ID: 904030872

View in Genome Browser
Species Human (GRCh38)
Location 1:27532700-27532722
Sequence CTGTGTTTAGGGAGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 1, 2: 10, 3: 57, 4: 584}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904030872_904030881 7 Left 904030872 1:27532700-27532722 CCCTCTCCCCTCCCTAAACACAG 0: 1
1: 1
2: 10
3: 57
4: 584
Right 904030881 1:27532730-27532752 CCAACAGAGCTAACTGCTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904030872 Original CRISPR CTGTGTTTAGGGAGGGGAGA GGG (reversed) Intergenic
900438234 1:2641335-2641357 CCGTGATTAGGGCTGGGAGAGGG + Intronic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
901210860 1:7525274-7525296 GTGTGTGTAGGGGGGTGAGATGG - Intronic
901436557 1:9250444-9250466 GTGTGTGTAGGGTGGGGAGTGGG - Intronic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
902670419 1:17969393-17969415 CTGGGTTCAGGAAGGAGAGAAGG + Intergenic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
902824288 1:18962357-18962379 TTGTTTTTTGGGAGGAGAGATGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903674931 1:25057610-25057632 CTGTCCTTAGGGAGAGGGGAGGG - Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904234047 1:29102332-29102354 TACTGTTTATGGAGGGGAGAAGG + Intronic
904384307 1:30131542-30131564 CAGTGTCTAGGCATGGGAGAGGG - Intergenic
904737257 1:32644044-32644066 CTTGGTTTAGGAAGGGGAGGGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905054052 1:35077892-35077914 CTGTGTTTAGGTAGCGGGCAAGG + Intronic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907194990 1:52679276-52679298 CTGTGCTCAGGCAGTGGAGAAGG + Intergenic
907314049 1:53557145-53557167 TGGTGTTTCGGGAGGTGAGAGGG - Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907520887 1:55022570-55022592 CTGCGTTTATGGAGGAGAGAAGG - Intergenic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
910419311 1:87040273-87040295 CTCTGTTCAGGGAGCGGGGAGGG - Intronic
910903813 1:92151701-92151723 GGGGATTTAGGGAGGGGAGAAGG - Intergenic
911185027 1:94894595-94894617 CTGTTTTTGGGAAAGGGAGATGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912938957 1:114028227-114028249 TTGTGATTAGGAAGGGAAGAAGG - Intergenic
912954609 1:114145984-114146006 CTGTGATTAGGGGAGGCAGAGGG + Intronic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914898267 1:151696301-151696323 TTTTGTTTAGAAAGGGGAGAAGG - Exonic
915147464 1:153803524-153803546 AAGAGTTGAGGGAGGGGAGATGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915662118 1:157413138-157413160 CAGTGTTTTGGGAGAGGAAATGG + Intergenic
915819452 1:159006269-159006291 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916311018 1:163399037-163399059 CTGTGCTCTGGGAGGGGAAATGG - Intergenic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
921250759 1:213295771-213295793 ATGTGTTTAGGAAGGGGCAATGG + Intergenic
921620612 1:217322326-217322348 ATGTGTTTTGGGAGGAGTGAAGG + Intergenic
921628175 1:217401805-217401827 CTGTTTTTTGGGGGGGTAGAGGG - Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923120392 1:230984641-230984663 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
923259876 1:232258359-232258381 CTGTGGTGAGGGGAGGGAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923671221 1:236042913-236042935 CTGCCTCCAGGGAGGGGAGATGG + Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1063982966 10:11470871-11470893 GTGTTTTTAGGGAGAGGAAAGGG - Intronic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067936385 10:50615754-50615776 ACTAGTTTAGGGAGGGGAGAAGG - Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1068566631 10:58583044-58583066 CTAAGTTTAGGGTGGGGTGATGG - Intronic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1071587744 10:86841784-86841806 CAACATTTAGGGAGGGGAGAAGG + Intronic
1071767870 10:88689388-88689410 CTCTGTTTATGGAAGGGTGAAGG + Intergenic
1072872033 10:99130619-99130641 CTTGGTTTAGGAAGGGGAGGGGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1073345081 10:102776836-102776858 CTGTGTTGGGGGTGGGGTGAGGG + Intronic
1073347514 10:102794991-102795013 CTGTATTTAGAGGAGGGAGAAGG + Intronic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1073436412 10:103519307-103519329 CTCTCTTTTGGGAGGGGACAGGG - Intronic
1073452181 10:103616570-103616592 CTGTGATTAGGCCTGGGAGAGGG + Intronic
1073995156 10:109307155-109307177 CTTGGTTTAGGAAGGGGAGTGGG + Intergenic
