGGCAGAGGGCAGTGATGTCTGG + Exonic
1180253519 21:46606023-46606045 TGGGAGAAGGACGTGATGCTGGG - Intergenic
1181426803 22:22849055-22849077 AGGGAGAGGGAGGGGGTGGTAGG - Intronic
1181530472 22:23514372-23514394 GGGCAGAGGGAAGAGAGGGTGGG - Intergenic
1182103324 22:27672141-27672163 AGGGGGAGGGGAGTGGGGGTGGG + Intergenic
1182357991 22:29730829-29730851 AGGGAGAAGGGAGTGAGCGTGGG + Exonic
1182583052 22:31326810-31326832 ATGCGGAGGGAAGTGATGTTTGG - Exonic
1183058068 22:35319095-35319117 AGGGTGAGGGAAGGAGTGGTGGG + Intronic
1183267760 22:36839778-36839800 ATAGAGAGAGAAGTGAGGGTAGG - Intergenic
1183337911 22:37261137-37261159 TGGGCCAGGGAGGTGATGGTGGG + Intergenic
1183436013 22:37795702-37795724 GGGGTGAGGGAAGAGATGGAAGG - Intergenic
1183579992 22:38718607-38718629 AGGGAGAGGGAAGTGCCAGCTGG + Intronic
1183697297 22:39430626-39430648 GAGGTGAGGGAGGTGATGGTGGG - Exonic
1184056159 22:42051338-42051360 GGGGAGAGGGAAGGGAGGGAGGG + Intronic
1184120362 22:42445938-42445960 AGGGACAGGGAACTGGGGGTAGG + Intergenic
1184753397 22:46502278-46502300 AGGGAAGGGGAAGGGAGGGTGGG + Intronic
1185229766 22:49673465-49673487 GGGGAGGGGGAAGGGAGGGTGGG + Intergenic
949121257 3:387320-387342 AGGCAGAGGGAAGGGAAGGCTGG + Intronic
949382842 3:3465050-3465072 GGGGAGAGGGAAATGAAGGGAGG + Intergenic
949512894 3:4782238-4782260 TGGGAGTGGGAAATGTTGGTGGG + Intronic
949692217 3:6653703-6653725 AGGGAGAGAGAAATTCTGGTTGG + Intergenic
949963629 3:9336209-9336231 AGGGAGAGAGAAGAGAGGGAGGG - Intronic
950433786 3:12966976-12966998 AGGGAGAGCGGAGAGTTGGTGGG - Intronic
950662542 3:14475516-14475538 ACGGAGAGGCAAGTGAGGCTCGG + Intronic
950920452 3:16688952-16688974 ATGGAGGTGGAAGTGGTGGTGGG + Intergenic
951125961 3:18983384-18983406 AGGGAGAGAGACATGATTGTGGG - Intergenic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951378584 3:21954786-21954808 GAGGAAAGGGAAGTGAGGGTGGG - Intronic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
952923846 3:38307435-38307457 AGGCTGAGGGAGGTGAGGGTAGG + Intronic
952979340 3:38722417-38722439 GGGGAGAGGTGACTGATGGTGGG + Intronic
953502241 3:43448341-43448363 AGGGGGAGGGAAGAGATGCAAGG - Intronic
953701157 3:45196785-45196807 CAGGAGAGGAAAGAGATGGTGGG + Intergenic
953753868 3:45630421-45630443 AGTGAGAGGGAAGTGTTTGTGGG + Intronic
953948616 3:47170335-47170357 AGGATGAGTGGAGTGATGGTTGG + Intergenic
954323814 3:49850569-49850591 AGGTGGAGGGAGGTGTTGGTAGG + Intronic
954461848 3:50631321-50631343 AGGGAGAGGGAGGACATGGGGGG + Intronic
955134358 3:56201144-56201166 AGGGAGATGGTAGTGAAGATAGG - Intronic
955211154 3:56942497-56942519 AGGGAGAGAGATGGGATGGTTGG - Intronic
955467842 3:59254878-59254900 GGGGAGAGGAAAGGGATGGCAGG - Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956163004 3:66374454-66374476 AGAGAGAGGGAATGGCTGGTTGG - Intronic
956170476 3:66429813-66429835 GGGGAGAGAGAAGAGATGGCGGG + Intronic
956230428 3:67009346-67009368 AGGTAGATGGAAGAGAAGGTTGG - Exonic
956334948 3:68153035-68153057 AAGGAGAGGGAATGGATGTTGGG + Intronic
956636459 3:71370065-71370087 AGGGTGAGGGAAATGATCCTAGG + Intronic
957560939 3:81820047-81820069 AGAGAGAGGGAAGAGGTGCTAGG + Intergenic
957887446 3:86306765-86306787 AATGAGAGGTAAGTAATGGTTGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958156714 3:89764130-89764152 AGGGAGGGTGAGATGATGGTTGG - Intergenic
958157792 3:89776506-89776528 AGTGGGAGGGAAGTGTGGGTTGG - Intergenic
959195448 3:103175004-103175026 AGGGAGAGGGGAGAGGTGCTAGG - Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
960905336 3:122595621-122595643 AGGGAGGGGGAAGTGGCAGTGGG - Intronic
961005290 3:123401389-123401411 AAGTAGAGGGATGGGATGGTAGG - Intronic
961121501 3:124375095-124375117 AGAGAGAGGGAAATGAGGGAAGG + Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
