ID: 904037104

View in Genome Browser
Species Human (GRCh38)
Location 1:27564841-27564863
Sequence CAAGCACCAGGTGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904037104_904037108 -10 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037108 1:27564854-27564876 CTGGTGCTTGGAAGGACTAGAGG 0: 1
1: 0
2: 1
3: 8
4: 131
904037104_904037112 29 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037104_904037110 13 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037110 1:27564877-27564899 ACCTGAGATGTCAGTGTCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 157
904037104_904037109 12 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037109 1:27564876-27564898 GACCTGAGATGTCAGTGTCTAGG 0: 1
1: 0
2: 0
3: 20
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904037104 Original CRISPR CAAGCACCAGGTGCTGCTGC TGG (reversed) Intronic
900300122 1:1972992-1973014 CAGGCACCAGAAGCTGCTGGAGG - Exonic
900399407 1:2466914-2466936 CCATCACCAGGAGCTACTGCTGG + Intronic
900551142 1:3256245-3256267 AAATCATCAGGGGCTGCTGCGGG + Intronic
900728437 1:4234817-4234839 CCAGGGCCAGGAGCTGCTGCAGG + Intergenic
900737886 1:4310543-4310565 CAAGCACCTGGTGCTGCGCGGGG + Intergenic
900744490 1:4351801-4351823 CAACCACCAGGTGTTTCTGGAGG + Intergenic
900992448 1:6104269-6104291 CAAGCCCTTGGTGCTGCGGCTGG + Exonic
901484174 1:9546912-9546934 GAAATACCAGGAGCTGCTGCTGG - Intronic
901550131 1:9989885-9989907 CCCTCACCAGATGCTGCTGCGGG + Intergenic
902183698 1:14709521-14709543 GAAGGACCAAGTGCTTCTGCAGG + Intronic
902362272 1:15948429-15948451 GAAGCCCCAGCTGCCGCTGCTGG + Exonic
902409111 1:16202426-16202448 GAAGCACCAGTTCCTGCTGCGGG - Exonic
902843087 1:19087803-19087825 CAAGTTCCAGGTACAGCTGCTGG - Exonic
902943074 1:19814481-19814503 CCAGCACCCGGGGCAGCTGCTGG - Exonic
903065186 1:20695715-20695737 CAAGCACAAGGTCCTGGAGCTGG - Intronic
903119372 1:21205010-21205032 CAATTACCAGGTTCTGCTGTTGG - Intergenic
903130573 1:21277057-21277079 CCAGGAGCAGGTGCTGGTGCTGG - Intronic
903154931 1:21436788-21436810 CAAGCACCAGCTGCAGGTCCAGG + Intergenic
904011867 1:27394482-27394504 CAGGCAGCAGGTGCCGCTGAAGG - Exonic
904037104 1:27564841-27564863 CAAGCACCAGGTGCTGCTGCTGG - Intronic
904130412 1:28271697-28271719 CCAGCCCCAGGTGCTGCTCGAGG - Exonic
904261895 1:29292271-29292293 CAAGGAGGAGGTGCTGCTGTAGG + Intronic
904333551 1:29783102-29783124 CATGGAGGAGGTGCTGCTGCAGG - Intergenic
904594623 1:31635479-31635501 CAAGCACCAGGAGCCCCTCCGGG - Exonic
904841081 1:33372357-33372379 GCAGCATGAGGTGCTGCTGCTGG + Exonic
905166836 1:36087994-36088016 CAAGCACCTGGCCCGGCTGCAGG + Exonic
909466577 1:75980129-75980151 CAAGCAGCAGCTGCTGATGAGGG + Intergenic
910459354 1:87432191-87432213 CAAGCACCAGGAGCAACTCCAGG - Intergenic