1073997036 10:109327386-109327408 TTGTATTTAGGGAGAGGAGGAGG - Intergenic
1074447601 10:113533322-113533344 GTGTGTTTAAGGAATGGAGAGGG + Intergenic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075054549 10:119207662-119207684 GCGTGTTGAGGGAGGGGGGAGGG + Exonic
1075516705 10:123114634-123114656 GTGTGTTGCGGGAGGGGACAGGG - Intergenic
1075745194 10:124722529-124722551 CTGTCTTCAGGGAGCGGAAATGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076195429 10:128514210-128514232 CTGTCTCTAAGGAGGGGAAAGGG - Intergenic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077135423 11:995746-995768 CTAGGTGGAGGGAGGGGAGAGGG - Intronic
1077166002 11:1139213-1139235 CGGGGTGTAGGCAGGGGAGATGG + Intergenic
1077240832 11:1509634-1509656 CTTTTTTTGGGGAGGGGTGATGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077601523 11:3578054-3578076 ATGTGTTTATGGTGGGGAGGCGG - Intergenic
1077873255 11:6281123-6281145 CTTGGTTTAGGAAGGGGAGTGGG - Intergenic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1079980730 11:27149321-27149343 ATGAGTTTAGGGAGGGGCCAGGG - Intergenic
1080058765 11:27934615-27934637 CTGGGTTTAGTTAGAGGAGAAGG + Intergenic
1080226689 11:29969611-29969633 CTGTGTTTAGGAATGTTAGAAGG + Intergenic
1080942612 11:36936823-36936845 CTGTCTCTAGTTAGGGGAGAAGG - Intergenic
1081073768 11:38642758-38642780 CTCTGTTTAAGGAGACGAGAAGG - Intergenic
1081757604 11:45555793-45555815 CTGTGTCTTGGAAGGGTAGAGGG + Intergenic
1082126268 11:48434736-48434758 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082559854 11:54605564-54605586 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082672800 11:56056228-56056250 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083789916 11:64977812-64977834 CTGTGCTCAGGGAGGGTTGAAGG - Intergenic
1083904367 11:65660454-65660476 CTGTGTTTAGAGAGTGGAAAAGG - Intronic
1084253659 11:67922954-67922976 CTGTGTTTAAGGTGAGAAGAGGG - Intergenic
1084257430 11:67952623-67952645 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1084815340 11:71642631-71642653 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1085462253 11:76701190-76701212 CTGTATCTAGGAGGGGGAGAAGG + Intergenic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087398771 11:97637285-97637307 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1087676594 11:101169601-101169623 ATGTGTATAGGGTGAGGAGAAGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088795294 11:113262277-113262299 CTGTGCTTAGGGATTGGGGATGG - Intronic
1089117427 11:116107279-116107301 CTGTCTTTATTGAGGGGCGAAGG - Intergenic
1089402870 11:118174672-118174694 GAGTGTTTGGGGTGGGGAGATGG - Intronic
1089760193 11:120717438-120717460 CAGTGCTTAGGGATTGGAGAAGG + Intronic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1092228486 12:6764272-6764294 CTCTCTTTAGGGCGGGGAGAAGG + Intronic
1092428933 12:8394388-8394410 ATGTGTTTATGGAGGGGATGTGG - Intergenic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1093149190 12:15601770-15601792 CTGTGTTGGGGTAGAGGAGAGGG - Intergenic
1093173254 12:15882535-15882557 CCGAGGTTAGGGAGGGGTGAGGG - Exonic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098933584 12:76450789-76450811 TTTTGTTTTTGGAGGGGAGAAGG - Intronic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100900209 12:99231204-99231226 CTGTGTTTTGGGAGGGCTGTGGG + Intronic
1101333832 12:103778934-103778956 CTGTGTTTAGGTTTGGGAGATGG - Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1102191681 12:110993470-110993492 CTGGGGTGAGGGAGGGGTGAGGG - Intergenic
1102538444 12:113600190-113600212 CTGCCTTGAAGGAGGGGAGATGG - Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103346218 12:120252103-120252125 CTGGGTTTGGGGTGGGGAGGTGG - Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1104768782 12:131346934-131346956 CCGTCTTTAGGGAAGGGAAAAGG + Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1106186545 13:27414828-27414850 CTGTCTTGAAAGAGGGGAGAAGG + Intergenic
1106410067 13:29505514-29505536 ATGTGTTTCGGGAGCGGTGATGG - Exonic
1107020383 13:35745070-35745092 CTGTGCTGAGGAAGGGGAGGAGG + Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1109237411 13:59842121-59842143 CTGGGTTTAGGCAGGGAATATGG - Intronic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1110597131 13:77331504-77331526 AGGAGTTTGGGGAGGGGAGATGG - Intergenic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112214661 13:97417905-97417927 ATTTGTTGAGGGAGGGGAGGAGG - Intergenic