961254200 3:125533195-125533217 AGGGAGAGAGAAGGGAGGGAGGG - Intronic
961345309 3:126260191-126260213 AGGGAGGGGGAAGAGAAGGGAGG - Intergenic
961426766 3:126854670-126854692 AAGGAAAGGGATGTGATGATTGG - Intronic
961505305 3:127367063-127367085 GGGGAGGGGGAAGTGATTGATGG + Intergenic
961561221 3:127731716-127731738 AGGGAGAGGGAACTGTGGGCCGG - Intronic
962426205 3:135271331-135271353 AGTGAGAGGGGAGTGAGGGGCGG - Intergenic
962484712 3:135831184-135831206 AGGGGTAGGGAAGGGATGGTAGG - Intergenic
962685597 3:137844955-137844977 AGGGAGAGGGAGAGGATGGATGG - Intergenic
962868028 3:139464108-139464130 AGAGTAAGGGAAGTGATGCTTGG - Intronic
962921407 3:139953642-139953664 AGGGAGAGGGAAGGGGGAGTTGG - Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963019110 3:140855044-140855066 AGGGAGTGGGAAGTACTGATTGG + Intergenic
963194965 3:142516780-142516802 TGTGAGAGAGAAGTGATAGTTGG - Intronic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963572029 3:147009377-147009399 AGGGAGAGAAAAGTAATTGTGGG - Intergenic
963977922 3:151503810-151503832 AGGGAGAGGGGAGTGCTGCTTGG + Intergenic
964107602 3:153055908-153055930 AGGGAGAGAGAAAGGAAGGTAGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964437003 3:156663970-156663992 AGGTAAAGGGAAGTGATGTCAGG - Intergenic
964911680 3:161790274-161790296 AGAAAGAGGGAATTGATAGTGGG - Intergenic
965206937 3:165731771-165731793 AGGGAGGGAGAAAAGATGGTAGG - Intergenic
965443392 3:168744938-168744960 GTGGTGAGGGAAGTGAAGGTAGG + Intergenic
965485093 3:169268889-169268911 GGGGAGAGGGAATTGAGGGGTGG + Intronic
965535362 3:169818169-169818191 AGGGAGAGGAAAGTGACTGTGGG - Intergenic
966219496 3:177536217-177536239 TGGGAGAGTCAAGTGAAGGTGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967771766 3:193341620-193341642 AGGGAGAGGGGTCTGATGGAGGG - Intronic
968018085 3:195357236-195357258 GGGGAGAGGAAAGGGATGGGTGG + Intronic
968284498 3:197500150-197500172 AGGGAGAGAGAAAGGAAGGTGGG + Intergenic
968339228 3:197941221-197941243 AGGGAGAGGGAAGGGAAGGGAGG - Intronic
968339236 3:197941241-197941263 AGGGAGGGGGAAGGGAGGGCAGG - Intronic
969501123 4:7553805-7553827 GGGGAGAGGAAGGTGAAGGTGGG + Intronic
969591810 4:8126425-8126447 GGGGAGAGGGAAGGGAGGGGAGG - Intronic
969689230 4:8695010-8695032 AGGGAGAGGGCAGTGGAGGCGGG + Intergenic
970113880 4:12670988-12671010 AGGGAGTGGCAAGTGCTGGAAGG + Intergenic
970172751 4:13305739-13305761 AGGCGGATGGGAGTGATGGTGGG - Intergenic
970239434 4:13993013-13993035 AAGGAGAAGAAAGAGATGGTGGG - Intergenic
971487529 4:27175693-27175715 AGGGAGGGAGAACTGATGGTAGG - Intergenic
971703380 4:30008516-30008538 AGGTAGAGGAATGTGAGGGTTGG + Intergenic
972049795 4:34715340-34715362 AGGGAGAGGGAAGGGAGAGAGGG - Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972621467 4:40751263-40751285 AGGGAGAGGGAAATGATCATTGG - Intronic
972917796 4:43902973-43902995 AGGGGCAGGGAAGTGCTGGGAGG + Intergenic
972940134 4:44185930-44185952 CGGGACAGGGAAGTGCTGGGAGG + Intronic
973010850 4:45070565-45070587 AGGGAGAGGGACCTGGTGGGAGG + Intergenic
973051863 4:45608158-45608180 AGGGAGAGGTAAGTGCTGGGAGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
974289441 4:59911656-59911678 AGGGTGAGGGCTATGATGGTGGG + Intergenic
974965132 4:68750979-68751001 AGGGAGGGAGAGGTAATGGTTGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975495809 4:75034947-75034969 GGAGAGAGGGATGTGATGATTGG - Intronic
976311670 4:83619445-83619467 TGGGCTAGGGAAGTGATGCTGGG - Intergenic
977287024 4:95120772-95120794 AGGGGGAGGGAAGGGAAGGGAGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977767347 4:100815275-100815297 AGGAAGAGGGCAGTCTTGGTGGG - Intronic
978327338 4:107574720-107574742 AGGGACAGGGAAGTGCTGGGAGG + Intergenic