911665198 1:100543665-100543687 CAAGTACCAGCTCCTGTTGCGGG + Intergenic
912226631 1:107741458-107741480 CATGCTCCAGGTGCTGCTGAGGG + Intronic
913254949 1:116944794-116944816 CACGCACCTGGCGCTGCTGTGGG + Exonic
913666269 1:121051592-121051614 AGAGGACCAGGTGCTGCTACTGG + Intergenic
914017957 1:143838704-143838726 AGAGGACCAGGTGCTGCTACTGG + Intergenic
914656569 1:149747237-149747259 AGAGGACCAGGTGCTGCTACTGG + Intergenic
915431248 1:155868635-155868657 GCAGCACCAGGTCCTGCAGCTGG - Exonic
915567936 1:156726935-156726957 CATTCACCATGTGCTGCTTCCGG + Exonic
915604181 1:156940375-156940397 GAAGCACCAGGTCCTGCTAGAGG - Exonic
915629040 1:157138009-157138031 CCAGGACCCGGAGCTGCTGCGGG - Intronic
916271835 1:162951730-162951752 CACTCAACAGGTGCTGCTGCTGG + Intergenic
916620676 1:166493123-166493145 CAAACACCAGGTCCTGTTGGAGG + Intergenic
916713980 1:167434794-167434816 CTAGAAGCAGGTGCTGCTGCAGG + Intronic
919059213 1:192609221-192609243 CAAGCACCATCTGCTGCTACTGG + Intergenic
919469954 1:197965829-197965851 CAACCAGAAGGTGCTACTGCGGG + Intergenic
919789748 1:201283533-201283555 GAAGCGCCAGGAGCAGCTGCAGG + Exonic
920076704 1:203342423-203342445 CAAGCTGCAGGTGCTGCGCCTGG - Exonic
920675724 1:208037399-208037421 CAACCACCAGGCGCTGGAGCTGG - Intronic
922579936 1:226689404-226689426 CAACCAGCAGCCGCTGCTGCGGG + Intronic
922603200 1:226872127-226872149 CAAGGGCTAGGGGCTGCTGCTGG + Intronic
922675384 1:227546219-227546241 CAAGGACCAGTTGTTCCTGCAGG - Intergenic
923041891 1:230325571-230325593 CAACCACCAGGTGCTTCAGAGGG + Intronic
923065764 1:230515912-230515934 AAGGCAGCAGGTGCTGCGGCAGG - Intergenic
923141525 1:231163968-231163990 CAAGCACGAGGTGAAGCCGCTGG + Exonic
924198933 1:241640110-241640132 CGAGCGCCTGGCGCTGCTGCTGG - Exonic
1062897390 10:1114699-1114721 TAACCACCAGGAGCTGCAGCTGG + Intronic
1063430226 10:5981750-5981772 AAAGCACTAGGTGCTGACGCAGG - Intergenic
1063949945 10:11213024-11213046 GATGAACCAGGTGCTTCTGCAGG - Intronic
1064923702 10:20547200-20547222 CAAGAGCCAGTTCCTGCTGCAGG + Intergenic
1067841418 10:49682540-49682562 CAGGAGCCAGTTGCTGCTGCTGG + Intronic
1067841425 10:49682573-49682595 CAGGAGCCAGTTGCTGCTGCTGG + Intronic
1069182853 10:65385003-65385025 CACGCACCAGGGCCTGTTGCGGG - Intergenic
1070735536 10:78861450-78861472 GCAGCCCCAGGTGCTGCAGCTGG + Intergenic
1071022229 10:81071033-81071055 CTAGCCACAGGTACTGCTGCTGG - Intergenic
1071152554 10:82652185-82652207 CCCCCTCCAGGTGCTGCTGCAGG - Intronic
1072276297 10:93826617-93826639 CTGGCCCCAGGTGCTGCTTCCGG - Intergenic
1073293086 10:102422930-102422952 CCAGGCCCTGGTGCTGCTGCAGG + Exonic
1074635824 10:115316118-115316140 CATGCACCAGGGCCTGTTGCCGG - Intronic
1074762332 10:116676315-116676337 CAGGCACCAGCTGGTGATGCTGG + Intronic