1112319244 13:98392110-98392132 CTGCCTCTGGGGAGGGGAGAAGG - Intronic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113587747 13:111476859-111476881 CTGAGATTTGGGAGGGGACACGG - Intergenic
1114472714 14:22974776-22974798 CTGCCTTTGGGGAGGGGATAGGG - Intronic
1114887849 14:26877048-26877070 ATGTATTTATGGAGGGGAAAAGG - Intergenic
1118022675 14:61734761-61734783 ATGAGATTAGGGAGGGGGGAGGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1120999684 14:90442739-90442761 AAGTGTTTAGGGAGGGGGCAGGG + Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1122127279 14:99586195-99586217 CTGGGTGTAGGGAGGGGCGGGGG - Intronic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122357565 14:101132712-101132734 CTGTCTCCAGGGAGGTGAGAGGG - Intergenic
1122424557 14:101598305-101598327 CTGTGTTTCGGCCGGGGAGGGGG + Intergenic
1122474578 14:101998161-101998183 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474597 14:101998255-101998277 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1122474615 14:101998349-101998371 CAGCGTTTATAGAGGGGAGAGGG - Intronic
1123152578 14:106197128-106197150 CTAGGTTTAGGAAGGGGAGAGGG + Intergenic
1123981556 15:25609322-25609344 CTCTGTTTGGGGAGAGGAAAAGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126791143 15:52222389-52222411 CTCAGTTTAGGGAGAGGAGGGGG + Intronic
1126921368 15:53529334-53529356 CTGAGTTTAGGGAAGTGAAACGG - Intronic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1128087213 15:64894577-64894599 CTGTCTTGAGGAGGGGGAGAGGG + Intronic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1130138528 15:81202467-81202489 GTGGGTGTAGGGAGGGGGGAGGG - Intronic
1130346274 15:83048608-83048630 CTGTGTTTGGATAGTGGAGAGGG - Intronic
1130944146 15:88538484-88538506 CTTGGTTTAGGAAGGGGAGGGGG - Intronic
1130945206 15:88546072-88546094 CTTGGTTTAGGAAGGGGAGGGGG - Intronic
1130985562 15:88842515-88842537 CTGTGCTCAGGTAGGGGGGAGGG - Intronic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1132147730 15:99438346-99438368 CTGTTTTGGGGGTGGGGAGAGGG + Intergenic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133351288 16:5102342-5102364 ATGTGATGAGGGAGGAGAGATGG + Intergenic
1134049911 16:11130291-11130313 CCGTGTTCAGAGAAGGGAGAAGG - Intronic
1134193245 16:12138705-12138727 CTGTGTTTATGGATGAGAGGAGG + Intronic
1134294849 16:12936443-12936465 CTCAGTTCAGGGATGGGAGAAGG + Intronic
1135869972 16:26140697-26140719 CTGTCTTTGGGTAGGGGAGAAGG - Intergenic
1136073807 16:27804839-27804861 CTGGGATTGGGGACGGGAGAGGG + Intronic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1137006281 16:35276665-35276687 CTTTGTTTAGAAAGGGGAGGGGG + Intergenic
1137568812 16:49551374-49551396 GTGTATTTTGGGAGGGGGGATGG - Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137881187 16:52050208-52050230 ATGTGTTTAGGGTGGGTAGGGGG + Intronic
1139038758 16:62979157-62979179 TTGTGTTTAGGGAGTGGAGTAGG - Intergenic
1139239446 16:65375901-65375923 GTGTCTTTAGGGAGGGGAAGAGG - Intergenic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1144180338 17:12745715-12745737 CTTTGTTTAGGGAGATAAGAGGG - Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144741444 17:17584831-17584853 CGGTGCTCAGCGAGGGGAGATGG - Intronic
1144781989 17:17812986-17813008 CTGAGACTAGGGTGGGGAGAGGG - Intronic
1145065137 17:19757017-19757039 CTGTGATTACGGAGCAGAGACGG - Intergenic
1145244878 17:21262160-21262182 CTGCGTGTAGGGAGAGGATAGGG - Intergenic
1146008921 17:29179350-29179372 CTTTGTTTTGGGGGTGGAGATGG - Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146462460 17:33057025-33057047 GTGTGTTTAAGGAGGTGGGAAGG + Intronic
1146640157 17:34534481-34534503 CTGGGATTAGGGAGGGGATGGGG - Intergenic
1146820825 17:35982645-35982667 CTCTGTTTATGGAGGTGACAAGG + Intergenic
1147109622 17:38252407-38252429 CAGTGTAAAGGGAGGGGACAGGG + Intergenic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1147403695 17:40195692-40195714 AAGTGCTGAGGGAGGGGAGAGGG + Intergenic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1147444468 17:40466518-40466540 CTGGCTTTTGGGAGGGGAGGTGG + Intergenic