978399199 4:108313140-108313162 AGGGACAGGGAAAGGAGGGTAGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979074012 4:116247876-116247898 TGGAAGAGGGTAGTGAGGGTAGG - Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979983489 4:127286742-127286764 TGGGAGGAGGAAGTGCTGGTTGG - Intergenic
980199277 4:129634094-129634116 AGAGAGGAGGGAGTGATGGTAGG - Intergenic
980330838 4:131409002-131409024 AGGGGTAGGGAAGTGCTGGGAGG - Intergenic
980388061 4:132112202-132112224 AGGGTGAGGGCTATGATGGTGGG - Intergenic
980622263 4:135323075-135323097 AGGGGGAGGGAAGAGATGAAGGG + Intergenic
980932926 4:139198713-139198735 AGGGAGTGGGAAGTGCTGATTGG - Intergenic
980940345 4:139268133-139268155 AGGGGGAAGGAAGGGAGGGTGGG + Intronic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981086564 4:140689704-140689726 AGGGAGGGGGAAGGGAAGGAAGG - Intronic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981834860 4:149042847-149042869 AGGGTGAGGGCTGTCATGGTGGG + Intergenic
982798116 4:159669273-159669295 AGGGAGAGAAAAGTGAGTGTGGG - Intergenic
982835397 4:160115543-160115565 AGGGTGAGGGCTGTCATGGTGGG + Intergenic
983168521 4:164509410-164509432 AGGGTGAGAGAAGGGGTGGTTGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983734456 4:171040862-171040884 CGGGAGAGGGAAGTGGTGGGTGG + Intergenic
984598224 4:181696312-181696334 AGGGAGAGGGGAGAGAGGGGCGG - Intergenic
985140993 4:186840564-186840586 AGGGAGAGGGAGGAGAAGGAGGG - Intergenic
985208646 4:187568440-187568462 AGAGAGAGAGAAGGGATGGAGGG - Intergenic
986007351 5:3678887-3678909 GGGGAGGGGGCAGTGATGGAGGG - Intergenic
986069144 5:4265288-4265310 AGGGAGCGGCCAGTGATGCTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986126387 5:4886064-4886086 AGGCAGAGAGAAGTGAGGATGGG + Intergenic
986231480 5:5868194-5868216 GGGGAGAGTGAAGGGATGGATGG - Intergenic
986342289 5:6801070-6801092 AGTAAGAGGGAGATGATGGTTGG - Intergenic
986453180 5:7887117-7887139 AGGAAGTGGCAAGTGGTGGTTGG - Intronic
986629940 5:9762014-9762036 AGTGACAAGGAAGTGATGGTGGG - Intergenic
986772373 5:10985919-10985941 AGGGTGATGGAGGTGATGGTGGG - Intronic
986920775 5:12676678-12676700 TGGGAGAGGGAACTGGTGGGAGG - Intergenic
987153042 5:15060572-15060594 AGGGTGAGGGATATTATGGTAGG + Intergenic
987489047 5:18553811-18553833 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988848634 5:35156543-35156565 AGTGTGAGGAAAGTGTTGGTAGG - Intronic
989576151 5:42990579-42990601 AGGAAGAGAGAACTGATGGTAGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990780333 5:59353730-59353752 AGGGAGAGGGAAGGAAAGGCAGG - Intronic
990971847 5:61516231-61516253 AGAGAGAGGGAAGAGATGAATGG - Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991611448 5:68453918-68453940 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
992068418 5:73128158-73128180 AGGGAGTGGGAATTGCTGTTTGG - Intronic
992150181 5:73895006-73895028 AGGCTGAGGGAAGGGAGGGTGGG + Intronic
992219131 5:74554712-74554734 AGTCAGAGGGAAGAGCTGGTTGG - Intergenic
992400465 5:76406448-76406470 TGGAAGAAGGAAGTGATAGTAGG + Intronic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992930019 5:81633664-81633686 AAGGAGAGGGAAATGAAGCTGGG - Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993252514 5:85547858-85547880 AGGGAGAAGGAAGTGAGTGTAGG + Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
994414028 5:99445026-99445048 AGGGAGAGAGAAGTTATGAATGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994552534 5:101255794-101255816 AGGGAGAGAGAAGTGAGCGCTGG + Intergenic
995067953 5:107883537-107883559 TGGGAAAGGGAAGAGATGGGGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995324240 5:110872926-110872948 AGGGATGGGGAAGGGAGGGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996392329 5:122974842-122974864 AGGGTGAGGGCAATTATGGTGGG - Intronic