1075030864 10:119023851-119023873 CAAGCACCTGGTGCTGATGGTGG + Intergenic
1075294968 10:121267088-121267110 CAAAGAGCAGGTGTTGCTGCAGG + Intergenic
1076010651 10:126985511-126985533 CATGCACCATGTCCTGCTGTTGG - Intronic
1076042506 10:127262789-127262811 CCAGCACCAGGCACTGCTGTGGG + Intronic
1076670272 10:132117097-132117119 GAAGAACCAGGAGCTGCGGCAGG + Exonic
1076711387 10:132337196-132337218 CGAGGGCCAGGTGCTGCGGCAGG + Intronic
1076712509 10:132346174-132346196 CAGGCACCAGCGGCTGCTGATGG + Intronic
1077183540 11:1226817-1226839 CAAGGCCCAGGGGCTGGTGCTGG + Exonic
1077976912 11:7256291-7256313 CCAGCAGCTGCTGCTGCTGCTGG - Intronic
1078753032 11:14182992-14183014 CAAGCATGGTGTGCTGCTGCAGG - Intronic
1080163363 11:29206433-29206455 CAATGACGAGGTGCTGCTGGTGG - Intergenic
1080579757 11:33632542-33632564 CAAGCAGCAGGTACTGTAGCAGG - Intronic
1080741280 11:35066636-35066658 CAACCATCAGGGGTTGCTGCTGG - Intergenic
1081493363 11:43583397-43583419 CAAGCAGCAGCTGCAGCAGCAGG - Intronic
1082781767 11:57293639-57293661 CAAACACCAGTTGCAGCTCCTGG + Intergenic
1083674319 11:64317057-64317079 CATGCACCACCTGCTGCTGGAGG - Exonic
1083800135 11:65041736-65041758 CGCGGACCCGGTGCTGCTGCAGG + Exonic
1083857075 11:65398517-65398539 CATGCGCTAGGAGCTGCTGCGGG - Intronic
1084154964 11:67308233-67308255 CGACAACCAGATGCTGCTGCTGG + Exonic
1084172162 11:67405900-67405922 CAGGCAGCAGGGGCTCCTGCAGG + Exonic
1084175168 11:67419099-67419121 CAAGCCGCCGGGGCTGCTGCGGG + Exonic
1084427815 11:69095175-69095197 AAAGTTTCAGGTGCTGCTGCTGG + Intergenic
1084957170 11:72697611-72697633 TGAGAACCAGGTGCTGGTGCTGG - Exonic
1085724392 11:78941622-78941644 CAAGCAGCAGGTGCTGGGGCAGG + Intronic
1088687570 11:112297966-112297988 CAGCGACCAGGTGGTGCTGCTGG + Intergenic
1088863172 11:113821194-113821216 CATTCACCATGTGCTGCTTCTGG + Intronic
1089090454 11:115870071-115870093 CTTGCAGCAGCTGCTGCTGCAGG - Intergenic
1089511186 11:118998269-118998291 CAAGCACCAGCGGCAGCTGAAGG + Exonic
1090474074 11:127003912-127003934 CCGGCCCCAGGTTCTGCTGCTGG + Intergenic
1091288229 11:134421049-134421071 CAAGGGCCAGATTCTGCTGCTGG - Intergenic
1091547237 12:1509649-1509671 AAAGGAACAGGTGCTGCCGCAGG - Intergenic
1091894705 12:4091868-4091890 CAAGAACCAGTGGCTGCCGCAGG + Intergenic
1094072314 12:26431386-26431408 GAAGCAGCAGCTGCTGATGCTGG - Intronic
1096573908 12:52540803-52540825 GAACCACCAGGGGCTGCTGGGGG - Intergenic
1098882883 12:75934756-75934778 CAATCAACAGCTACTGCTGCTGG + Intergenic
1101414765 12:104499444-104499466 CAATCACCAGTTGCTGCTCCAGG - Intronic
1101589647 12:106114294-106114316 CAAGCCCAAGGTGCAGATGCTGG - Intronic
1102006341 12:109591333-109591355 CCAGCACGAGGTACTGCTCCGGG - Exonic