1147594085 17:41705585-41705607 CTGTGTTCACGGTGGGGAAAAGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148419827 17:47535660-47535682 CAGTGTAAAGGGAGGGGACAGGG - Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1151114967 17:71725259-71725281 CCGTGTTCAGGGATGTGAGATGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151595876 17:75077810-75077832 CTGCGTTTTGGGAGGTGGGATGG - Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1154355847 18:13622720-13622742 CTGTGTTTTGAGAGAGGACAGGG + Intronic
1154370905 18:13762321-13762343 TTGTGTTCAGGGAGAGGAGCTGG + Exonic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155790134 18:29956812-29956834 TTATGTTTAGGGAAGGGATAGGG + Intergenic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1155971110 18:32084563-32084585 GTGTGTTTGGGCAAGGGAGAAGG + Intergenic
1156104829 18:33647505-33647527 TTGTGATTAGAGAGGGGAAAAGG + Intronic
1156443672 18:37218044-37218066 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
1156646312 18:39166148-39166170 CTATCTTCAGAGAGGGGAGAAGG + Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1157011129 18:43650232-43650254 CTGTGTTTTGGGAGAGAGGAAGG + Intergenic
1157013650 18:43682567-43682589 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1157418795 18:47527551-47527573 CTGGGTTTAGGTGGAGGAGATGG + Intergenic
1157675824 18:49567989-49568011 CTGTGCTGAGGGTGGGGAGGGGG + Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159406582 18:68010470-68010492 CAGTGGTTCGGGAAGGGAGACGG - Intergenic
1159453442 18:68631593-68631615 ATGTGATTTGGGAGGGGTGAGGG + Intergenic
1160451455 18:78969235-78969257 CTGTCTATAGAGAGGGGATAAGG - Intergenic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160962326 19:1728432-1728454 CTGAGTTTAGGGGGTGGAGAAGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161650833 19:5483693-5483715 CAGTGTTTAGGGAGGTGAGGCGG + Intergenic
1161994941 19:7706259-7706281 CTGGGGTTACGAAGGGGAGAAGG + Intergenic
1162095200 19:8306122-8306144 CAGGGTGTAGGGAGGAGAGAGGG - Intronic
1163240330 19:16058857-16058879 CTGTGATTTGGGAGTGTAGAGGG + Intergenic
1163872650 19:19835795-19835817 CTGTGTTTAGAGAGTAGTGAGGG - Intergenic
1164785122 19:30924381-30924403 GTGTGTTTGGGGTGGGGAGGAGG + Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166299544 19:41906269-41906291 CTGGGTTTAGGGTTGGGACAGGG - Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167884497 19:52489092-52489114 CTTTTTTTAGGGGGGGCAGACGG - Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168673118 19:58256441-58256463 CTAGGTTTAGGAAGGGGAGAGGG + Intronic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
926274995 2:11396827-11396849 GTGTGCTGAGGGAGGGGTGATGG + Intergenic
926300114 2:11596374-11596396 ATGTGTATAGTGAGGGGGGACGG + Intronic
926688082 2:15714100-15714122 TTGTTATTAGGAAGGGGAGATGG - Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927755093 2:25702029-25702051 CTGGGATTTGGGAGGGCAGAGGG + Intergenic
928111844 2:28516895-28516917 GCGTGTGTATGGAGGGGAGAGGG + Intronic
928807413 2:35176517-35176539 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
929048816 2:37816742-37816764 CTGAGGTTAGGAAGGGGTGACGG - Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
932201904 2:69836052-69836074 CTGTGTTCATAGAGTGGAGAAGG + Intronic
932429934 2:71668072-71668094 CTGGGTTTTGGAAGAGGAGAAGG + Intronic
933136636 2:78743571-78743593 CTGTGTTTGGGGAGCAGAGTTGG - Intergenic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
934935405 2:98461636-98461658 GTGTCTTAAGGGAGGGGACATGG - Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935359252 2:102233572-102233594 TTATATTTAGGGAGGGGAGGGGG - Intronic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
936229579 2:110688454-110688476 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
936735707 2:115440623-115440645 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
938099108 2:128486144-128486166 ATGTGCTTTGGGAGGTGAGAGGG + Intergenic
938344357 2:130556725-130556747 CTGTCTTCAGGGAGGTGAAAGGG + Intergenic
938345476 2:130563997-130564019 CTGTCTTCAGGGAGGTGAAAGGG - Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
942945474 2:181667534-181667556 CAATGTTGAGGGAGGGGAAAGGG + Intronic
944650851 2:201828878-201828900 GCATGATTAGGGAGGGGAGAGGG - Intronic
945001638 2:205357175-205357197 GTGTGTTGTGGGAGGAGAGAAGG + Intronic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
