ID: 904033810

View in Genome Browser
Species Human (GRCh38)
Location 1:27548805-27548827
Sequence GAGAACTGTCGGCAGTTTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904033810_904033827 30 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033827 1:27548858-27548880 GGAGGCGGCAGAGGCTGCAGAGG 0: 2
1: 2
2: 23
3: 322
4: 2438
904033810_904033823 9 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033823 1:27548837-27548859 CTGGAAGGAGGAGGAGGAGGAGG 0: 2
1: 18
2: 211
3: 1918
4: 10112
904033810_904033822 6 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033822 1:27548834-27548856 GGGCTGGAAGGAGGAGGAGGAGG 0: 2
1: 6
2: 59
3: 649
4: 4514
904033810_904033818 -6 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033818 1:27548822-27548844 GTTCTCGGGCGAGGGCTGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 107
904033810_904033826 21 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033826 1:27548849-27548871 GGAGGAGGAGGAGGCGGCAGAGG 0: 5
1: 56
2: 516
3: 4540
4: 12590
904033810_904033817 -10 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033817 1:27548818-27548840 GACAGTTCTCGGGCGAGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 117
904033810_904033821 3 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033821 1:27548831-27548853 CGAGGGCTGGAAGGAGGAGGAGG 0: 1
1: 0
2: 22
3: 153
4: 1306
904033810_904033819 -3 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033819 1:27548825-27548847 CTCGGGCGAGGGCTGGAAGGAGG 0: 1
1: 0
2: 1
3: 21
4: 275
904033810_904033824 12 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033824 1:27548840-27548862 GAAGGAGGAGGAGGAGGAGGAGG 0: 326
1: 3396
2: 7908
3: 15051
4: 24191
904033810_904033820 0 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033820 1:27548828-27548850 GGGCGAGGGCTGGAAGGAGGAGG 0: 1
1: 0
2: 14
3: 146
4: 1320
904033810_904033825 15 Left 904033810 1:27548805-27548827 CCCGCAAACTGCCGACAGTTCTC 0: 1
1: 0
2: 0
3: 4
4: 74
Right 904033825 1:27548843-27548865 GGAGGAGGAGGAGGAGGAGGCGG 0: 1901
1: 5100
2: 10705
3: 16594
4: 27534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904033810 Original CRISPR GAGAACTGTCGGCAGTTTGC GGG (reversed) Exonic
902359603 1:15935212-15935234 GACTTCTGTAGGCAGTTTGCTGG - Exonic
904033810 1:27548805-27548827 GAGAACTGTCGGCAGTTTGCGGG - Exonic
911937011 1:103989288-103989310 AAGAACTTCCAGCAGTTTGCTGG + Intergenic
919758210 1:201079197-201079219 GACAACTTTCGGGAGTTTGACGG - Intronic
920550679 1:206858193-206858215 TAGAAATGTCAGCAGTTTGTAGG - Intergenic
921311826 1:213852038-213852060 GAGAACAGTGGGCAGTATGTGGG - Intergenic
922015161 1:221637760-221637782 GAGAGCTGTGGGCAGGATGCTGG - Intergenic
1063848968 10:10162942-10162964 GAGAACTTTTGGCTGATTGCTGG - Intergenic
1064810231 10:19188739-19188761 GCCAACAGTTGGCAGTTTGCTGG - Intronic
1068548436 10:58379186-58379208 GAGAACTGCAGGCAGTTTGGTGG - Intergenic
1068657040 10:59586654-59586676 GAGAACAGTCTGCACTTTTCTGG + Intergenic
1077401817 11:2362579-2362601 GAGAGCTGTGGGCAGCTGGCTGG - Intergenic
1080801915 11:35618054-35618076 GAAATCTGTCTGAAGTTTGCAGG + Intergenic
1090932167 11:131307748-131307770 CAGAACTTTCGGCAGCTGGCAGG + Intergenic
1096228389 12:49883705-49883727 GAGAAGAGTCGGCCTTTTGCAGG + Intronic
1096910910 12:54983016-54983038 GAGAACAGTTGTCAGTTTGCAGG + Intronic
1098341857 12:69459820-69459842 GAGAAATGTCCTCAGTGTGCTGG - Intergenic
1107114430 13:36731525-36731547 GGGAACTGTGGGCAGCTTCCAGG - Intergenic
1112065948 13:95793283-95793305 GATGGCTGTCGGCAGTTTTCTGG + Exonic
1112112861 13:96321934-96321956 GAGAACTGTTGGGAGTTTGGTGG - Intronic
1116612070 14:47088389-47088411 CAGAACTGTCTGCTGTGTGCAGG - Intronic
1121745154 14:96283184-96283206 GAGATCTGTCAGCAAGTTGCAGG - Exonic
1122585235 14:102801493-102801515 GAAAACTCTTGGCAGTTAGCAGG + Intronic