1102401979 12:112637832-112637854 AAAGAACCAGGTGGGGCTGCTGG - Intronic
1103331937 12:120160186-120160208 CAAGCAGAAGGAGATGCTGCAGG - Exonic
1103725965 12:122997515-122997537 CAAGATCCACGTGCTGCTACTGG - Exonic
1103758959 12:123233885-123233907 CACGCATCAGGTGCTGTTTCAGG + Intronic
1103977290 12:124711528-124711550 CAAGCACGAGCTGCAGCTTCCGG + Intergenic
1104127399 12:125861381-125861403 CAGGCCCCGGGTGCTGCGGCGGG + Intergenic
1104241300 12:126992569-126992591 CAAGCACTAGGAGATGCTGAGGG - Intergenic
1104423164 12:128653725-128653747 CAAGTACCAGGTGCTGTTCCAGG - Intronic
1104860392 12:131920437-131920459 CCGGGACCAGGTGCTGCTTCTGG - Intronic
1105942006 13:25156081-25156103 CAAGCAGGTGGAGCTGCTGCTGG - Intergenic
1107977511 13:45704312-45704334 GGAGGACCTGGTGCTGCTGCTGG + Intronic
1108694962 13:52895097-52895119 AATGCAGCTGGTGCTGCTGCCGG - Intergenic
1113728635 13:112624167-112624189 CCAGGAACAAGTGCTGCTGCCGG - Intergenic
1113757437 13:112822965-112822987 CTGGCTCCAGGTGCTGCTGACGG + Intronic
1113800723 13:113085157-113085179 CAAGTACCAGCTGCTGCTCAAGG + Exonic
1114618812 14:24082596-24082618 CAGCCCCCAGCTGCTGCTGCAGG + Exonic
1115458693 14:33634877-33634899 CAAGTTTCAGGTGATGCTGCTGG - Intronic
1116029191 14:39550361-39550383 CACACACCAGGGCCTGCTGCGGG - Intergenic
1117512691 14:56469956-56469978 CCAGCAACAGCAGCTGCTGCAGG + Intergenic
1118292909 14:64541890-64541912 CAAGATCCAGAAGCTGCTGCAGG + Exonic
1118316845 14:64730928-64730950 CAAGTACCACCTGCTGCTCCAGG + Exonic
1119069893 14:71572007-71572029 CAAGGTCCAGCTGCTGCTGGTGG + Intronic
1119415466 14:74466608-74466630 CATGAACAAGGGGCTGCTGCTGG + Intergenic
1119747323 14:77053484-77053506 TTAGCACCACCTGCTGCTGCCGG + Intergenic
1119923498 14:78469615-78469637 CAAACACCAGGTGTTGATCCAGG - Intronic
1119936093 14:78593775-78593797 GAAGCCCCAGGTGCATCTGCTGG - Intronic
1121173140 14:91870985-91871007 CAGGCACCAGGGCCTGCTTCAGG + Intronic
1121511550 14:94516502-94516524 CAAACACCAGGTGCACCAGCAGG + Intronic
1121613825 14:95299476-95299498 CCAGCACCTGGTGCTGCACCTGG - Intronic
1122130742 14:99603506-99603528 CAAGGAGCTGGTGCTGCTGCTGG - Exonic
1122267331 14:100552823-100552845 CAGTCACCAGGTCCTTCTGCTGG - Intronic
1122767340 14:104081533-104081555 CAGGTTCCAGGTGCTGCTGCTGG + Intergenic
1122801407 14:104231559-104231581 CCACCACCAAGTGCTGGTGCAGG - Intergenic
1123017417 14:105382037-105382059 CCAGCTACAGGTGCAGCTGCAGG + Exonic
1123936912 15:25198488-25198510 CCAGCGCCTGGTGATGCTGCAGG + Intergenic
1123940554 15:25214552-25214574 CCGGCACCTGGTGGTGCTGCAGG + Intergenic
1123940952 15:25216447-25216469 CTGGCACCTGGTGCTGCTGCAGG + Intergenic
1123943522 15:25228014-25228036 CTGGCACCTGGTGGTGCTGCAGG + Intergenic
1123981415 15:25608082-25608104 CATGCACCAGGCGCTGCTCTAGG - Intergenic