996437909 5:123455964-123455986 AGGGAAAGGGAAGTGAAAGGAGG + Intergenic
996485645 5:124030619-124030641 AGGTAGACAGAAGAGATGGTGGG + Intergenic
996614367 5:125422728-125422750 AGGCAGAGGGAGGTGGGGGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996695759 5:126393099-126393121 AGGGAAAAGGTAGTGAAGGTAGG - Intronic
997725143 5:136114042-136114064 AGGGTGAGGGCAGGGATGGAGGG - Intergenic
999334104 5:150700572-150700594 AGGGGGCGGGAAGCGAGGGTGGG + Intronic
1000057042 5:157616301-157616323 AGGAATATGGAAGTGATGGTTGG - Intergenic
1000089502 5:157917998-157918020 AGGGAGTGGGGAGTGCTGATTGG + Intergenic
1000419409 5:161021238-161021260 AGGGAGAGGATAGTGATGAGTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000962514 5:167616670-167616692 GGAGAGAGGGAGGGGATGGTGGG + Intronic
1001156375 5:169275865-169275887 TGGAAGAGGGAAGTCATGGGTGG + Intronic
1001461222 5:171916413-171916435 AGGGAGAGGGACAGGAGGGTGGG + Intronic
1001546081 5:172571132-172571154 AGGGAAAGGGAAGGGAAGGGAGG + Intergenic
1001799767 5:174532775-174532797 AGGGAGGAGGAGGTGATGTTTGG + Intergenic
1001950892 5:175815712-175815734 AGGGAGGGGCAAGTCATGGAAGG - Intronic
1002097218 5:176838673-176838695 AGGGAGAGTGTAGAGATGTTAGG - Intronic
1002134059 5:177097410-177097432 AGGCAGAGGGAGGTGGTGGGTGG - Intronic
1002161335 5:177315464-177315486 AGGGGTAGGGAAGGGCTGGTGGG + Intergenic
1002657945 5:180767848-180767870 TGGGAGACGGAAGTTGTGGTAGG - Intergenic
1002852669 6:1010509-1010531 AGGGAGAGGGGAGGGAGGGAGGG - Intergenic
1003136005 6:3435279-3435301 AGGGAGAGGGAAGGGAGGGGAGG - Intronic
1003394154 6:5739030-5739052 TGCCAGAGGGTAGTGATGGTGGG - Intronic
1003518450 6:6837064-6837086 AGGGAGAGGGGAGGGAGGGAGGG + Intergenic
1003669302 6:8141028-8141050 AGGGAGATGGAAGAGATAATGGG - Intergenic
1004260376 6:14102554-14102576 ACAGAGAGAGAAGTGATGCTTGG + Intergenic
1004673931 6:17823413-17823435 AGGGAGGGGGAAGTGGGGGGCGG - Intronic
1004721639 6:18272889-18272911 AGGAAGAGGGAAAGGCTGGTTGG - Intergenic
1005273334 6:24189704-24189726 AGGGAGAGAGAACTAATGGGTGG - Intronic
1005472856 6:26179077-26179099 AGGGAAGGGGAAGGGATGGGAGG + Intergenic
1005844543 6:29767229-29767251 AGGGAGAGGCAAGGGAGGGATGG - Intergenic
1005856662 6:29868031-29868053 AGGGAGAGGGAAGGGAGGGATGG - Intergenic
1006297367 6:33175819-33175841 AGGGATAGTGTAGTGATGGGAGG + Intronic
1006435154 6:34022222-34022244 AGGGAGAGGGGAGCAATGGCTGG + Exonic
1006449743 6:34099140-34099162 AGGGTGAGGGAAACGATGGCAGG + Intronic
1006488629 6:34366463-34366485 AGAGAGAGGGAAGGGAGGGAGGG + Intronic
1006501547 6:34462573-34462595 AGGGAGAGGGAGGAGGTGGGTGG - Intergenic
1006824762 6:36926588-36926610 AGGGAAAGGGAAGGGAGGGGAGG + Intronic
1006846071 6:37062432-37062454 ATGGAGAGGGAAGGGATGAGAGG - Intergenic
1006921271 6:37629124-37629146 AGGGCGATGGATGTGGTGGTGGG + Intergenic
1006945921 6:37784458-37784480 AGGGAGAGGGAGGCGGTGGGGGG + Intergenic
1007518448 6:42431861-42431883 AGGGGGAGGGACATGAAGGTGGG - Intronic
1007614122 6:43170687-43170709 AGGGAAAGGGAAGGGAAGTTGGG + Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1008520375 6:52357287-52357309 AGGGAGGGGGAAGTGAAGAGAGG + Intergenic
1008859095 6:56127769-56127791 AGTGGGAGGGTAGGGATGGTAGG + Intronic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009403903 6:63289750-63289772 AGGGAGATTGAAGAGATGTTTGG + Intronic
1009530525 6:64807961-64807983 AGGGAGAAGGAAGGGAAGGAAGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010501968 6:76611770-76611792 ATGGAGCTGGAAGTGATGGATGG - Intergenic
1010544281 6:77130678-77130700 GGGGAAAGGGAGGTGAGGGTGGG + Intergenic
1010575846 6:77529779-77529801 AGGGAGAAGGATGTGATAGGTGG - Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011447915 6:87462643-87462665 AGGAGGAGGGAAGTGATGGCTGG + Intronic
