ID: 904031029

View in Genome Browser
Species Human (GRCh38)
Location 1:27533500-27533522
Sequence CAGGGTAGACAGAAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 601}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904031019_904031029 15 Left 904031019 1:27533462-27533484 CCAAAGTTTACCAAAGCAGGGAG 0: 1
1: 1
2: 1
3: 12
4: 185
Right 904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG 0: 1
1: 0
2: 6
3: 61
4: 601
904031021_904031029 5 Left 904031021 1:27533472-27533494 CCAAAGCAGGGAGGAAACATTTG 0: 1
1: 0
2: 1
3: 26
4: 289
Right 904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG 0: 1
1: 0
2: 6
3: 61
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904031029 Original CRISPR CAGGGTAGACAGAAAGGGGA GGG Intergenic
900000645 1:13073-13095 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900020358 1:183592-183614 CTGGGTCGACAGACAGGGGCTGG + Intergenic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900297968 1:1961783-1961805 CAGGGAAGAGAGGAAGGAGACGG + Intronic
900785884 1:4650225-4650247 CAGGGAAGCCCCAAAGGGGAGGG - Intergenic
900804296 1:4757208-4757230 CAGGGGAGGCGGAAAGGGGAGGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901535771 1:9882199-9882221 GCTGGTAGAGAGAAAGGGGAAGG + Intronic
902006481 1:13236370-13236392 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902025534 1:13380755-13380777 AAGGGGAGTTAGAAAGGGGATGG + Intergenic
902392986 1:16116905-16116927 CTGGGGAGACAGCAAGGGGTGGG - Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
903135860 1:21308821-21308843 CTGGGCAGGCAGGAAGGGGAGGG - Intronic
903382860 1:22909000-22909022 CCTGGGAGACAGAAAGAGGAGGG - Exonic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903996027 1:27306112-27306134 CAGGGTACACGTATAGGGGAGGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
906170769 1:43723090-43723112 GAGGGAAGAGAGAGAGGGGAGGG - Intronic
906651810 1:47518123-47518145 CTGGGTAGAGAGTGAGGGGAGGG - Intergenic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
907460231 1:54601450-54601472 CAGGGCAGAGAGGGAGGGGAGGG - Intronic
907466924 1:54644347-54644369 CAGGAAAGAAAGAAAGGGAAGGG - Intronic
908184399 1:61638576-61638598 CAAGGGGGAGAGAAAGGGGAGGG + Intergenic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
909473626 1:76057526-76057548 CAGGGTGGGAAGCAAGGGGAGGG - Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910105517 1:83627603-83627625 ATGGGTATAGAGAAAGGGGAAGG + Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
911054167 1:93696576-93696598 CATGGAAGACAGAATGGAGAAGG - Intronic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
912644422 1:111378643-111378665 CTGGGTTGAGAGAGAGGGGAAGG - Intergenic
913087127 1:115449485-115449507 GAGGGGAGACAGGAAGGGAAGGG - Intergenic
913508794 1:119543787-119543809 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913511903 1:119569755-119569777 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913516136 1:119607069-119607091 CAGAGTAGACTGAATGTGGAGGG - Intergenic
914235477 1:145806660-145806682 AAGGCAAGAGAGAAAGGGGAGGG - Intronic
914474205 1:148009902-148009924 GAGGGAGGAAAGAAAGGGGAAGG + Intergenic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
916078306 1:161216020-161216042 CAGGGTTGATAGAAAGTGGCAGG + Intronic
916142997 1:161715799-161715821 CAGGCTAGACAGAAAGAGACGGG - Intergenic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
916893562 1:169137664-169137686 GAGGGAAGACAAAAAGGGAAAGG - Intronic
917082309 1:171268669-171268691 CAGGGGAGGGAGAAAGGAGAAGG - Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917499607 1:175574260-175574282 CAGGGTGGGGAGAAAGGAGAAGG - Intronic
917655600 1:177122520-177122542 TAGGGAAGAGAGAAAAGGGAGGG - Intronic
918077340 1:181180685-181180707 CAGGGCAGAAACAATGGGGAAGG - Intergenic
918128707 1:181606464-181606486 CAGGGTAGATGTAATGGGGAGGG - Intronic
918181151 1:182086779-182086801 CAGGGTTGACAGGAAGGGACAGG + Intergenic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
918543656 1:185658612-185658634 CATGGTAGACAGAATGAGGGTGG - Intergenic
919011050 1:191963546-191963568 AAGGGTAAATAGAAAGGGAAAGG - Intergenic
919110888 1:193217436-193217458 TAGGGGAGCCAGAAAGGGGATGG + Intronic
919275452 1:195409314-195409336 CAGAGGAGGCAGAAAGGGAAGGG + Intergenic
919724122 1:200871142-200871164 CAGTGGGGACAGAAATGGGAGGG - Intergenic
919845922 1:201642099-201642121 AAGGGAAGAAAGAAAGAGGAAGG - Intronic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921572952 1:216800371-216800393 CAGGCTGGACAGAAAAGGGAGGG + Intronic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
923232306 1:231998420-231998442 CAGGATAGAAAAAAAGGTGATGG + Intronic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
1063777891 10:9284811-9284833 CAGGGTAGAAAGAAAGGAGGTGG - Intergenic