945943789 2:215974785-215974807 CTGTGTTTAGGAACTGGAGCAGG - Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947402101 2:229741668-229741690 ATGGGTTTTGGGTGGGGAGAGGG - Intergenic
947658668 2:231850115-231850137 CTGCCTCCAGGGAGGGGAGAGGG + Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947741491 2:232486937-232486959 GTGTGTGCAGGGAGGGGACAGGG - Intronic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169595233 20:7190923-7190945 GTGAGTATAGGGATGGGAGATGG + Intergenic
1169927637 20:10799500-10799522 CTGGGATTAGGGAAGGGAGAGGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170816724 20:19720483-19720505 GTGTTTTTAGGGAGGAGAGAAGG + Intronic
1171972327 20:31572202-31572224 CTGTGTTGAGGAAGAGGAGGGGG + Intronic
1172056792 20:32159799-32159821 CTGTCCTTAGGGAGGGGCCAGGG - Intronic
1172497081 20:35395205-35395227 CTGACTTTTGGAAGGGGAGAGGG - Intronic
1172569546 20:35958781-35958803 CTGTGGTTAGGGATAGGGGAAGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1173188069 20:40856562-40856584 GTGTGTTCAGTGTGGGGAGAGGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1174263492 20:49314525-49314547 TTGTCTTTAGGGAGAGGAGCTGG - Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175461581 20:59155667-59155689 CTGAGTGTAGGAAGGAGAGAAGG + Intergenic
1175564070 20:59958868-59958890 CTAGGCTAAGGGAGGGGAGAGGG + Intronic
1175901327 20:62361011-62361033 CTGGGCTGGGGGAGGGGAGATGG - Intronic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1178260848 21:31098525-31098547 CAGTGTTTAGGAATAGGAGAGGG - Intergenic
1178391884 21:32205570-32205592 GTGTGTTTTGGGGGTGGAGAGGG + Intergenic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179308861 21:40179350-40179372 CTGAGTTCAGGGAGGGGTGATGG + Intronic
1179486644 21:41714836-41714858 CTTGGTTTAGGAAGGGGAGGGGG - Intergenic
1181507203 22:23367677-23367699 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1181577491 22:23804546-23804568 CTTTTTTTTGGGAGGGGAGATGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181867433 22:25869782-25869804 GTGTGTTTAGGGTGGGCTGAGGG - Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182819562 22:33203578-33203600 TTGTTTATAGTGAGGGGAGAGGG + Intronic
1182966905 22:34530574-34530596 GTGTGTTTGGGGCGGGGAGTGGG + Intergenic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1183847502 22:40554276-40554298 CTGTGATTTGGGAGGGGCCAGGG + Intronic
1184060452 22:42078146-42078168 TTGCGTTTTGGGAGGGGACATGG + Exonic
1184249577 22:43252585-43252607 CGGGGTTCCGGGAGGGGAGAAGG - Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
951359775 3:21711613-21711635 GTGTTTTTGGGGATGGGAGATGG - Intronic
951460397 3:22945534-22945556 CTGGAATTAGGGAGGGAAGACGG + Intergenic
952143117 3:30501507-30501529 CAGTCTTTTGGGAGGGGATAAGG - Intergenic
952331489 3:32367830-32367852 GAGTGTTTAGGGAGAGGGGAGGG - Intronic
954967279 3:54622953-54622975 CTGTGATTAAGAAGGGGAGGAGG + Intronic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
955570340 3:60298252-60298274 CTGACTCTAGGGAGGGGAGAGGG - Intronic
955968609 3:64414079-64414101 CAGTGTTCAAAGAGGGGAGAAGG - Intronic
956877670 3:73479708-73479730 CTGGGGTCAGGCAGGGGAGATGG - Intronic
956911497 3:73822290-73822312 CTGTGTTTTGGAATGCGAGAAGG + Intergenic
957072368 3:75577110-75577132 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
957609583 3:82449708-82449730 ATGTGATTTGGGAGGGGACAGGG + Intergenic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
959105316 3:102058692-102058714 AAGCCTTTAGGGAGGGGAGAGGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
960386840 3:117030670-117030692 CTTTGTATAGGTAGGGGACATGG - Intronic
961549840 3:127663020-127663042 GTGTGTTTTGGGGAGGGAGAAGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
962083675 3:132167587-132167609 ATGTGTTCAGAGAGGGGAGGAGG + Intronic
962471039 3:135709303-135709325 CTGTTTTTTGGGAGGAGGGATGG - Intergenic
963007256 3:140737822-140737844 TTGTGTTGAGGGACGTGAGATGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964818838 3:160747706-160747728 CTCAGTTAAGTGAGGGGAGAAGG - Intergenic
965026109 3:163303774-163303796 TTCTGCTTAGGGAGAGGAGAGGG + Intergenic
965104707 3:164341522-164341544 CTTGGTTTAGGAAGGGGAGGGGG + Intergenic
965149328 3:164949695-164949717 ATGTGTTTATGGAGGGGTGTGGG + Intergenic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967049059 3:185765443-185765465 CTGAGATTAAGGAGGGGAGGTGG - Intronic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