1011513091 6:88123052-88123074 AGGAAGAGGGGAGTGCTGATTGG - Intergenic
1011970912 6:93221334-93221356 AGGGAGATGGCAGTGAGTGTAGG - Intergenic
1012167346 6:95974060-95974082 AGTGAGGAGGAATTGATGGTGGG + Intergenic
1012506370 6:99951127-99951149 AGGGAGAGGAAAGTGGTGTTGGG + Intronic
1012875545 6:104721355-104721377 GAGGAGAGGGGAGTGATGGTGGG + Intergenic
1014785562 6:125614621-125614643 ATGGAGAGGGAAATGACTGTAGG - Intergenic
1015129736 6:129795651-129795673 AAAGAGAGGGACGTGGTGGTAGG + Intergenic
1015265821 6:131291224-131291246 AGTGAGAGGGAAATGATGGTTGG + Intergenic
1015366700 6:132403470-132403492 AGTGAGATGGGAGTGATGGAAGG - Intergenic
1015543389 6:134338583-134338605 AGGGAGAGGAGAGGGCTGGTGGG + Intergenic
1015571203 6:134623132-134623154 AGGGTAAGGGAGGTGGTGGTTGG - Intergenic
1015660580 6:135569911-135569933 AAGGAGAGGGAAGGGAGGATTGG - Intergenic
1015890822 6:137968050-137968072 TGGGAGATCAAAGTGATGGTGGG - Intergenic
1015907950 6:138136776-138136798 AGTGAGAGGGAAGTGCAGGAAGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017131728 6:151113629-151113651 AGGGTGAGGGAGGTGGTGGATGG + Intergenic
1017365758 6:153635805-153635827 AGGGAGAGGGAATGGATAATGGG - Intergenic
1017460567 6:154645960-154645982 AGTGAGAGAGAAGAGATGGCTGG + Intergenic
1017650389 6:156576169-156576191 GGGGAGAGTGAAGTGAGTGTGGG + Intergenic
1018632360 6:165832242-165832264 TGGGAGACAGAAGTGGTGGTGGG + Intronic
1018647736 6:165963728-165963750 AGCAAGAGGGGACTGATGGTGGG - Intronic
1019057679 6:169234973-169234995 AGTGAGAGGGAAGAGCAGGTGGG + Intronic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1020035105 7:4959521-4959543 GGGGAGCGGGAAGTGGTAGTAGG + Intergenic
1020283500 7:6663676-6663698 GGGGAGAGGGAAGGGATGTGGGG + Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021362377 7:19731801-19731823 TGGGAGAGGGAAGGGAGAGTAGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1022370866 7:29770117-29770139 AGGGAGAGGGAAAAGAAGGAGGG - Intergenic
1022423795 7:30248401-30248423 AGGAAGAGGGAAGAGAAGGAGGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023103089 7:36738789-36738811 AGGGAAAGGAAAGTGAGGGCAGG + Intergenic
1023359387 7:39400072-39400094 AAGGAGAGGGAAGAGAGGCTGGG - Intronic
1023609460 7:41958567-41958589 AGGGGAAGGGAAGGGAGGGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023739868 7:43269770-43269792 TGGGGGCGGGAAGTGAGGGTAGG + Intronic
1023741775 7:43287443-43287465 TGGGAGAAGGAAGTCATGGAAGG + Intronic
1023907135 7:44531022-44531044 AGGGAGAGGGAAGGCATCGAGGG - Intronic
1023910046 7:44547290-44547312 AGGGAGGGGGAAGGGAAGGAGGG + Intergenic
1023923901 7:44651064-44651086 AGGTAGGGGGCAGTGATGGAGGG + Intronic
1023931230 7:44707845-44707867 AGGGAGGGGGCAGTGAGGGCAGG - Intronic
1024335750 7:48203744-48203766 AGTGAAAGGGAAGTGAGGGTCGG - Intronic
1024688402 7:51773248-51773270 AGGTAGAGGGAAATAATGATGGG + Intergenic
1024991619 7:55239121-55239143 AGGGAGAAGGAAGGGAGGGAAGG - Intronic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025708341 7:63886931-63886953 TGGGAGAGGGAAGAGGTGGTGGG - Intergenic
1026428735 7:70322987-70323009 AGGGAGAGGGACATGTTGCTGGG - Intronic
1026613480 7:71881475-71881497 AGTTAGAGAGAAGTGATGATGGG - Intronic
1026977619 7:74508044-74508066 AGGGAGGAGGCAGTGGTGGTGGG - Intronic
1027362398 7:77422776-77422798 AGGGAGTGGGGAGTGCTGATTGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1027998192 7:85454336-85454358 AGGGAGAGGGATATAAAGGTGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029318708 7:99737973-99737995 GGGGAGAGGCAAGTGTTGCTTGG - Intergenic
1029323640 7:99786952-99786974 GGGGAGAGGCATGTGGTGGTTGG - Intergenic
1029435842 7:100563653-100563675 AGGGAGAGGGCAGGGTTGTTTGG + Intronic