1064247554 10:13681164-13681186 GAAGGTAGAGAAAAAGGGGAGGG - Intronic
1064364182 10:14692205-14692227 CTGGGTGGAAAGAAAGGAGAAGG + Intronic
1064553929 10:16529386-16529408 CAGGGTGGAGAGATAGGGGAAGG - Intergenic
1064554055 10:16530653-16530675 CAGGGTGGAGGGATAGGGGAAGG - Intergenic
1065071130 10:22024718-22024740 CTGGGAAGACAGAAAAGGGTGGG - Intergenic
1065307835 10:24385097-24385119 CAGGCAGCACAGAAAGGGGAGGG + Intronic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1065683930 10:28265000-28265022 TAGGGTAGACAGACAGGACAAGG + Intronic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066435423 10:35393006-35393028 CACAGGAGACAGCAAGGGGAGGG - Intronic
1067052542 10:43030310-43030332 CAGGCTAGACAGACAAGGGATGG + Intergenic
1067704960 10:48599718-48599740 CAGGCTAGTGGGAAAGGGGAGGG - Intronic
1067911129 10:50348019-50348041 TAGGGTAGGGGGAAAGGGGAGGG - Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069883256 10:71607266-71607288 CAGGGAAGACAGGAAGGGCCAGG + Intronic
1070068118 10:73058154-73058176 AAGGGAAAAAAGAAAGGGGATGG + Intronic
1070363845 10:75716997-75717019 ATGGGGAGAGAGAAAGGGGATGG - Intronic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070763522 10:79042435-79042457 AAGGGAAGAGAGAGAGGGGAAGG + Intergenic
1070784779 10:79156531-79156553 CATGGGAGAGAGAAAGGTGAGGG + Intronic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071143668 10:82542064-82542086 GTGGGTAGAGGGAAAGGGGAGGG - Intronic
1071361615 10:84851804-84851826 CAGGGTACTGAGCAAGGGGAAGG - Intergenic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073054773 10:100692310-100692332 AATGGTTGACAGCAAGGGGAAGG - Intergenic
1073063434 10:100745358-100745380 CAGGGGAGGGAGAAATGGGAGGG - Intronic
1073616763 10:105004205-105004227 CAGGATGGACAGAGAAGGGATGG + Intronic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1074565028 10:114569745-114569767 CAGGGTAGCAAGAATGGTGAAGG + Intronic
1074858582 10:117491915-117491937 CAGGGTATACAGAAACTGAAAGG + Intergenic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1077391338 11:2301962-2301984 AAGGGCAGGCAGGAAGGGGAGGG - Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077716132 11:4582238-4582260 CAGGGTTGTCATAAAGGGAAAGG + Intergenic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1077901987 11:6497234-6497256 CGGGGGAGCCAGAAAGAGGAGGG - Intronic
1078911149 11:15733370-15733392 CAGGTAAGACAGAGAAGGGAAGG + Intergenic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1081329368 11:41785345-41785367 CATGGTAGAGAGAAAAGGGTTGG + Intergenic
1081588961 11:44407657-44407679 CAGGGCAGAGAGAAAGGAGCTGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082803375 11:57430845-57430867 CACAGTAGACAGGAAGGGGATGG + Intergenic
1083148337 11:60774697-60774719 CAGTGATGACAGAAAGGGGCTGG + Intronic
1083533782 11:63449927-63449949 GGGGGTGGGCAGAAAGGGGAGGG - Intergenic
1083731029 11:64652778-64652800 CAGGATGGCCAGAGAGGGGAAGG + Intronic
1083744572 11:64728213-64728235 CAGAGCAGCCAGAAAGGGAAAGG + Intronic
1084147024 11:67270415-67270437 CAGGGAAGCCAGAAAGGGGCAGG - Intronic
1084793658 11:71490468-71490490 CAGAGTTGACAGGCAGGGGAGGG + Intronic
1085295150 11:75427331-75427353 CAGGGTGGCCAGACATGGGAAGG - Intronic
1086022630 11:82250163-82250185 CAGGTTAGAAGGAAAGGTGAAGG - Intergenic
1086911182 11:92474498-92474520 CTGGGCATACAGGAAGGGGAAGG + Intronic
1087047177 11:93851794-93851816 CAAGGCAGAAAGAAAGGGGGAGG - Intergenic
1087677090 11:101175682-101175704 GTGGGGAGCCAGAAAGGGGATGG - Intergenic
1088072090 11:105799555-105799577 CAGGGTAGACATAAAGGATTTGG + Intronic
1088993578 11:114976401-114976423 CAGTGGAGACAGACATGGGAGGG + Intergenic
1089104127 11:115987908-115987930 CTGGGTAGACAGAGAGGAGTAGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089418936 11:118316453-118316475 AAGGGAAGAAAGAAAGAGGATGG + Intergenic
1089500743 11:118929899-118929921 AAGGGTAGCCAAAAAGTGGAGGG - Intronic
1089545128 11:119218308-119218330 CTGAGGAGACAAAAAGGGGATGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090352891 11:126118870-126118892 CAGAGAAGACAGAGAGGTGAGGG - Intergenic
1090754791 11:129780316-129780338 CAGAGGAGACAGAAAGGGATGGG - Intergenic
1090996453 11:131870188-131870210 CACAGTAGAAAGAAAGTGGATGG + Intronic
1091088179 11:132744027-132744049 CAGGGTAGACACAAATGCCAAGG - Intronic
1091192442 11:133706889-133706911 AAGGGGGGACAGAAAGGGAACGG + Intergenic
1091214429 11:133891954-133891976 GAGGGTAGACAGAGAAGAGAAGG - Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091373737 12:13200-13222 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1092167606 12:6352597-6352619 CAGGGTATACAGAACTGGGATGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092646736 12:10582514-10582536 CGGGGTAGAGGGCAAGGGGAGGG + Intergenic
