ID: 904031360

View in Genome Browser
Species Human (GRCh38)
Location 1:27535491-27535513
Sequence TTCCTCAGAACAGCCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904031360_904031366 -2 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031366 1:27535512-27535534 AATGACATCATGGGGAGGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 200
904031360_904031367 -1 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031367 1:27535513-27535535 ATGACATCATGGGGAGGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 359
904031360_904031364 -7 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031364 1:27535507-27535529 TGAGGAATGACATCATGGGGAGG 0: 1
1: 0
2: 3
3: 17
4: 185
904031360_904031368 18 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031368 1:27535532-27535554 AGGGCCTCAGCACACAGCACAGG 0: 1
1: 0
2: 2
3: 34
4: 343
904031360_904031363 -10 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031363 1:27535504-27535526 TTCTGAGGAATGACATCATGGGG 0: 1
1: 0
2: 3
3: 13
4: 198
904031360_904031365 -6 Left 904031360 1:27535491-27535513 CCAACTTAGGCTGTTCTGAGGAA 0: 1
1: 0
2: 2
3: 13
4: 138
Right 904031365 1:27535508-27535530 GAGGAATGACATCATGGGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904031360 Original CRISPR TTCCTCAGAACAGCCTAAGT TGG (reversed) Intronic