1029450114 7:100636752-100636774 ATGGAGAGGGAAGAGAAAGTGGG - Intronic
1030226373 7:107156104-107156126 AGGGGGTGGGGAGTGAAGGTAGG + Intronic
1030319059 7:108145465-108145487 GGGGAGGGGGAGGTGGTGGTGGG + Intergenic
1030472456 7:109982262-109982284 AGGGAATGGGAAGTGCTGATTGG - Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031021763 7:116636217-116636239 GGGGAGGGAGAAGTGATTGTTGG - Intergenic
1031082760 7:117274509-117274531 AGGGACAGGGAAGTGACAGCAGG + Intergenic
1031210263 7:118815772-118815794 AGGGGGAGGGACTTGATGGGAGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031756136 7:125645395-125645417 AGGGAGGGGGAAGGGAGGGAGGG - Intergenic
1031913989 7:127545513-127545535 AGAGAGAGGGAACTGGTGGGAGG - Intergenic
1032582754 7:133118354-133118376 AGGGAGAAGGAAAGAATGGTAGG - Intergenic
1032722663 7:134563397-134563419 AGTTAGATGGGAGTGATGGTGGG + Intronic
1032864873 7:135915332-135915354 AGGGAGAGGCAAGTGCAGGCTGG + Intergenic
1033290752 7:140080781-140080803 AGGGAGAGATAATTGATGCTGGG - Intergenic
1033485765 7:141787570-141787592 AGGTAGATGTAAGTGACGGTGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033729304 7:144158933-144158955 AGGGAGGGGGAAGGGAGGGAGGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033982780 7:147186791-147186813 AAGCAGAGGGAAGTGAAGGAGGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034191655 7:149217827-149217849 AAGAAGAGGGAAGTGAAGGCAGG + Intronic
1034464399 7:151218004-151218026 AGGAAGAGGGGAGTGATGCAGGG - Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035776407 8:2191517-2191539 AGGGAGGGGGAAGGGAGGGAGGG - Intergenic
1035776421 8:2191547-2191569 AGGGAGGGGGAAGGGAGGGAGGG - Intergenic
1035776476 8:2191653-2191675 AGGGAGGGGGAAGGGAGGGAGGG - Intergenic
1036775815 8:11612536-11612558 GGGGAGTGGGTAGAGATGGTAGG + Intergenic
1037043199 8:14263870-14263892 AGCGAGAGGGAAGTAATTGCAGG + Intronic
1037094940 8:14974842-14974864 ATGAAGAGGGAAGTGATTTTAGG + Intronic
1038046375 8:23768801-23768823 AAGGAGAGGGAAGGGAAGGAGGG - Intergenic
1038075711 8:24071175-24071197 AGAGACTGGGAAGTGTTGGTGGG + Intergenic
1038194343 8:25352844-25352866 AGGATAAGGGAAGTGAGGGTGGG + Intronic
1038412506 8:27369160-27369182 AAGAAGAGGGAAGTGGAGGTTGG - Intronic
1038646481 8:29366168-29366190 AGGGAGAGGGAAGGAAGGGCAGG - Intergenic
1038898315 8:31812643-31812665 AGGGAAGGGGAAGAGATGGGAGG - Intronic
1039087636 8:33795750-33795772 AGTGAGAGGGTAGTGAAGGAGGG - Intergenic
1039425747 8:37484561-37484583 GGGAGGAGGGAAGTGCTGGTTGG - Intergenic
1039725879 8:40216049-40216071 AAGGAGAGGGAAGAGAGGGGTGG + Intergenic
1039848524 8:41343150-41343172 AGGGATAGGGAAGTGGGGGCCGG + Intergenic
1042468700 8:69159212-69159234 AAGGAGATGGAGGTGATGATGGG - Intergenic
1042665196 8:71196425-71196447 AGGGTGAAGGAAGTCATTGTGGG + Intergenic
1042748241 8:72131115-72131137 AGACAGAGGGAAGAGAGGGTGGG + Intergenic
1042790046 8:72595188-72595210 ACAGAGTGGGAAATGATGGTGGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044523592 8:93226708-93226730 AGGGGGAAGGGAGTGATGGAAGG + Intergenic
1044803770 8:95983752-95983774 AGGGAGAGGGAATGGAGGGGAGG + Intergenic
1044841360 8:96339608-96339630 ATGGAGGGGGATGGGATGGTAGG + Intergenic
1045047019 8:98288887-98288909 AGAGAGAGGGTTGTGATGGGAGG - Intronic
1045172659 8:99687634-99687656 CGGGAGAGAGTAGTGATTGTGGG - Intronic
1045227321 8:100261694-100261716 TAGGGGAGGGAAGTGTTGGTGGG - Exonic
1045391542 8:101719928-101719950 AGGTAGAGGGAAATGAGGGCAGG + Intronic
1045541880 8:103094428-103094450 AGGGAGGGGGAAGGGAGGGAAGG - Intergenic
1045773600 8:105774994-105775016 AGGGAGAGTGAAGGGCTGGGTGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046399973 8:113692079-113692101 AGGAAAAGGGAAGTTATTGTGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047676687 8:127210266-127210288 GGGGAGAGGGAGGAAATGGTAGG + Intergenic