967816432 3:193802878-193802900 TAGTGTTTAGGGTGGGGAGGTGG - Intergenic
967948971 3:194825618-194825640 CAGTGTTGAGGGAGGACAGATGG - Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969042395 4:4309508-4309530 CTGTCTTTGGGGAGAGGAGTAGG + Intronic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969457734 4:7309773-7309795 CTGTGTCCAGGCTGGGGAGAGGG + Intronic
969474644 4:7414590-7414612 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
969737990 4:9003929-9003951 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
970885409 4:20982825-20982847 TTGTGTTTAATGTGGGGAGATGG - Intronic
971701544 4:29984186-29984208 TTCTGTTTAAGGAGAGGAGAAGG + Intergenic
972279115 4:37585635-37585657 AGGTGTTGAGGGAGGGGAGGAGG + Intronic
974010840 4:56606007-56606029 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
975801029 4:78058955-78058977 CAGTGCTTAGGGAGGGGGAAGGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976082881 4:81375683-81375705 TTCTGTTTAAGGAGAGGAGAGGG - Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977832719 4:101613374-101613396 CTTTTTTTTGGGGGGGGAGATGG - Intronic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
981584435 4:146285938-146285960 CTGTGTTTTGAGTGGTGAGAAGG + Intronic
981584444 4:146286010-146286032 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584450 4:146286058-146286080 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584487 4:146286318-146286340 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584490 4:146286342-146286364 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584496 4:146286390-146286412 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584499 4:146286414-146286436 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584511 4:146286506-146286528 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584514 4:146286530-146286552 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584516 4:146286554-146286576 CTGTGTTTCGAGTGGTGAGAAGG + Intronic
981584546 4:146286746-146286768 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584557 4:146286838-146286860 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584573 4:146286982-146287004 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584576 4:146287006-146287028 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584579 4:146287030-146287052 CTGAGTTTAGAGTGGTGAGAGGG + Intronic
981584584 4:146287078-146287100 CTGTGTTTCGAGTGGTGAGAAGG + Intronic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982424318 4:155239452-155239474 TTGGCTTTAGGGAGGGGGGAGGG + Intergenic
982442296 4:155451385-155451407 CAGGGATTAGGGAGGAGAGAGGG - Intergenic
982708589 4:158737261-158737283 CTGTCGTAAGGGAGGGGAAAGGG + Intergenic
983106897 4:163697676-163697698 CTGTGTCTAAGGACAGGAGATGG + Intronic
983469806 4:168142313-168142335 TTGTGTTAGGGAAGGGGAGAGGG - Intronic
984099991 4:175473181-175473203 CTTGGTTTAGGAAGGGGAGTGGG + Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
986885294 5:12226442-12226464 CTCTGCTTAAGGAGAGGAGATGG - Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
987903834 5:24050432-24050454 CTCTGCTTAAGGAGAGGAGAGGG + Intronic
989629638 5:43468105-43468127 CTTGGTTTAGGAAGGGGAGTGGG + Intronic
990471392 5:56119418-56119440 CAGGGCTTAGGGATGGGAGAGGG + Intronic
990923841 5:60996443-60996465 TTCTGTTTAAGGAGAGGAGAGGG - Intronic
991258084 5:64637452-64637474 CTGTGTGGAGGGAGGGGACTAGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992130419 5:73686306-73686328 CTGTTTTGAGGTAGGGGAGGAGG - Intronic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993803218 5:92371389-92371411 CTGTGTTCAGTGACGGGATAGGG - Intergenic
994414238 5:99448041-99448063 CAGTGTTCAGGGATGGGTGAGGG - Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995774762 5:115713101-115713123 ACGTGTTTTGGGAGGGGAGCCGG - Intergenic
996144084 5:119952013-119952035 CTGTGTTTAAGGGGCAGAGAAGG + Intergenic
996266222 5:121543999-121544021 CCTGGTTTAGGGAGGGGATAGGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997843787 5:137267131-137267153 TTGTGTTTTGGGAGGTGAAAAGG - Intronic
998031120 5:138868985-138869007 GGGTGTTTTGGGAGGGGGGAGGG - Exonic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998434443 5:142095610-142095632 CTGTGTTTTGGAAGGGAGGAGGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999768678 5:154758032-154758054 TTGAGTTTAAAGAGGGGAGAAGG - Intronic
