ID: 904032638

View in Genome Browser
Species Human (GRCh38)
Location 1:27542837-27542859
Sequence AACAAGGCCTGGCCTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904032638 Original CRISPR AACAAGGCCTGGCCTAAACA TGG Intronic
901434410 1:9237872-9237894 AACAAGGCCTGGCATACAGAAGG - Intronic
903001201 1:20267030-20267052 AGCAAGGCCTGGCCGAATCAGGG - Intergenic
903117184 1:21188027-21188049 AATAAGGCCTGGCATCAGCAAGG - Intergenic
903836086 1:26204051-26204073 AAGAAGTCCTGGCTCAAACAGGG - Intergenic
904032638 1:27542837-27542859 AACAAGGCCTGGCCTAAACATGG + Intronic
904187756 1:28719232-28719254 AACAAGGCAGGGACCAAACAGGG - Intronic
904581781 1:31549007-31549029 GACAAAGCCTGGCCCAACCAGGG - Intergenic
905111174 1:35595609-35595631 ATCCAGGCCTGGGCTAAAGAAGG - Intergenic
907162614 1:52382265-52382287 AACCACGCCCGGCCTAAACTGGG + Intronic
908503117 1:64764485-64764507 AAGAAGTCCTTTCCTAAACAAGG - Intronic
909151598 1:72012639-72012661 AAGAGGGTCTGGCTTAAACAGGG - Intronic
916011668 1:160711817-160711839 AAAAAGGCCGGGGCTAAAAACGG + Exonic
917867526 1:179211606-179211628 CACAATGCCTGGCCTAAATTTGG - Intronic
918833462 1:189429117-189429139 AACCATGCCTGGCCTCATCAAGG + Intergenic
920537463 1:206747908-206747930 CACCATGCCTGGCCTAAACTGGG + Intergenic
922060168 1:222081666-222081688 AACAAGGCCTAGTCAAAACGAGG - Intergenic
924094681 1:240539109-240539131 CACAAGGCTTGGCTTTAACATGG - Intronic
924827935 1:247561607-247561629 AAAATGGACTGGCCTAAACCAGG - Intronic
1063933219 10:11050457-11050479 AACCTGGCCTGGCTTGAACATGG + Intronic
1064723736 10:18256650-18256672 CACCATGCCCGGCCTAAACATGG - Intronic
1064983831 10:21190189-21190211 CACTAGGCCTGGCCTAATCCAGG - Intergenic
1067870206 10:49952502-49952524 AACATGGCCTGGTCCAAACCAGG + Exonic
1068372692 10:56138382-56138404 AACAAGGCTTAACTTAAACAAGG + Intergenic
1068995448 10:63197130-63197152 AACAAGGCCTAACCTAAATTTGG + Intronic
1072950833 10:99845319-99845341 CACCACGCCTGGCCTAAACAAGG + Intronic
1074211464 10:111339375-111339397 AACAAAGCCTGGCATACAAAAGG - Intergenic
1074704432 10:116118544-116118566 ACCAAGGCCTGATCTGAACATGG + Intronic
1075779908 10:125010688-125010710 GACAAGGACTGGCCTGAACCAGG + Intronic
1075784842 10:125042055-125042077 AAGATGGCCAGCCCTAAACATGG - Intronic
1078053800 11:7990456-7990478 ATCAGGGCCTGGCCTAGAAAAGG + Intronic
1079404500 11:20132538-20132560 AGCACGGCCTGTCCCAAACAGGG - Intergenic
1080339727 11:31247522-31247544 TACAAGGCCAGCCCTGAACATGG - Intronic
1081393867 11:42561939-42561961 CACAATGCCTGGCCTAAAGCTGG + Intergenic
1081858814 11:46320452-46320474 AGTGAGGCCTGGCCTAAAGACGG + Exonic
1083739473 11:64701061-64701083 ATCAGGGCCTGGCCTCACCAGGG - Intronic
1084711729 11:70847837-70847859 AGCAAGGCCTGGACCAAAGAGGG + Intronic
1085444604 11:76592041-76592063 GACAAGGCCTGGCACAGACAAGG - Intergenic
1085943927 11:81242863-81242885 AACACTACCTGGCCTAAAAAAGG + Intergenic