1048032862 8:130649565-130649587 AGGAAGAGGGGAGTGAGGGTGGG - Intergenic
1048165917 8:132061348-132061370 AGGGAGAGGGAAAGGAAGGAGGG - Intronic
1049009316 8:139876720-139876742 AAGGAGAGGGAGGTGAGGCTGGG - Intronic
1049143912 8:140983645-140983667 AGAGAGAGGGAAGTGAAGGAAGG + Intronic
1050255121 9:3786037-3786059 AGGGGAGGGGAAGTGATGGAGGG - Intergenic
1050860160 9:10418742-10418764 AGGCAGAAGGAAGAAATGGTTGG + Intronic
1051037114 9:12761684-12761706 AGGGAGAGAGAATTGAAGGAAGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052368505 9:27639736-27639758 AGGGTGAGGGCTATGATGGTGGG + Intergenic
1053030954 9:34777461-34777483 AGGGCGAGGGCAGTGAAGTTGGG + Intergenic
1053108786 9:35438649-35438671 AGGGTGAGGGATGTGGTGGGGGG + Intergenic
1053618657 9:39794413-39794435 AGTGAGAATGAAGTGATGGCAGG - Intergenic
1053876834 9:42553775-42553797 AGTGAGAATGAAGTGATGGCCGG - Intergenic
1053895842 9:42740930-42740952 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054234863 9:62547947-62547969 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054265498 9:62913016-62913038 AGTGAGAATGAAGTGATGGCAGG + Intergenic
1054789908 9:69246995-69247017 AGTGAAAGGGAAGTGAATGTAGG - Intronic
1054912418 9:70466332-70466354 AGGGGCAGGGAAGTGCTGGGAGG - Intergenic
1055195532 9:73588184-73588206 CGGGAGTGGGGAGTGATGGGAGG + Intergenic
1055397882 9:75892573-75892595 AGGGAGAGGGAGGTGCTGGCTGG + Intronic
1055549442 9:77417928-77417950 AGAGACAAGGAAGTGATGGGAGG - Exonic
1056368392 9:85929374-85929396 AAGGAGAGGCTAGTGAGGGTTGG + Intergenic
1056608872 9:88112325-88112347 AGGTGTAGGGAAATGATGGTGGG - Intergenic
1056870156 9:90269688-90269710 AGGGAGAGGGAGGGGAGGGGAGG + Intergenic
1056881212 9:90395740-90395762 ACAGTGAGGGAAGTGATGGTAGG - Intergenic
1057074212 9:92127090-92127112 TGGGAGAGGGATGTGGTGGGAGG - Intergenic
1057424008 9:94934254-94934276 AGGGAGAGGGAAGGGAGGGAGGG - Intronic
1057982916 9:99680309-99680331 AGGGAGAAGTAAATTATGGTAGG - Intergenic
1058019758 9:100074980-100075002 AGGGTGAGGGCGATGATGGTGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058591640 9:106571674-106571696 TGGTGGAGGGAAGAGATGGTGGG - Intergenic
1058600542 9:106665167-106665189 AGGGAGAGGGAAGTAAAGCATGG - Intergenic
1059551065 9:115229590-115229612 AGGGAGGAGGAAGTAATGATTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059814765 9:117900102-117900124 AGAGAGAGGGAAGAGAAGGAAGG - Intergenic
1060142968 9:121226457-121226479 AGAGAAAGGGAACTGATGGATGG + Intronic
1060181506 9:121537650-121537672 AGTGGGTGGGAAGAGATGGTAGG - Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060408875 9:123386852-123386874 AGGGGGAGGGACCTGATGCTGGG + Intronic
1060486553 9:124051353-124051375 TGGGAGAGTGAAGTGGTGCTAGG + Intergenic
1060801267 9:126547336-126547358 AGGGAGGAGGAAGGGATGGGTGG - Intergenic
1060893582 9:127203561-127203583 TGGGTGAGGGAAGTGAGGCTGGG + Intronic
1061006391 9:127930677-127930699 CAGGAGAGGGAAGGGTTGGTGGG - Intronic
1061086822 9:128404541-128404563 AGGGAGATGGAAGAGAGTGTTGG - Intergenic
1061230891 9:129315340-129315362 AGAGAGAGAGGAGGGATGGTGGG - Intergenic
1061445126 9:130633318-130633340 AGGGAAAGGGGATGGATGGTGGG - Intronic
1061455273 9:130692909-130692931 AGGGAGAGGGTAGTGGGGGACGG + Intergenic
1061509164 9:131049956-131049978 AGGGAAAGGGCAGAGCTGGTCGG - Intronic
1061669027 9:132178198-132178220 AGGGAGAAGAAAATGAGGGTGGG - Intronic
1061949315 9:133927381-133927403 AGGCACAGGGAAGAGATGGGAGG + Intronic
1062201709 9:135306231-135306253 AGGGAGGGGGAAGGGAGGGAGGG - Intergenic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1062271628 9:135712536-135712558 GGGGAGAGGGGAGTGTTGGGGGG - Intronic