1124207390 15:27733298-27733320 GTGAAATGTGGGCAGTCTGCTGG - Intergenic
1125325992 15:38536310-38536332 GAGAGCTGCCAGCAGCTTGCTGG + Intronic
1126749181 15:51859269-51859291 TAGATCTGTCTGCAGTTTTCAGG + Intronic
1128716196 15:69909953-69909975 GAGAAGTGTCGGTGGTTTGATGG - Intergenic
1130413031 15:83663177-83663199 GAGAACTGAAGGGAGTTGGCAGG - Intronic
1133873700 16:9713477-9713499 GACCACTGACTGCAGTTTGCTGG + Intergenic
1140687352 16:77446337-77446359 GACATCTGTTGGCAGTTTCCTGG - Intergenic
1155234253 18:23803682-23803704 GAGAACTTTGAGCAGTGTGCTGG - Intronic
1160729303 19:633495-633517 GCGTAATGTCGGCACTTTGCTGG - Exonic
1161183572 19:2901211-2901233 GAGGACTGGGGGCAGTTTGGGGG + Intronic
1162810967 19:13164137-13164159 GAGAACTGTTGGCAATTCCCTGG - Intergenic
928660999 2:33501745-33501767 GAGAACCGTTGGCAGTTTAGAGG + Intronic
929115767 2:38442641-38442663 GAGAAAAGTCAGCAATTTGCAGG + Intergenic
931359082 2:61563118-61563140 GACAAATGTCTGCAGTTTGAAGG - Intergenic
935807904 2:106767141-106767163 TAGTATTATCGGCAGTTTGCAGG + Intergenic
945054052 2:205852540-205852562 GAGAACTGCAGGCATCTTGCTGG - Intergenic
945137322 2:206642322-206642344 GAGAGGTGGCGGCAGTTTCCAGG + Intergenic
948267196 2:236643597-236643619 GAGAACTGTGGCCAGTTTATAGG - Intergenic
948925696 2:241095373-241095395 GAAAACTGCCAGCATTTTGCTGG + Exonic
1172985501 20:38984972-38984994 GAGCAAAGTCTGCAGTTTGCAGG - Intronic
1173243866 20:41320691-41320713 AAGAACTATCTGAAGTTTGCTGG + Intergenic
1174408821 20:50320828-50320850 GAGAGCTGTGGGAAGTTTCCAGG - Intergenic
1175719001 20:61274097-61274119 GAGTACTGTGTGCAGTTTGGGGG + Intronic
1175719062 20:61274394-61274416 GAGTACTGTGTGCAGTTTGGGGG + Intronic
1175719107 20:61274625-61274647 GAGTACGGTGTGCAGTTTGCAGG + Intronic
1175719139 20:61274782-61274804 GAGTACTGTGTGCAGTTTGGGGG + Intronic
1175719203 20:61275126-61275148 GAGTACTGTGTGCAGTTTGGGGG + Intronic
1175719279 20:61275495-61275517 GAGTACTGTGTGCAGTTTGGGGG + Intronic
1176120989 20:63454534-63454556 GGGAACTATCCGCAGTTTGGAGG - Intronic
1183547736 22:38463789-38463811 CAGAATTGGAGGCAGTTTGCAGG + Intergenic
960340901 3:116473992-116474014 AAGAAATGCCTGCAGTTTGCTGG + Intronic
964601703 3:158508199-158508221 AAGAACTGTAGGCAATTTGAAGG + Intronic
973195306 4:47432944-47432966 GAGAAATTTAGACAGTTTGCAGG - Intergenic
978605072 4:110471087-110471109 GAGAATTCTCTGCAGTTTTCTGG - Intronic
983297376 4:165882886-165882908 GAGATTTGTGAGCAGTTTGCTGG + Intronic
991141354 5:63247633-63247655 GAGAAATGTAGGCAATTTGAGGG - Intergenic
996796408 5:127353025-127353047 CTCAACTGTCTGCAGTTTGCAGG + Intronic
1000114629 5:158142304-158142326 GAGATCTGACGGTAGTCTGCTGG - Intergenic
1004064616 6:12231000-12231022 GAGAACTGCAGACAGATTGCTGG - Intergenic
1006561542 6:34917216-34917238 GAAAACTGTCAGCAGGCTGCTGG - Intronic
1007949150 6:45854682-45854704 GAGAACAGTAGCCAGTGTGCTGG + Intergenic
1010973510 6:82288069-82288091 GAGAACTCTCTGCTGTTTGTAGG - Intergenic
1013613417 6:111818083-111818105 GATAACTGTCAGCAGATTTCTGG - Intronic
1014375797 6:120671320-120671342 GAGAACGTTCTGCATTTTGCTGG + Intergenic
1017050008 6:150382078-150382100 GAGTACTGTCGGCCTCTTGCAGG + Intronic
1017407361 6:154134722-154134744 GAGAACTATCTGCAATTTGCAGG - Intronic
1017439500 6:154450313-154450335 GTGACATGTGGGCAGTTTGCAGG - Intronic
1021537639 7:21723455-21723477 GAGAAATGACGGCAGTTTATGGG - Intronic
1048000791 8:130377891-130377913 GAGAAGTGTGGGCAGTGGGCAGG - Intronic
1192152194 X:68719286-68719308 GAGATCAACCGGCAGTTTGCAGG + Exonic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192793882 X:74410917-74410939 GAGAAATGTAGGCAGTTAGGAGG + Intergenic
1196974642 X:121145635-121145657 ATGAACTTTCGGTAGTTTGCGGG + Intergenic
1197803803 X:130380056-130380078 CAGACCTGTCAGCAGTTTGAAGG + Intergenic
1198033199 X:132775282-132775304 GAGAACTGTAGAAAGTTTCCTGG - Intronic