1000641254 5:163704895-163704917 TTGTGTTTAGCCAGGGGTGATGG + Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001617160 5:173051906-173051928 CTGTGTTTAGTGATGGGCGGGGG - Intergenic
1001922831 5:175613941-175613963 CTGTGTTCAGAGAGTGGAGGAGG + Intergenic
1002021786 5:176368268-176368290 CTGTGTATAGGCAGGGCAGGGGG + Intronic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1003145400 6:3505985-3506007 AGGTCTTTAGGGAGAGGAGATGG + Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1005010582 6:21331800-21331822 CTGTGTTTAAGGTGGGTACAGGG - Intergenic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1005990588 6:30899465-30899487 GTGTGTCCAGGAAGGGGAGAAGG - Intronic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006321881 6:33323975-33323997 TTGTGTTTAGGGAGGCTGGAGGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007178694 6:39913280-39913302 ATGGGTTGAGGGAGGGAAGAAGG - Intronic
1008217151 6:48806639-48806661 CTGTCTTTAGAGACTGGAGAGGG + Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008979343 6:57465188-57465210 CTGTCTTCACGGAAGGGAGAAGG - Intronic
1009052920 6:58299875-58299897 GTGTGTTTAGGTGGGTGAGAGGG + Intergenic
1009167476 6:60358180-60358202 CTGTCTTCATGGAAGGGAGAAGG - Intergenic
1009773983 6:68180868-68180890 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1010324643 6:74550560-74550582 TTCTGCTTAGGGAGAGGAGAAGG - Intergenic
1010356019 6:74934601-74934623 CTGTTTTGAGATAGGGGAGAGGG + Intergenic
1011785227 6:90836266-90836288 CTGTGCTTAGCAAGGGGACAGGG + Intergenic
1012535629 6:100293231-100293253 ATGGGTCTTGGGAGGGGAGAGGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015847924 6:137540706-137540728 CTGTGTGTAGGAAGGAGAGGAGG + Intergenic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017349515 6:153423121-153423143 CTGGGCTTAGGTAGGAGAGAAGG + Intergenic
1017707013 6:157132765-157132787 CTTCAATTAGGGAGGGGAGAAGG - Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019281874 7:204697-204719 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019281902 7:204839-204861 CAGTGTTCAGGGAGGGGAAGTGG + Intronic
1019878615 7:3838650-3838672 CTGTGTTCAGGGACGGGGGCTGG - Intronic
1020461094 7:8431041-8431063 CTCTTTTTTGGCAGGGGAGAGGG - Intergenic
1020743789 7:12055523-12055545 CTGTCTTTAGAGAGTGGGGATGG - Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1020979991 7:15054799-15054821 CTTGGTTTAGGAAGGGGAGCGGG - Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021859723 7:24894558-24894580 CTGTGCTTGGGGCGGGGAGGGGG + Intronic
1022518998 7:30993950-30993972 CTGTGTTTAGCTAAGGGAGTGGG - Intergenic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1024678223 7:51657216-51657238 CTACCTTCAGGGAGGGGAGAGGG + Intergenic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1026197826 7:68188241-68188263 GTGTGTGTTGGGAAGGGAGAGGG - Intergenic
1026443148 7:70460968-70460990 CTGGGTTTGGGAAGGGCAGAAGG + Intronic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1026562837 7:71464551-71464573 TTGTGCTGAGGGAGGGAAGATGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1032977456 7:137241938-137241960 CTGTGTTGAGAGAGGTGAGGGGG - Intronic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1033997568 7:147370033-147370055 CTGTGTTTGGGGAGAGGCAAGGG - Intronic
1034026526 7:147710349-147710371 CTGTGTTTCAGGAGTGGTGATGG - Intronic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034760235 7:153665533-153665555 TTCTGTTTTGGGAGGGGAGGGGG + Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035656756 8:1313771-1313793 TTATGTCTGGGGAGGGGAGAAGG + Intergenic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1036069342 8:5423499-5423521 CTGTGCTTAGGGAGCTGAGGTGG - Intergenic
1036257719 8:7218837-7218859 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036258969 8:7225834-7225856 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036307652 8:7613677-7613699 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036309768 8:7677433-7677455 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036311022 8:7684430-7684452 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036358506 8:8061678-8061700 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036359768 8:8068686-8068708 ATGTGTTTATGGTGGGGAGGTGG + Intergenic