1062713461 9:137989374-137989396 GGAGAGAAGGAAGTGAGGGTGGG + Intronic
1185719501 X:2370948-2370970 AGGGACAGGCACGTGATGCTCGG - Intronic
1185749652 X:2600623-2600645 GGACAGAGAGAAGTGATGGTAGG + Intergenic
1186115191 X:6297905-6297927 AGAGAAAGGGAAGAGATGGGGGG + Intergenic
1186156953 X:6735648-6735670 AGGTGGAGGGGAGTGAAGGTTGG - Intergenic
1186701283 X:12092878-12092900 AGGGAATGGGAAGTGCTGGAAGG + Intergenic
1187294240 X:17983787-17983809 AGGGAAAGGGAGGAGATGGGAGG + Intergenic
1187445398 X:19356450-19356472 AGAGACAGGGAAGTGAGGGTGGG + Intronic
1187704279 X:21993921-21993943 AGGGGGAGGGAAGAGAGGGCAGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188376291 X:29432745-29432767 AGGGTAAGGCAAGTGATGGCAGG - Intronic
1188747316 X:33862171-33862193 AGGGAGTGGGGAGTGTTGATTGG + Intergenic
1188773125 X:34179027-34179049 AGGGAGAGGGATGTGAGTGTGGG - Intergenic
1188774562 X:34198294-34198316 AGGGAGAGGGAGATGAAGATAGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189750401 X:44214974-44214996 TGGGAGAGGGAACTGGTGGGAGG + Intronic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1190405362 X:50081413-50081435 AGGGGGAGGGGAGTGATAGCTGG - Intronic
1190708714 X:53050186-53050208 AAGGACAGTGAAGTGGTGGTGGG + Intronic
1190737628 X:53266283-53266305 TGGAAGAGGGAAGTGGGGGTGGG + Intronic
1191128303 X:56981855-56981877 AGGCACAGGGAATTGAGGGTGGG - Intronic
1191769630 X:64741193-64741215 AGGGTGAGGGATATTATGGTGGG - Intergenic
1192234864 X:69289358-69289380 AGGGAGGGGGCAGTGCTGGAAGG - Intergenic
1192365791 X:70472056-70472078 GGGGAAGGGGAAGTAATGGTAGG - Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192491607 X:71580247-71580269 AGGGAGTGGGAAGTGGGGGCGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193297649 X:79851604-79851626 AGGGTGAGGGAAATTATGGTGGG + Intergenic
1193335585 X:80285035-80285057 AGGGAGAGGGAAGTGTGCATGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194269894 X:91799747-91799769 AGGGAGATTGAACTGATAGTAGG + Intronic
1194921475 X:99771447-99771469 AGGGAGAAGGGAGTGAAGGTAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195270158 X:103220951-103220973 CGGGAGAGGGAAGGCAAGGTCGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1195882118 X:109603506-109603528 AGAGGGAGGGAAGTGAGGGATGG - Intergenic
1196026282 X:111044547-111044569 AGGGAGAGGGATGTGGCAGTGGG + Intronic
1196179188 X:112671600-112671622 AGGCAGAAGGAAGGGAAGGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196831921 X:119782595-119782617 AGGGAGAGGGACGTTGTGATGGG - Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197030595 X:121809192-121809214 AGGGACAGTGAAGTGAATGTGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197898457 X:131342361-131342383 AGGAAGAGGGCAGAGAAGGTGGG + Intronic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198301595 X:135339011-135339033 AAGGAGAAGGAAGTGAGGATTGG - Intronic
1198761561 X:140038345-140038367 AGGGAGAGGAAAGTGACTGTGGG + Intergenic
1198801155 X:140449057-140449079 GGGGGGAGGGAAGGGAAGGTTGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199776488 X:151016204-151016226 AGGGGGAGGGAAGAAATGATAGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199894919 X:152119264-152119286 AGGGATAGGGGGGTGAGGGTAGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200154992 X:153970520-153970542 AGGGTGAGGGAGGAGATGGAGGG + Intronic
1200155014 X:153970587-153970609 AGGGAGAGGGAGGAGATGGAGGG + Intronic
1200587136 Y:5021166-5021188 AGGGAGATTGAACTGATAGTAGG + Intronic
1200587138 Y:5021186-5021208 AGGGAGATTGAACTGATAGTAGG + Intronic
1201550221 Y:15210990-15211012 AGGGAGAGAGAAATGAAGGAAGG + Intergenic
1201697421 Y:16841091-16841113 AGGGAGGGGAAAGTGAGGGAAGG + Intergenic