1096123384 12:49103015-49103037 CAGGCTAGAAGGAAAGGGAATGG - Intronic
1096177520 12:49532762-49532784 CAGGACAGACAGAAAAGGAAAGG - Intergenic
1097100774 12:56587580-56587602 CAGGCTGGAGAGAAATGGGATGG - Exonic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1097841523 12:64326207-64326229 CAGGGTAGAGAGGAGGGGGGTGG + Intronic
1097975754 12:65684481-65684503 CAGGGTAGAGGAAAAGGGGATGG - Intergenic
1099258995 12:80352639-80352661 CAGGGAAAAGAGAAAGGGAAGGG - Intronic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099708065 12:86182482-86182504 CAGGCAAGACAGAATGGGAAAGG - Intronic
1100110660 12:91238172-91238194 GAGGGTGGGGAGAAAGGGGAGGG - Intergenic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1100420043 12:94423969-94423991 CAGGCTGGAGAGAAATGGGATGG + Intronic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101594885 12:106155463-106155485 CTGGGTAGCAAGATAGGGGAAGG - Intergenic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102028923 12:109728928-109728950 CTGGGAAGACTGAAAGGAGATGG - Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102748006 12:115267139-115267161 CAGGGTAGAGTAAAAGGTGATGG + Intergenic
1102910860 12:116712939-116712961 CAGGGTAGAAAGCAAGGGCGGGG + Exonic
1103674408 12:122644378-122644400 TAGGGGAGCCAGAAAGGAGATGG + Intergenic
1103800958 12:123536874-123536896 AAAGGAAGAAAGAAAGGGGAGGG - Intergenic
1103848547 12:123916237-123916259 CAGGGTAGAGAGGAAAGGAAGGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104066849 12:125313600-125313622 GAGGGGAGAGGGAAAGGGGAGGG - Intronic
1104172420 12:126294882-126294904 CAGGGCTGACACAAAGTGGAAGG + Intergenic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104566268 12:129887223-129887245 CACGGTAGACAGGGAGGGGCGGG - Intronic
1104742503 12:131188754-131188776 CTGGGCAGGCAGAAAGGGGTGGG + Intergenic
1105305706 13:19167320-19167342 CAGGGAAGACAGAAAGGCAGAGG + Intergenic
1107765271 13:43727585-43727607 GCGGGTAGACAGAAAGGGCCAGG + Intronic
1107896992 13:44975190-44975212 CAGGGTAGAGTGAAAAGAGAAGG - Intronic
1108163967 13:47672633-47672655 CAGAGTTTACAGCAAGGGGAGGG + Intergenic
1109272390 13:60268831-60268853 CAGAGTAGTGAGAAAGGGGAAGG + Intergenic
1111323215 13:86657713-86657735 CAGTAAAGACAGAAAAGGGAGGG - Intergenic
1112009179 13:95279777-95279799 AAGAGAAGGCAGAAAGGGGATGG + Intronic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112531327 13:100206742-100206764 CAGGGAAGAGAGGAAGGGGAAGG - Intronic
1112836639 13:103522795-103522817 CAGGGTAGGGGGAAAGGTGAGGG + Intergenic
1112837996 13:103539581-103539603 TAGGTTAGACAGAAAGGGGAGGG + Intergenic
1113664671 13:112132959-112132981 CAGAGCAGACACACAGGGGATGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1114306342 14:21426821-21426843 CAGTGTTGACAGAAAAGTGATGG - Intronic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116773293 14:49151664-49151686 CATAGTAGAGAGAGAGGGGATGG - Intergenic
1116898584 14:50340507-50340529 AAGGGTAGAGAGAAAGGAAAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118137098 14:63042142-63042164 CAGAGCAGAGAGAAAGGGGTGGG - Intronic
1118277092 14:64394891-64394913 GAAGGTAGAAAGAATGGGGAAGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1119044819 14:71309216-71309238 CAGGGAAGACTCAAAGGGCAAGG + Intergenic
1119697313 14:76723560-76723582 CATGGTATATAGGAAGGGGATGG + Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1121095948 14:91218094-91218116 CAGGGAAGAGAGATGGGGGAGGG + Intronic
1121780449 14:96618782-96618804 GAAGGGAGACAGAAAGGTGAGGG - Intergenic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122721709 14:103725972-103725994 AAAGGTAGACAGAAACAGGAAGG - Intronic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125181226 15:36882616-36882638 CAGGGAGGACAGCAAGGGAAAGG - Intergenic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1127906537 15:63380296-63380318 TAGGGAAGAAAGGAAGGGGAGGG + Intronic
1128905829 15:71466837-71466859 CAGTGTAGCTAGAAAGGGGCTGG - Intronic
1129574082 15:76721920-76721942 CAGGGCAGTCAGACAGGAGAAGG - Intronic
1129778941 15:78256518-78256540 CAGGGTAGAGTGAACGTGGAAGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131511555 15:93051939-93051961 CAGGGCAGAGACAAAGGGCAGGG + Intronic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131692129 15:94838586-94838608 CAGGGTAGAGAGAGAGAGGTGGG + Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1132012523 15:98288393-98288415 CAGGGAAGACAGACAAGTGAGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132452862 15:101977872-101977894 CTGGGTCGACAGACAGGGGCTGG - Intergenic
1132454033 16:12754-12776 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1132908919 16:2298611-2298633 TAGGGGAGACAGAGAGGGGGTGG - Intronic