1125540410 15:40466722-40466744 CCAGCACCAGTTGCTACTGCAGG - Exonic
1125721620 15:41847788-41847810 CAACAACCAGGAGCAGCTGCTGG + Exonic
1129410491 15:75348051-75348073 CAGGGACCAGGCGCTGCCGCGGG + Intronic
1129456029 15:75676611-75676633 AAACCACCCGGAGCTGCTGCTGG + Exonic
1131424542 15:92334861-92334883 CATGCACCAGGTACTGTTACAGG + Intergenic
1132874193 16:2128491-2128513 CAGGCACCCTGTGCGGCTGCAGG + Intronic
1133316242 16:4885747-4885769 CAAGAACCAGCTGCTGCAGGAGG - Exonic
1134438748 16:14285160-14285182 AAAATCCCAGGTGCTGCTGCTGG + Intergenic
1134553139 16:15147315-15147337 CAGGCACCCTGTGCGGCTGCAGG + Intergenic
1135779958 16:25291824-25291846 CAGGCAGCAGGTGTTGCTTCAGG + Intergenic
1136025321 16:27464809-27464831 CCAGCACCTGATGCTGCTCCAGG + Exonic
1138213748 16:55184881-55184903 CCAGCCCCAGGTGCTCCAGCAGG + Intergenic
1138414781 16:56865372-56865394 CATGCAGAAGGTGCTGCTGTGGG - Exonic
1138640767 16:58384585-58384607 CCAGCACCTGCTCCTGCTGCAGG + Intronic
1139430238 16:66907239-66907261 CAAGCACCATGAGCTGATGATGG - Intergenic
1139636108 16:68259552-68259574 GGAGCACCAAGTGTTGCTGCAGG + Exonic
1140517652 16:75555902-75555924 CCAACACCAGGTGCTGCTCGTGG - Exonic
1141128393 16:81417458-81417480 CAAGCTCCTGGGGCTGCTGCTGG - Intergenic
1141677287 16:85524496-85524518 CAAGACCCAGGGGCTGCTACTGG - Intergenic
1142106067 16:88303476-88303498 CCAGGGCCAGGTGCTGCTGCAGG - Intergenic
1142688486 17:1591332-1591354 CAAGGAGCAGGTGGCGCTGCAGG - Exonic
1143371848 17:6445161-6445183 CCAGCACCAGGAGCAGCTGGAGG + Exonic
1144090605 17:11852563-11852585 GAAGAACCAGGGGCTGCTCCAGG - Intronic
1144338345 17:14292707-14292729 CACGCACCAGGGCCTGCTGGGGG - Intergenic
1144556404 17:16286390-16286412 CAGTCACCAGGTGCTGGTGAGGG - Intronic
1144627966 17:16854767-16854789 CAGTCACCAGGTGCTGCTCCTGG - Intergenic
1144707435 17:17378870-17378892 AAGGTCCCAGGTGCTGCTGCAGG + Intergenic
1145159559 17:20565348-20565370 CAATCACCAGGTGCCACTCCTGG - Intergenic
1146637667 17:34518346-34518368 CAACTCCCAGGTGATGCTGCTGG + Intergenic
1147545243 17:41396182-41396204 CAAGCACATGGAGCTGCTCCGGG + Intronic
1147636728 17:41968487-41968509 CCAGTACCAGGTGGTGCTGGTGG + Exonic
1148344767 17:46895832-46895854 CAAGCCCCTGGTCCTACTGCAGG + Intergenic
1149094893 17:52828370-52828392 TAGCCACCAAGTGCTGCTGCTGG - Intergenic
1151185552 17:72361508-72361530 CATGCACCAGGCTCTGCTGTAGG + Intergenic
1151569730 17:74920250-74920272 CCAGCGCCAGATGCTGCAGCCGG + Exonic
1151978729 17:77497088-77497110 CCAGCACCAGCTCCTGCTCCTGG - Intronic
1152091311 17:78249367-78249389 CATGCACCAGGTGGGGATGCTGG - Intergenic
1152586650 17:81192356-81192378 CCAGCTCCAGCTGCTGCTTCAGG + Exonic
1154100303 18:11466726-11466748 CCTTCACCAGGTGCTGCCGCTGG + Intergenic