1086686358 11:89737551-89737573 CACCATGCCTGGCCTAAATATGG - Intergenic
1087737864 11:101854442-101854464 CACCAGGCCTGCCCTAAAAAAGG + Intronic
1091260707 11:134231911-134231933 CACGAGGCCTAGACTAAACATGG + Intronic
1092111354 12:5966999-5967021 AGCATGGCCTGGCAAAAACAGGG + Intronic
1093292024 12:17337775-17337797 AACAAGGGCTGGCAAAGACATGG - Intergenic
1096369736 12:51058978-51059000 ATCAAGACCTAGCCTAAACAGGG - Intronic
1098530391 12:71535051-71535073 AACAATAACAGGCCTAAACAAGG - Intronic
1100583480 12:95957762-95957784 CACTATGCCTGGCCTAAAAACGG - Intronic
1100638100 12:96455433-96455455 CACCATGCCTGGCCTAAAGATGG + Intergenic
1101908735 12:108847185-108847207 CACTGGGCCTGGCCTAGACAAGG + Intronic
1102606829 12:114074149-114074171 GACAAGGCCTGACCTCATCATGG + Intergenic
1104663573 12:130630998-130631020 AACAAATCCTACCCTAAACAGGG + Intronic
1108113304 13:47101213-47101235 AACAATGCCTGGCCCAGAAATGG + Intergenic
1108700044 13:52936015-52936037 AACAAGGCTTGGGCTGAGCACGG + Intergenic
1110759975 13:79221003-79221025 AACATGGCATGTCCTTAACATGG + Intergenic
1117146879 14:52844838-52844860 AACAGGGCCTGGCGTAGAGAAGG - Intergenic
1118525245 14:66632988-66633010 AAGAAGGCCTGGCCTGAGCAAGG - Intronic
1120625172 14:86816713-86816735 AGCAATGCCTGGCCTGAAGAAGG - Intergenic
1122537349 14:102474927-102474949 AGCAAGGCCTGGCAAAAGCAAGG + Intronic
1127387660 15:58479985-58480007 GACAAGGCCTGGCCCATAGAAGG + Intronic
1128075044 15:64820702-64820724 CACAAGGCCTGGCATAAAGTAGG - Intronic
1128735493 15:70051519-70051541 AGCAAGACCTGCCCTAGACATGG + Intronic
1129083485 15:73063351-73063373 AACAAAGCCTGGCTTATTCATGG + Intronic
1129868239 15:78924982-78925004 CACCACGCCTGGCCTGAACATGG + Intronic
1137481917 16:48858986-48859008 AACTAGTCCTGGGCTAAGCATGG + Intergenic
1139229897 16:65273542-65273564 AACACCACCTGGCCTAAGCAGGG - Intergenic
1142119850 16:88381905-88381927 AGCAAGGTGTGGCCTAACCACGG - Intergenic
1143144906 17:4768731-4768753 AACCAGCCCTGGCCTAGATAAGG + Intergenic
1148140307 17:45323381-45323403 CATGAGGCCTGGCCTCAACAGGG - Intergenic
1151026218 17:70679989-70680011 AACAGGGCCTGGCATAAAATGGG - Intergenic
1153070229 18:1097415-1097437 AAAAAGGCCTGACCTAGTCAGGG + Intergenic
1153415422 18:4840882-4840904 TTCAAGGACTGGCCTATACAGGG + Intergenic
1154325290 18:13386761-13386783 CACCATGCCTGGCCTAAAAATGG - Intronic
1163697946 19:18773450-18773472 AAAAAGGCCTGGCATACACAGGG - Intronic
1164076347 19:21822433-21822455 AAGCAGGCCTGACCTAAATAAGG + Intronic
1166827518 19:45618658-45618680 CACCAAGCCTGGCCCAAACAAGG - Intronic
1167039841 19:47017319-47017341 CACCATGCCTGGCCTACACATGG - Intergenic
1167263723 19:48473065-48473087 ACAAAGGTCTGGCCTAAGCAGGG + Intronic
927629429 2:24759282-24759304 AAAAAGGCCTGGTCAAAAAAAGG + Intronic
927803442 2:26122767-26122789 AAAGAGGCTTGGCCTAAAAATGG + Intronic