1133440550 16:5817600-5817622 GAGGGGAGAGAGAAAGGAGAGGG + Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1134291078 16:12903028-12903050 CAGGCGAGCCCGAAAGGGGAGGG + Intronic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135518565 16:23156080-23156102 AAGGGAAGACAGGAAGGGAAAGG + Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138183606 16:54959913-54959935 CTCTGGAGACAGAAAGGGGAAGG - Intergenic
1139391078 16:66606342-66606364 CATAGGAGACAGGAAGGGGAGGG + Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1143005160 17:3827070-3827092 AAGGGTAGGGGGAAAGGGGAAGG + Intronic
1143503688 17:7352585-7352607 GAGGGCAGCCAGAGAGGGGAAGG - Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1144027591 17:11292277-11292299 CAGAGTAGGGGGAAAGGGGAGGG - Intronic
1144065691 17:11622215-11622237 CAGGGAAGACAAAGATGGGAAGG + Intronic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146686635 17:34845597-34845619 CAGGGAAGACAGAGAAGCGACGG + Intergenic
1147376590 17:40026333-40026355 TAGGGGAGACGGAAAGGTGATGG + Intronic
1147533092 17:41298589-41298611 CGGGGGAGCCAGAAGGGGGATGG - Intergenic
1148085253 17:44990084-44990106 CAGGGAAGAAAGAAAAGGAAGGG - Intergenic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148394194 17:47295379-47295401 GAGGGGAGCCAGAAAAGGGAGGG - Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149546868 17:57510303-57510325 CAGGGTAGGAAGAAACGAGAGGG - Intronic
1150956926 17:69869451-69869473 GAGGGTAGGAGGAAAGGGGAGGG + Intergenic
1150977369 17:70103623-70103645 CAGAGTAGTTAGAAAGGAGAAGG - Intronic
1151429822 17:74054961-74054983 AAGGAGAGAGAGAAAGGGGAGGG - Intergenic
1151430494 17:74059319-74059341 CAGGTTATAAAGAAAGGGAAGGG + Intergenic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1153101389 18:1474160-1474182 CAGGGCAGGCAGGTAGGGGAAGG - Intergenic
1153703212 18:7717415-7717437 AAGGGGAGACAAAAAGGGGATGG - Intronic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157643392 18:49241713-49241735 CAGGGTAGGGAGAAAAAGGAGGG + Intronic
1158789361 18:60758093-60758115 GAGGGTAGAGAGTAAGGAGAAGG + Intergenic
1158870611 18:61683954-61683976 AACGGCAGACAGAGAGGGGAGGG - Intergenic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1162781105 19:13007431-13007453 CAGGGCAATCAGAAATGGGAGGG - Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163012543 19:14434539-14434561 CCGGGGAGACACAAAGGGGCCGG - Intronic
1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG + Intergenic
1163775175 19:19213138-19213160 CAGGGCAGGCAGGAAGGGGTGGG + Intronic
1163776136 19:19219008-19219030 CAGGGTAAAGAGACAGGGCAGGG - Exonic
1164111443 19:22163175-22163197 TAAGGTAGACAGCAAGGGAAGGG + Intergenic
1164238175 19:23356582-23356604 CGGGGAAGAGTGAAAGGGGAAGG + Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165847420 19:38827120-38827142 GAGGGGAGGGAGAAAGGGGAGGG + Intronic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1166332450 19:42086800-42086822 CAGGAAAGAGAGGAAGGGGAGGG + Intronic
1166704988 19:44903549-44903571 CAGGGTGGACTGACCGGGGATGG - Exonic
1166992148 19:46699063-46699085 AGGGTTGGACAGAAAGGGGATGG - Intronic
1167655901 19:50764000-50764022 CAGGGTATACAAAAAGGAGCTGG + Intergenic
1167758129 19:51426239-51426261 CAGGGGAGCCATAATGGGGATGG - Intergenic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1168191216 19:54739987-54740009 CAGGGTAGACATGAGGTGGAGGG - Intronic
1168203921 19:54835560-54835582 CAGGGTAGACATGAAGTGGAGGG - Intronic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926176935 2:10602014-10602036 CAGTGTAGACAGAGAAGGGCAGG - Intronic
927333461 2:21892890-21892912 CAGGGTAGAAAGTGAGAGGAGGG - Intergenic
927465231 2:23331721-23331743 CATGCTAGACAGATCGGGGAAGG - Intergenic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
929916727 2:46142666-46142688 AAGGGTAGAAAGCAAAGGGAGGG + Intronic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930288528 2:49465358-49465380 AAGGGCAGAGGGAAAGGGGAAGG - Intergenic
930288540 2:49465396-49465418 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930288548 2:49465415-49465437 AAGGGGAGAGGGAAAGGGGAAGG - Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931340771 2:61398579-61398601 CGGGGGAGGGAGAAAGGGGAGGG + Intronic
931509503 2:62975247-62975269 CAGCTTAGGCAGAAAGGGTATGG + Intronic
931864011 2:66390485-66390507 CAGGGTAGAAAGAGGGGGGCTGG - Intergenic
932569280 2:72929521-72929543 CAGGGAAGAGAGAAAGCTGAGGG + Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
933513093 2:83265807-83265829 CAGGGGAGAGAGAAAGGGGTGGG - Intergenic
934041571 2:88131361-88131383 CAGGGTAGGCAGGAAGTGCAGGG - Intergenic
935365906 2:102290974-102290996 CAGTGTATACAGAAAGGGACAGG + Intergenic
935746894 2:106196489-106196511 GGGGGTTGACAGTAAGGGGAGGG - Intergenic
936246773 2:110835399-110835421 AAAGGAACACAGAAAGGGGAGGG + Intronic