1154210746 18:12377007-12377029 CAGGCACGAGGAGCTGCTGTAGG + Exonic
1155360484 18:24995064-24995086 CAAGTAACAGATGCTGCTTCTGG + Intergenic
1157192291 18:45591654-45591676 CAAGCACCCAGTGCTGCTGCTGG + Intronic
1157632384 18:49111748-49111770 CAAGCAGCAGCATCTGCTGCTGG - Intronic
1158872971 18:61706768-61706790 AAAGCACCAGGTGCCTCTGAAGG - Intergenic
1159942208 18:74417007-74417029 CAAGCACCATCTGCTTCTGTGGG - Intergenic
1160679754 19:407324-407346 CACGCAGCAGTTGATGCTGCGGG + Exonic
1160782425 19:883773-883795 GTGGCGCCAGGTGCTGCTGCAGG + Intronic
1160783113 19:886675-886697 TAAGCACCAGCGGCTGCTGCGGG + Intronic
1160842580 19:1152803-1152825 CAAGCAGCAGGACCTGCTCCAGG - Intronic
1161270651 19:3387713-3387735 CCAGCTCCATGTGCTGCTCCTGG - Intronic
1162061931 19:8101388-8101410 CAGGCACCAGGAGGAGCTGCAGG - Intronic
1162173132 19:8807150-8807172 CCAGCCCCAGGTCCTCCTGCAGG - Exonic
1162781240 19:13007994-13008016 TAAACACCAGGTACAGCTGCAGG + Intronic
1162904973 19:13817951-13817973 CAAGCAGGCGGGGCTGCTGCTGG + Exonic
1164464075 19:28472709-28472731 CAAGCTCCAGGCGAGGCTGCTGG + Intergenic
1165108594 19:33488449-33488471 CCAGCACCAGGTAGTGCTGGGGG + Intronic
1165394633 19:35557724-35557746 CAAGGGCCAGGAGCTGCCGCTGG - Exonic
1165941540 19:39416979-39417001 CAAGTACCATCTGCTGCTGCAGG + Exonic
1166334897 19:42099782-42099804 CAAGCACCAGCTGCTGGAGCTGG + Exonic
1166907252 19:46119887-46119909 CATCCCCCAGATGCTGCTGCAGG - Intergenic
1167315499 19:48760708-48760730 CCAGCCCCAGTTGCTGCAGCCGG + Intergenic
1167477955 19:49711847-49711869 CAAGCACCAGGCTCTGCTGAAGG + Exonic
1167528267 19:49999198-49999220 CAATAAGCAGGTGCTGCTACTGG + Intronic
1168686632 19:58353015-58353037 CAAGCACCAGTTCCTGCTGACGG - Exonic
925380077 2:3418721-3418743 CCAGCACCAGGCCCAGCTGCTGG + Intronic
926003711 2:9354713-9354735 CAGGAACCAAGTTCTGCTGCTGG + Intronic
926464806 2:13175300-13175322 CAACCTCCAGATGCTGCTGCAGG - Intergenic
926615351 2:14991704-14991726 CAAGACCCAGGTGATGCTGATGG - Intergenic
927128334 2:20034244-20034266 CAAGCTCCAGGTTCTTCTCCTGG + Intronic
927155661 2:20219831-20219853 CCAACACCAGGTCCTGCTGGGGG - Intronic
927173935 2:20392272-20392294 CCCACACCAGGTTCTGCTGCAGG - Intergenic
927704247 2:25287238-25287260 CCACCAGCAGGTGCAGCTGCAGG + Intronic
927793368 2:26028312-26028334 CATGCACCACCTGCTGCTGGAGG - Intergenic
927937101 2:27082291-27082313 CCAGCACCAGCTGCAGCTCCTGG + Exonic
929090637 2:38213933-38213955 CAAGAGCCTGGTGCTGCTGCAGG + Intergenic
929164073 2:38863367-38863389 CAAGAACAAGATGCTGATGCTGG - Exonic
930143918 2:47981756-47981778 CATGCACCAGGGGCAGCTGCTGG - Intergenic
935255698 2:101308207-101308229 CAAGGACAAGGTGCTGGTGGCGG - Exonic