1036444495 8:8809753-8809775 TTGTGTTTTGTGAGAGGAGAGGG - Intronic
1036461711 8:8959502-8959524 ATGAGTTTTGGGAGGGGATAAGG - Intergenic
1036537619 8:9665903-9665925 ATGAGGTTAGGGAGGGGAAAAGG - Intronic
1036891192 8:12598284-12598306 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1036892452 8:12605274-12605296 ATGTGTTTATGGTGGGGAGGTGG - Intergenic
1037043269 8:14264267-14264289 GTGTGTTTAAGGAAAGGAGAAGG + Intronic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037251097 8:16895152-16895174 CTGAATTTAGGTAGAGGAGATGG + Intergenic
1037575925 8:20202821-20202843 CTGGGGTGAGGGAGGGGATATGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038483066 8:27914916-27914938 CTGGGATCAGGGAAGGGAGAAGG - Intronic
1039469187 8:37803015-37803037 CTGTGATTAGGGAGGGGGAGTGG + Intronic
1039713495 8:40083479-40083501 CTGTGTTTACAGTGGAGAGAGGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040890107 8:52308659-52308681 CTGTGTCCAGGGAGGTGAGTGGG + Intronic
1041008496 8:53518728-53518750 TTATTTTCAGGGAGGGGAGAAGG + Intergenic
1042128374 8:65561749-65561771 CTGAGTTTAGGTGGGGGAGTGGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043527288 8:81111279-81111301 CTGTGTTTACGTTGGGGTGAAGG - Intronic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1046750429 8:117920948-117920970 GTATGTTTAGGGAGGGACGAGGG - Intronic
1046785678 8:118263811-118263833 CTGTGGTCAGGCAGTGGAGATGG + Intronic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1047762073 8:127961791-127961813 CCTTGTTTAGGGAGTGGGGATGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049444643 8:142624407-142624429 CTGTCCTTAGGGAGGGCCGAGGG - Intergenic
1049963571 9:758772-758794 CGGGGTTGAGGGAGGGGATATGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1050615880 9:7401308-7401330 CTGTATTTAAAGAGGAGAGAGGG - Intergenic
1051618127 9:19026514-19026536 CTGTGGTTAGGTGGGGGAGTGGG - Intronic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1055206600 9:73738247-73738269 CAGGGGTTAGGGAGGAGAGAGGG - Intergenic
1055259186 9:74412547-74412569 CTGTGTTGAGGGAGGGGGCAGGG + Intergenic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057652628 9:96931802-96931824 CTGTGTGTTGGGCCGGGAGAGGG - Exonic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1058210843 9:102167818-102167840 CTGGGTTGAGGGAGGAGAGGAGG + Intergenic
1058827292 9:108786578-108786600 CAGAGCTTAGGGAAGGGAGAAGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059919878 9:119148008-119148030 GTGTGTCTAGGAAGTGGAGATGG - Intergenic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061005659 9:127927473-127927495 CTGTGTTTAGGGGTGGGATCGGG - Intronic
1061008270 9:127940775-127940797 CTGTCTTTAGGGAGGTGATAAGG - Exonic
1061723257 9:132566817-132566839 CTGTGATGAGGGAGGTGGGAAGG - Intronic
1061963315 9:133998963-133998985 ATGGGTTGAGGGATGGGAGAAGG - Intergenic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1185576077 X:1173426-1173448 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186229144 X:7434456-7434478 CCTCGTTTAGGGAGGGTAGAGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188593808 X:31872085-31872107 CTGTGTTCAAGGTGGGGGGAGGG - Intronic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1189156045 X:38757643-38757665 TTGTGCTTAGGGAAGGGTGAAGG - Intergenic
1189655129 X:43237092-43237114 CCATGTTTGGGGAAGGGAGAGGG - Intergenic
1189862397 X:45286914-45286936 CTGTGTTTGGGAAGGAGGGAAGG + Intergenic
1190276771 X:48904241-48904263 CGGTGGTAAGGGAGGAGAGAAGG + Exonic
1190322785 X:49188324-49188346 CTGGGTTTGGGCAGTGGAGAGGG - Exonic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1191778952 X:64846622-64846644 CTGATTTTGGGGAGGAGAGAGGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1193515051 X:82452373-82452395 CTGTGTTGAGGGGAGGGAGCTGG - Intergenic
1193939945 X:87670165-87670187 GTGTGTTAAGGGAGGGGATTAGG - Intergenic
1195706627 X:107742338-107742360 CGGTGTTTAGGAAGGGGGGAGGG + Intronic
1197681115 X:129386463-129386485 ATGTCTTTAGGCAGGGAAGAGGG - Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1200040168 X:153359265-153359287 ATGAGATTTGGGAGGGGAGAGGG + Intronic
1200845795 Y:7831408-7831430 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1202033446 Y:20604499-20604521 CGGGGTTGGGGGAGGGGAGAGGG + Intergenic