936437852 2:112523381-112523403 CAGGGTAGAAATAAAGAAGAAGG - Intronic
936569079 2:113600343-113600365 CTGGGTGGACAGACAGGGGCTGG - Intergenic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937468182 2:122153032-122153054 CTGGGTAGACAGAGAAGGAAGGG + Intergenic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938294511 2:130169228-130169250 CAGGAAAGACAGAAAGGCAAGGG + Intronic
938386404 2:130870218-130870240 CAGGGTAGGCTGAAGGGGCAAGG + Intronic
938462139 2:131504668-131504690 CAGGAAAGACAGAAAGGCAAGGG - Intergenic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
938877355 2:135546348-135546370 CAGGGTGGAGAGGAAGGGAAGGG - Intronic
939706183 2:145456781-145456803 CAGTGTAGACAGGTAGGAGATGG - Intergenic
940329915 2:152463720-152463742 TAGGGGAGAGGGAAAGGGGATGG - Intronic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
942779187 2:179621144-179621166 TGGGGTAGAAAAAAAGGGGAGGG + Intronic
943881924 2:193156643-193156665 CAAGGGAGACAGAAAAGGTAAGG + Intergenic
945983836 2:216339033-216339055 CAGGTTGGACAGAAAGGAGCGGG + Intronic
946030204 2:216697622-216697644 AAGGGTAGAGAGAAGGGGGGAGG + Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
946373476 2:219294655-219294677 GAGGGGAGACAGAAAGCAGAGGG + Intronic
946587055 2:221201494-221201516 CAGGAGAGACAGAAAGGCAAAGG + Intergenic
946835439 2:223767926-223767948 CAGAGAAGACAGGAAGGGTAGGG - Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
948294629 2:236851420-236851442 CACGGCAGACAGCAAAGGGAAGG + Intergenic
948335976 2:237207323-237207345 CAGGGAAGAAAAAAAGGGTAAGG + Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169404373 20:5311283-5311305 CAGGATAGGGAGAAAGGGTAAGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170351246 20:15444070-15444092 CAAGGTTGAGAGAGAGGGGACGG - Intronic
1170440962 20:16378312-16378334 GAGGGAAGGAAGAAAGGGGAGGG + Intronic
1170585446 20:17730752-17730774 CAGAGTGGACAGAAAGGAGTTGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171298040 20:24035947-24035969 CAGGGTAGTGAGACAGAGGAGGG + Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172526414 20:35602569-35602591 CCGGGTGGCCATAAAGGGGAGGG + Intergenic
1172731724 20:37094600-37094622 CAGTGTAGACAGAATTGTGATGG - Intronic
1172955257 20:38752404-38752426 AAGGGAATACAAAAAGGGGAAGG - Intronic
1173397285 20:42691238-42691260 CAAAGTAGAGAGAAAGGGGGTGG + Intronic
1173743319 20:45417942-45417964 CAGAGTAGACAGGAAAGGGTAGG - Intronic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1174724489 20:52846953-52846975 CAAGGCAGGCAGAACGGGGAAGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175136443 20:56827835-56827857 CATGGAAGACAGAAAGGCAACGG - Intergenic
1175207174 20:57320034-57320056 CGGGGGAGAGAGAAAGGAGAAGG + Intergenic
1176041639 20:63068834-63068856 CAGGGCAGACAGGAAGCGGGAGG - Intergenic
1176366488 21:6036040-6036062 CAGGCTGGACAGCAAGGGCAGGG - Intergenic
1177873547 21:26602857-26602879 AAGGGTAGTCAGAGAGGGAAGGG - Intergenic
1177968460 21:27759089-27759111 GAGGGGAGATGGAAAGGGGATGG - Intergenic
1179012322 21:37565276-37565298 CAGGGCAGACAGATATGGCAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179757029 21:43502505-43502527 CAGGCTGGACAGCAAGGGCAGGG + Intergenic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181448730 22:23001381-23001403 AAAGGAAGACAGAAAGGTGAGGG - Intergenic
1181627604 22:24132346-24132368 CAGGGTGGGGAGAAAGGGGTGGG - Intronic
1182253646 22:29021993-29022015 CAGGGAAGCCAGGAAAGGGAGGG - Intronic
1183040850 22:35176843-35176865 CAGGGCAGCCAGGAATGGGAGGG - Intergenic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183229739 22:36574290-36574312 CAGGGTAGGTACAAAGGGCATGG + Intronic
1183290684 22:36999998-37000020 CAGGGATGACAGACAGGGGATGG + Intronic
1184172115 22:42765851-42765873 CATGGTTGACAGAATGGGGTGGG - Intergenic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1184955990 22:47886251-47886273 AAGGGGCGACAGCAAGGGGATGG + Intergenic
1185061212 22:48607860-48607882 CAGGGTGGTCAGAAAAGGGCAGG - Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185128194 22:49023300-49023322 CAGGGTAGACAGGAGGGGAGAGG + Intergenic
1185131848 22:49043780-49043802 AAAGGAAGACAGGAAGGGGAGGG - Intergenic
1185330185 22:50248913-50248935 GAGGGTCGACAGAGAGGGGCTGG + Intronic
949148142 3:729605-729627 AAGGATAGACAGAGAGGGAAAGG - Intergenic
950056814 3:10031697-10031719 AAGGGTAGACAGAATGGGGAAGG - Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
951457021 3:22904263-22904285 CAGTGTGGAACGAAAGGGGATGG - Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
952196025 3:31076086-31076108 CAGAAGAGACTGAAAGGGGACGG + Intergenic
952518853 3:34133873-34133895 CAGAATAGACAGAAAGGGAGAGG + Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
955144227 3:56300114-56300136 CAGGTTTGACAGCAACGGGAGGG + Intronic