930377564 2:50587194-50587216 CACCATGCCTGGCCAAAACAGGG - Intronic
930377810 2:50589640-50589662 CACCATGCCTGGCCAAAACAGGG + Intronic
930479285 2:51926463-51926485 AACATGGCAAGCCCTAAACAGGG + Intergenic
933690499 2:85175882-85175904 AACAAAGACTGACCTAAACGTGG - Intronic
936007104 2:108899178-108899200 AACAACGCCTGACCTAGAGAGGG + Intronic
941088999 2:161152635-161152657 AACAGGACCTGGCCTACAGAAGG + Intronic
944553545 2:200866467-200866489 AACAAGGTCTGGCCAAAGAAAGG + Intergenic
944632469 2:201641486-201641508 AAAAGGGCCTGGCCTAGAGATGG - Intronic
945275467 2:207983337-207983359 CACCACGCCTGGCCTAAACATGG + Intronic
946884315 2:224207963-224207985 AACAAGGCCTGGCATACAAAAGG - Intergenic
1171991953 20:31703465-31703487 CACCATGCCTGGCCTAAACTTGG + Intronic
1172034593 20:32002134-32002156 AACCAGGCCAGGCCTGGACAGGG - Exonic
1172997758 20:39083575-39083597 CACCAGGCCAGGCCTAAACTGGG - Intergenic
1181102421 22:20550302-20550324 AGCGAGGCCTGGCCAGAACAAGG - Intronic
1183525661 22:38321057-38321079 ATCAAGGGCTGGCCTGAAAACGG + Intronic
1183559459 22:38559618-38559640 AACAATCCCTGGCATAAACTAGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183706438 22:39477482-39477504 AGCAAGGCCTGGCATATTCAGGG + Intronic
950185708 3:10944262-10944284 AACAAGACCTGCCCTCACCAAGG - Intergenic
957456364 3:80454117-80454139 CACCAGGCCTGGCCAAAATAAGG - Intergenic
958757813 3:98271538-98271560 AATAAGCCCTGGCCTGAAGAGGG - Intergenic
960061883 3:113331161-113331183 ATCATGGCCTTGCCTACACAAGG - Intronic
960122022 3:113956739-113956761 AACAGGACCAGGCCTAATCAGGG + Intronic
961365885 3:126398951-126398973 AACCAGGCCTGGCCTGGCCAGGG - Intronic
965616190 3:170594971-170594993 AACTAGCCCTAGCCTAATCAGGG - Intronic
965721612 3:171668260-171668282 ATGAAGGCCTGGCCCATACATGG + Intronic
969209045 4:5672248-5672270 GAGAAGGACTGGCCTGAACAAGG + Intronic
969403143 4:6970577-6970599 CACAAGACCTGGCCTCAACATGG - Intronic
971058257 4:22937763-22937785 AACAATGCCTGGCATACAGAAGG + Intergenic
974841300 4:67302621-67302643 AAAAAGGCCTGGCATATAGAGGG + Intergenic
976109990 4:81662207-81662229 AACAGGGACTGGCATAAAGAAGG + Intronic
979863328 4:125722272-125722294 ATCAAGGCCTGATCTAAACATGG + Intergenic
982092850 4:151895722-151895744 AACAAGGCCTGGACTTTTCAGGG - Intergenic
983708088 4:170682739-170682761 AACAATGCCTGGCCTAGAGTGGG + Intergenic
984800074 4:183706580-183706602 AAAAATGACTGGCCTAGACAGGG - Intronic
984894656 4:184527403-184527425 AACAAGGCCAGGTCTGACCAGGG - Intergenic
991642440 5:68768456-68768478 AACAAGGTATGGCTAAAACAGGG - Intergenic
991916228 5:71608744-71608766 CACCAGGCCTGCCCTAAAAAAGG - Intronic
992268122 5:75038152-75038174 AACAAGTCCTAACCTAAACTGGG + Intergenic
992850321 5:80800741-80800763 AACAAGGCTTGGCACAAAGAAGG - Intronic
996138939 5:119880570-119880592 AACAAATCCTGGCCTAGAAAAGG + Intergenic
998413097 5:141925742-141925764 AAAAATGCCTGGCCCAGACAAGG - Intronic