935804976 2:106736576-106736598 CAAACTCCATGAGCTGCTGCTGG - Intergenic
937134137 2:119537700-119537722 CAACCACCAGATGATGCTGTGGG + Intergenic
937147281 2:119658510-119658532 CAAGTACCAGTTGCTGTAGCAGG - Intronic
937839312 2:126509784-126509806 CCAGCACCAGGCACTGCTCCTGG + Intergenic
938408591 2:131046099-131046121 CCAGCAGCAGGTCCTGGTGCTGG + Exonic
938408590 2:131046099-131046121 CCAGCACCAGGACCTGCTGCTGG - Exonic
938991188 2:136631600-136631622 CAACTACCAAGTGCTCCTGCAGG - Intergenic
939153932 2:138502148-138502170 CAAGCGCCTGGGGCTGCCGCGGG - Intronic
940515947 2:154684171-154684193 CAACCATCAGGTGCTGGTTCAGG - Intergenic
940528654 2:154850088-154850110 AAAGCAACAGATGCTGCTACTGG - Intronic
941653701 2:168120950-168120972 CAGGCACTAGGAGATGCTGCAGG - Intronic
941746259 2:169089851-169089873 CAAGCTCCAGGTGCTGCCCATGG + Intronic
942105537 2:172629760-172629782 CAACCCCTAGGTGCTGCTGCAGG + Intergenic
944480622 2:200154028-200154050 ACAGCCCCATGTGCTGCTGCTGG + Intergenic
944711248 2:202336655-202336677 CCAGCACCAGGAGCAGCTGGAGG - Intergenic
946405079 2:219488222-219488244 CAAGGACCAGGTGCTGCTGGAGG + Exonic
946416069 2:219540360-219540382 CATTCACCAGCTGCTGCTTCTGG + Exonic
946880833 2:224175801-224175823 CAGGAACCAGATGCTGCTGCTGG + Intergenic
946966431 2:225042245-225042267 CACTCACCCGCTGCTGCTGCCGG + Exonic
947736700 2:232458945-232458967 CATGCACCAGGTGCGCCTGCGGG - Exonic
948005759 2:234606321-234606343 CAAGCGCCAGGTGCTCTTGTAGG - Intergenic
948194108 2:236082415-236082437 CACCCACCAGGTCCTGCTACGGG + Intronic
948543145 2:238704063-238704085 CTAGCCCCAGCTGCAGCTGCTGG - Intergenic
948674149 2:239587353-239587375 CAAGGGCCTCGTGCTGCTGCGGG + Intergenic
1168874399 20:1160872-1160894 GCAGCACCAGGTGCTCCTCCAGG - Intronic
1169199788 20:3703320-3703342 CAAGAACCATGTCCTGCTGGAGG - Exonic
1169337821 20:4771553-4771575 CAAGAATCAGGTGCTGCTCTAGG + Intergenic
1169564366 20:6837393-6837415 CAATCACCAGATGATGCTGATGG - Intergenic
1169851750 20:10059845-10059867 CAAGCTCCCTGTGATGCTGCTGG - Intergenic
1169980312 20:11377294-11377316 CATGCATCAGGTGGTTCTGCTGG - Intergenic
1170404267 20:16019885-16019907 GAAGCAACATGTGCTACTGCTGG - Intronic
1170429560 20:16263889-16263911 CAAGCAGGAAGTGCTGCTGGAGG - Intergenic
1173231763 20:41204073-41204095 CATGCACTGGGGGCTGCTGCTGG + Exonic
1175429561 20:58891843-58891865 CACGCACCGCCTGCTGCTGCTGG + Intronic
1175530362 20:59670720-59670742 CAAGCACCACGTGCTGTCACAGG - Intronic
1175663113 20:60834707-60834729 CAAGAACCAGGTGGTGATTCAGG - Intergenic
1176024194 20:62977522-62977544 CAGGCAGGAGGTGCTACTGCAGG + Intergenic
1179460095 21:41528807-41528829 GAAGCAGCAGGTGCCTCTGCTGG + Intronic
1181033830 22:20160602-20160624 CAATCACCTGGTGCTGTTGGGGG - Intergenic