955522271 3:59786354-59786376 CCAGGTAGAAAGAAAGAGGAGGG - Intronic
955592823 3:60556298-60556320 CAGAGGAGACAGAAAGGTAAAGG + Intronic
956011233 3:64833777-64833799 CAGTGAATTCAGAAAGGGGAAGG + Intergenic
956204076 3:66738127-66738149 TAGGATGGCCAGAAAGGGGATGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956626674 3:71273535-71273557 CAAGGAAGACTGAAGGGGGATGG - Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957282571 3:78172559-78172581 CTGGGTGGAAAGAAAGGGAATGG - Intergenic
957563985 3:81861685-81861707 CAGGGTAAACATAAAAGAGAGGG + Intergenic
958869188 3:99537233-99537255 CAAAGAAGACAGAAAGTGGAGGG - Intergenic
959852575 3:111107028-111107050 CAGGGAGGAAAGAAAGGGAATGG + Intronic
960205575 3:114893354-114893376 CAGGCTAGACAGACAGTGGGTGG + Intronic
960389191 3:117056036-117056058 CATTGTAAACAGAAAGGAGATGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960933711 3:122881523-122881545 GAGGGAAGAGAGAAAGGAGAGGG + Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961064646 3:123864980-123865002 CAGGAAAGCCAGCAAGGGGAGGG - Intronic
961153542 3:124659789-124659811 CAAGGGAGAAAGAAAGGGAAAGG + Intronic
961226863 3:125257695-125257717 GAGGGTAGAGAGAAATGGGAAGG - Intronic
961902349 3:130225291-130225313 CAGGGGACTCTGAAAGGGGAGGG - Intergenic
961943371 3:130659879-130659901 GAGGGAAGACAGAAAGAAGAGGG - Intronic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962256402 3:133872877-133872899 CAGAGAAGATGGAAAGGGGAGGG + Intronic
962595844 3:136942743-136942765 AAGCCTGGACAGAAAGGGGATGG - Intronic
963025559 3:140915473-140915495 CAGGGAAGAAAGAAAAGTGAAGG - Intergenic
963655899 3:148049711-148049733 ATGGGGAGATAGAAAGGGGATGG - Intergenic
963748735 3:149152405-149152427 CAAGGAAGAGACAAAGGGGAGGG + Intronic
964372635 3:156016930-156016952 AGGGGTAGACAGAAAGGACATGG - Intergenic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965448746 3:168809947-168809969 CTGTGAAGACAGAAAGGGGAAGG - Intergenic
967646281 3:191928122-191928144 CAGGGAAGAGAGATAGGGGTGGG + Intergenic
967788915 3:193526453-193526475 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
967942943 3:194780233-194780255 CAGGATAGAGAGAAAGGTTATGG - Intergenic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
968601523 4:1512123-1512145 CAGGGTAGCGGGACAGGGGAGGG + Intergenic
968818772 4:2835009-2835031 CATGGCAGAAAGTAAGGGGATGG - Exonic
969137728 4:5044166-5044188 CAGCTTAGACAGAAAGGGATGGG - Intergenic
969686258 4:8675982-8676004 CAGGGGAGACAGAGAGGTGGGGG + Intergenic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970355663 4:15249639-15249661 CAAGGTAGAAAAAAAGGGAAGGG + Intergenic
971005476 4:22370002-22370024 AAGGGGAGCCAAAAAGGGGATGG - Intronic
971055921 4:22912372-22912394 AAGGACAGACAGAAAGTGGAAGG - Intergenic
971216364 4:24665812-24665834 AAGGGCAGACAGAATGGAGAGGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971807932 4:31384700-31384722 CGGGGTAGGGGGAAAGGGGAGGG - Intergenic
972028759 4:34424115-34424137 GAGGGTGGAGAGCAAGGGGAGGG + Intergenic
973995055 4:56450171-56450193 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974106989 4:57480964-57480986 GAAGGAAGACAGAGAGGGGAGGG + Intergenic
974385670 4:61200605-61200627 AAGAGAAGAAAGAAAGGGGAGGG - Intergenic
974555434 4:63440826-63440848 TAGGGTAGATATTAAGGGGATGG + Intergenic
974857366 4:67476706-67476728 CAGGGTAGGCAGCAAGGGGCAGG + Intronic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
977048099 4:92091754-92091776 CAGGATAGAGTGAAATGGGAAGG - Intergenic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
980187094 4:129475681-129475703 TAGAGTAGGCAGATAGGGGAAGG - Intergenic
980741834 4:136960603-136960625 CATGGTAAACAGAACGGTGAGGG - Intergenic
980867340 4:138568176-138568198 TAGGGGAGAAACAAAGGGGAGGG + Intergenic
981083064 4:140654308-140654330 GAAAGTAGAGAGAAAGGGGAAGG + Intronic
981457149 4:144966037-144966059 GGGGGTAGGCAGCAAGGGGAGGG + Intergenic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
984105554 4:175541175-175541197 GAGGGGAGCTAGAAAGGGGATGG + Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986875507 5:12103212-12103234 TAGGGAAGAAAGAAAGGGGTGGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988423926 5:31040344-31040366 GAGGGTGGGCAGCAAGGGGAGGG + Intergenic
988683298 5:33503519-33503541 CAGGGCAGACTGACCGGGGATGG - Intergenic
990310546 5:54533893-54533915 CAGGGAGGAAGGAAAGGGGAGGG + Intronic
990389766 5:55307350-55307372 CAGGGCAGACAGCCAGGGGCTGG + Intronic
990662527 5:58033179-58033201 CAGGGTGGGCAGAAATGGGCAGG + Intergenic
992218642 5:74549745-74549767 CAGGTGGGACAGAAAGGGGGCGG - Intergenic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
992825657 5:80547586-80547608 CTGGGTAGACTGACAGGGGAAGG + Intergenic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