998937216 5:147241950-147241972 AACAAAGCCTGGCTGAATCAAGG - Intronic
999138735 5:149342621-149342643 CACCATACCTGGCCTAAACAAGG - Intergenic
1002069528 5:176671042-176671064 TACCAGGACTGGCCAAAACATGG - Intergenic
1002382045 5:178838119-178838141 AACAAAGCCTGGGCAAAACATGG + Intergenic
1002499896 5:179641451-179641473 AACAAGGCCTGAACTAGAGATGG - Intergenic
1002648729 5:180675566-180675588 AACAAAGCCTGGGCAAAACATGG - Intergenic
1005130508 6:22502091-22502113 AACAAGGCCTGGCACAAAACAGG - Intergenic
1005447311 6:25938044-25938066 AAGAAAGCCTGGCATATACATGG - Intergenic
1009973892 6:70653316-70653338 TACAGCACCTGGCCTAAACATGG - Intergenic
1012310623 6:97719951-97719973 AACAATGCCTGGAATATACAGGG + Intergenic
1012776803 6:103505750-103505772 AACAATGCCTGCCTTAAAGATGG + Intergenic
1013260564 6:108437258-108437280 AATAAGACCTGGCATAAACTTGG - Intronic
1013757344 6:113477160-113477182 AACAAGGCATGACCCAAACCAGG - Intergenic
1014885509 6:126776094-126776116 AACAGGGCCTGCCATAAACAAGG - Intergenic
1015671427 6:135694393-135694415 TGCAAAGCTTGGCCTAAACATGG + Intergenic
1018542774 6:164900790-164900812 AACAAGGCCTTGTTGAAACAGGG + Intergenic
1023754857 7:43407159-43407181 AACAAGACCTGGCCTCCACGGGG - Intronic
1028870880 7:95770681-95770703 CACCATGCCTGGCCTCAACATGG - Intergenic
1029416534 7:100446596-100446618 AACAAGACCTCCCCTAACCATGG - Intergenic
1029597311 7:101544819-101544841 CACAACACCTGGCCAAAACAGGG + Intronic
1033647862 7:143318950-143318972 AACATGGCCTGGCCTGACCCTGG + Intronic
1034336068 7:150324302-150324324 AGAAAGGCCTGGCATAATCATGG + Intronic
1036932687 8:12971864-12971886 AACATGGCCTGGCCCAAAGCAGG - Intronic
1037359558 8:18058834-18058856 AACAAAACCTGTCCTCAACAAGG - Exonic
1038177093 8:25190747-25190769 AAGAAGGCCTGGCCTTAACTTGG + Intronic
1038562398 8:28591513-28591535 AACAACTCTTGGTCTAAACAGGG - Intergenic
1044871263 8:96622151-96622173 AACAATGCCTGGCATACAGAAGG + Intergenic
1045242751 8:100416779-100416801 AACAAGGGCTGCCCTAAAATTGG + Intergenic
1046771262 8:118118813-118118835 AACCAGGCCGGGCCTGAACCAGG - Intergenic
1048856673 8:138692666-138692688 AACAAGGCCTGGAGGAAACATGG - Intronic
1053469597 9:38336668-38336690 AGCATGGACTGGCCTAAACCTGG + Intergenic
1061713017 9:132500408-132500430 CACAGGGCCTGGCCTACAAAGGG + Intronic
1062207021 9:135342910-135342932 AACTAGTCCTGGCCTAAACGTGG - Intergenic
1190427154 X:50344669-50344691 AACAAAGCATTGCCTAACCAGGG + Intronic
1191231808 X:58101938-58101960 TAAAAGGCCTGGAGTAAACAGGG - Intergenic
1196323577 X:114373083-114373105 AACAAAGCATGGCTCAAACAGGG + Intergenic
1198330418 X:135617669-135617691 AACGAGACACGGCCTAAACATGG + Intergenic
1198336509 X:135671330-135671352 AACGAGACACGGCCTAAACATGG - Intergenic
1198803626 X:140472290-140472312 CACCATGCCTGGCCTCAACATGG + Intergenic
1199513071 X:148644510-148644532 AACAGTGGCTGGCATAAACAAGG + Intronic