993697088 5:91074318-91074340 GAGGGTAGAGGGAAAGAGGAGGG - Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996401407 5:123067230-123067252 CAGGGGCCAGAGAAAGGGGATGG - Intergenic
996960991 5:129249432-129249454 CAGGGTAGGAGGCAAGGGGACGG + Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997232051 5:132252601-132252623 CAGGGTTGACAAGAAGGAGACGG - Intronic
997622293 5:135306758-135306780 CAGGGAAGGCAGAAAAGGCAGGG - Intronic
998206095 5:140157688-140157710 CAGGGAAGACGGATAGGGCAAGG + Intergenic
998979756 5:147689224-147689246 GAGGGCAGACAGTAATGGGAGGG + Intronic
1000897182 5:166869191-166869213 CTGGGTAGACAGAGAAGAGAAGG - Intergenic
1001295720 5:170497615-170497637 AAGGGTGGATTGAAAGGGGACGG - Intronic
1002134626 5:177100000-177100022 AAAGGAAGACAGAGAGGGGAGGG - Intergenic
1002308636 5:178299637-178299659 CAGGGTAGAAAGAAATGAAATGG - Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005560226 6:27032627-27032649 CAGGTTAGACACAAAGGATAAGG - Intergenic
1005589298 6:27308804-27308826 AAGAGTGGACAGGAAGGGGAAGG + Intronic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006303696 6:33207196-33207218 TAAGGTGGAGAGAAAGGGGAGGG - Intergenic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006707865 6:36037539-36037561 GATTGTAGAGAGAAAGGGGAAGG + Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006810849 6:36819697-36819719 CAGGGTCCAAGGAAAGGGGAAGG - Intronic
1006881408 6:37343198-37343220 AAGGGAAGAGAGAATGGGGAAGG - Intergenic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1007637138 6:43306389-43306411 CAGGGTGGGCAGCAAGGGGGAGG - Intronic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1008626917 6:53326102-53326124 CACAGTAGACAGAAAGGGTAGGG + Intronic
1008826634 6:55702413-55702435 AAGGGTAGAGAGAAAAGTGAAGG - Intergenic
1009044120 6:58216929-58216951 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009219944 6:60971197-60971219 CAGGCTATACAGAAAGCAGATGG + Intergenic
1009291799 6:61891898-61891920 CAGGGCAGTCAGGAAGGAGAAGG + Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010024249 6:71197298-71197320 CAGAGGAGACGGAAAGGAGAGGG + Intergenic
1010451830 6:76012668-76012690 CAGGGAAGAGAGGAAAGGGATGG - Intronic
1010613919 6:77990493-77990515 CAGGAGAGCCGGAAAGGGGAGGG - Intergenic
1010813271 6:80324658-80324680 GAGGGTAGTGAGAAAGGGAAAGG - Intronic
1011236004 6:85217799-85217821 GAGGGTGGAGAGCAAGGGGAGGG + Intergenic
1012153321 6:95783557-95783579 CAGGAGAGAGAGAAAGGGCAGGG + Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1012386902 6:98692891-98692913 AAGGGTTGAAGGAAAGGGGAAGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015767676 6:136736280-136736302 CAGAGTAGAAAGAAAGGGTATGG - Intronic
1016368978 6:143351731-143351753 GAGGGTGGAGGGAAAGGGGAGGG - Intergenic
1016696849 6:147006204-147006226 GAAGGTAGACAGTAAGAGGAGGG - Intergenic
1016769703 6:147835590-147835612 CGGGGTAAACAGAAATGGCATGG - Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1017869936 6:158478754-158478776 CAAGGGAGAAAGAAAGGTGAAGG - Intronic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018322406 6:162625577-162625599 CAGAGTAGAAAAAAAGAGGAAGG - Intronic
1018345346 6:162893320-162893342 CAGTGTGGACAGACAGGGCAGGG + Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1019556593 7:1634516-1634538 CAGGGAAGACATAGAGGGGCAGG - Intergenic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1020129288 7:5550483-5550505 CAGGGCAGAGAGAAAGGGGTAGG - Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1023166597 7:37349349-37349371 TAGGTTAGGCAGAAAGGGAAAGG + Intronic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1026004944 7:66592972-66592994 CAGGGAAGGCAGATAGGGGTGGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026454012 7:70555136-70555158 CAGTGGAGACAGAGAAGGGATGG + Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1027512403 7:79098830-79098852 GAGAGGAGAGAGAAAGGGGAGGG + Intronic
1028688478 7:93621212-93621234 CAGGGCAGACTGGAAGGGGAAGG + Intronic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1029955968 7:104640264-104640286 GAGGGTTGGGAGAAAGGGGAGGG - Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030774907 7:113522605-113522627 CAGGCTTAAAAGAAAGGGGAAGG + Intergenic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031693728 7:124822167-124822189 CAGTGTTTACAGAAAGGGGCAGG + Intergenic
1032016078 7:128381155-128381177 CAGGGGAGAGAGAAAAGGAATGG - Intergenic
1032485758 7:132286311-132286333 CAGGGTGGACAGACAGGGCCAGG - Intronic
1032760092 7:134932540-134932562 AAGGTAAGACAGAAAAGGGAAGG + Intronic
1032846965 7:135759262-135759284 GAGAGAAGACAGAGAGGGGATGG + Intergenic
1033048800 7:137985678-137985700 GAGGGAAGACAAGAAGGGGACGG - Intronic
1033301319 7:140188696-140188718 AAGGAAAGAAAGAAAGGGGAAGG + Intergenic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034407293 7:150913564-150913586 CTAGGTAGAAAGAAATGGGAAGG + Intergenic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1034543686 7:151776313-151776335 CGGGGTAGACAGCCAGGGGCCGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035651098 8:1265844-1265866 AAGAGTAGACAGGTAGGGGAGGG + Intergenic
1036656376 8:10679870-10679892 GAGTGGAGAGAGAAAGGGGACGG - Intronic
1037114913 8:15213073-15213095 GAGGGGCGACATAAAGGGGAAGG + Intronic
1037819650 8:22129513-22129535 GAGGGAGGACAGAAAGTGGAAGG + Intronic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038868809 8:31470063-31470085 GGGGGTGGAGAGAAAGGGGAAGG + Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039931257 8:41991800-41991822 AAGGGTAGAAAGTAAGGAGAGGG + Intronic
1040845617 8:51835232-51835254 AAGGGTAGAAGGAGAGGGGAAGG - Intronic
1040998114 8:53422065-53422087 GAGGGTTGATAGAGAGGGGAAGG + Intergenic
1041124538 8:54621779-54621801 CAGGGAAGAGAGAAAGGGGTAGG - Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1043111297 8:76186399-76186421 CATGGCAGACAGAAAGGAGAAGG + Intergenic
1043718464 8:83512920-83512942 CAGGGTAGACAATGAGGGTACGG + Intergenic
1045379508 8:101609203-101609225 CAGGGAAGGAAGGAAGGGGAAGG + Intronic
1045539226 8:103066512-103066534 GAAGATAGACAGAAAAGGGAGGG + Intronic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1047024850 8:120813235-120813257 GAGGGTAGACAGCAGTGGGAAGG - Exonic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047601083 8:126426528-126426550 CAGGGGGTACAGTAAGGGGAGGG + Intergenic
1048151668 8:131900901-131900923 CAGAGGGGATAGAAAGGGGAAGG + Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049244003 8:141551825-141551847 CAGGGTAGGGCGGAAGGGGATGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049370261 8:142261021-142261043 CAGGGAGGAGAGAAAGAGGAGGG + Intronic
1049883451 9:13186-13208 CTGGGTGGACAGACAGGGGCTGG + Intergenic
1049978858 9:885408-885430 TAGGGGAGTCAGAAAGGAGATGG + Intronic
1050048939 9:1577514-1577536 CAGGGAGGCAAGAAAGGGGAGGG + Intergenic
1050100962 9:2119337-2119359 CAAGGCAGAAAGAAAAGGGAAGG - Intronic
1050305419 9:4300561-4300583 CAGGGAAGAGAGGAAGGTGATGG + Intronic
1051586768 9:18734862-18734884 CCTGGAAGACTGAAAGGGGATGG - Intronic
1051715425 9:19977941-19977963 CAGGGTGGACAGATAAGTGATGG + Intergenic
1052467174 9:28843599-28843621 CAGTGAACAGAGAAAGGGGAGGG + Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053469673 9:38337315-38337337 CAGGATAGCAAGAAAGGGGGTGG + Intergenic
1055214798 9:73846095-73846117 CATTGTAGACAGAAAGGAAAAGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1056139116 9:83657366-83657388 CAAGGTAGAAAGACAGGAGAAGG - Intergenic
1056143708 9:83708387-83708409 CAGAGTAGACAGAGAGGCAAGGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1058944253 9:109841758-109841780 GAGGGTGGAGAGAAAGGAGAGGG + Intronic
1058944272 9:109841796-109841818 GAGGGTGGAGGGAAAGGGGAGGG + Intronic
1058983502 9:110191431-110191453 CAGGCAAGACAGCAAGTGGAGGG - Intronic
1060022038 9:120140120-120140142 CAGCCTACCCAGAAAGGGGAAGG - Intergenic
1060165887 9:121414886-121414908 CATGGCAGTCAGAAAGGTGATGG - Intergenic
1060439995 9:123629295-123629317 CATGGTACACAGACAGGGAAAGG - Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1061294708 9:129670875-129670897 CAGGAAATAGAGAAAGGGGAAGG - Intronic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186899998 X:14043836-14043858 CAGGGGAGAAAGGAAGGAGAGGG + Intergenic
1187144210 X:16622766-16622788 CAGAGGTGACAGAAAGGGGTAGG + Intronic
1189051821 X:37653198-37653220 CGGGATAGAAAGAAAGGGGGAGG + Intronic
1189630767 X:42950464-42950486 CAGGGTAGAGAGAAAGGTATGGG + Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1192234171 X:69285578-69285600 CAGGGCAGAGGGAAAGGAGAGGG + Intergenic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1192724434 X:73733206-73733228 GGGGGTAGGGAGAAAGGGGAGGG - Intergenic
1196713347 X:118786666-118786688 AAAGGTAGACAGAAAGGGCCAGG - Intronic
1196943218 X:120798163-120798185 CAGGGGAGAGAGAAAAGGAAAGG - Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198588800 X:138153159-138153181 CAGAGTAGAGAGAAATTGGAAGG + Intergenic
1198959332 X:142167745-142167767 CAAGGTAGACAAAAAAGCGATGG + Intergenic
1199227693 X:145396643-145396665 CAGGGAAGCCATAGAGGGGATGG - Intergenic
1199899603 X:152160020-152160042 GAGGGGAGACAGAAAAGGGAAGG - Intergenic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1200402365 X:156026963-156026985 CTGGGTGGACAGACAGGGGCTGG - Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic
1201619722 Y:15942971-15942993 CAGGGCAGTCAGACAGGAGAAGG - Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201895282 Y:18986025-18986047 CAGGGAAGCCAGAATGGGCATGG - Intergenic