1181043195 22:20202626-20202648 CAGGCACCATCTGCTGGTGCAGG - Intergenic
1181314692 22:21963716-21963738 GTAGCAGCAGGTGCTGTTGCAGG - Intronic
1181358644 22:22318339-22318361 CAACCATCAGGGGATGCTGCAGG + Intergenic
1181509525 22:23382801-23382823 CAATCACCTGGTGCTGTTGGGGG + Intergenic
1182308482 22:29388187-29388209 GAAGCCCCAGGAGGTGCTGCGGG + Intronic
1183314332 22:37128719-37128741 CAGGCACCTTGTCCTGCTGCAGG + Exonic
1183328988 22:37209284-37209306 CAAGGACCTGGGGCTGCAGCGGG + Intronic
1183338051 22:37262214-37262236 CCACCACCATCTGCTGCTGCTGG - Intergenic
1183354254 22:37350004-37350026 CCAGGACCAGGTGCTGCTGTGGG - Intergenic
1183385183 22:37510140-37510162 CAAGCCCCAGTACCTGCTGCAGG + Intronic
1183922161 22:41177903-41177925 TAAGCACCTGTTGCTGCTGCAGG - Exonic
1183949908 22:41347152-41347174 CCAGCACCAGCTGCTGCTGGTGG + Intronic
1183975118 22:41507585-41507607 CAAGTGCCAGGTGCTGCAGGAGG + Intronic
1184095517 22:42314322-42314344 CACGGACCAGCTGCCGCTGCCGG + Intronic
1184300168 22:43553995-43554017 CTACTACCTGGTGCTGCTGCTGG - Intronic
1184334235 22:43844039-43844061 CATCCAGCTGGTGCTGCTGCAGG + Intronic
1184335402 22:43849900-43849922 TGAACCCCAGGTGCTGCTGCGGG + Intronic
1184417993 22:44363322-44363344 CAGGCACCAGGGGCTGCAGATGG - Intergenic
1184790683 22:46697982-46698004 CAGGCTCCCGGGGCTGCTGCTGG - Intronic
1184877380 22:47284168-47284190 CAAGAAGCAGGTGCATCTGCTGG + Intergenic
1185380555 22:50505803-50505825 CCGCCCCCAGGTGCTGCTGCAGG - Exonic
949863959 3:8532061-8532083 CAAGCCCCAGGTGACGCTTCTGG + Intronic
950204475 3:11068164-11068186 CAACCCCTAGATGCTGCTGCAGG + Intergenic
950254375 3:11492604-11492626 CAGGAACCAGCTGCTGCTTCGGG + Intronic
950322582 3:12070526-12070548 GCAGCACCAGGTGCTCCTCCGGG - Intronic
950322584 3:12070532-12070554 GGAGCACCTGGTGCTGCTGACGG + Intronic
950420530 3:12896114-12896136 CAAACACCAGCTGCTGCTGGTGG + Intergenic
950458165 3:13104842-13104864 CAAGCAGCGTGTGCTGCGGCAGG + Intergenic
950566696 3:13773473-13773495 CAAGCAGCAGGGGTTGCTGGGGG + Intergenic
952323133 3:32296549-32296571 CAAGCAACAGGTCCTGCTTCTGG + Intronic
952945621 3:38476515-38476537 CGAGCACCAGGTGTGGTTGCTGG + Intronic
952972290 3:38659199-38659221 CAAGCAGCAGCGGCTGTTGCTGG + Intergenic
953274257 3:41479430-41479452 AAAGCACCAGTTGGTGCTGTTGG + Intronic
953494032 3:43371372-43371394 GGGGAACCAGGTGCTGCTGCTGG - Intronic
953675980 3:45002886-45002908 CGAGCACCAGCTACTGCTGTGGG - Intronic
953849993 3:46458543-46458565 CAAGCAAGAGATGCTGGTGCTGG + Intronic
954304078 3:49716442-49716464 CACGCACCAGGAGCTGCACCAGG - Exonic
954327908 3:49873571-49873593 CAAGCAGCAGGAGCAGCTACTGG - Intergenic
957028118 3:75208548-75208570 CAGGCTTCAGGTGATGCTGCTGG + Intergenic
957297867 3:78355266-78355288 CAACCCCTAGATGCTGCTGCAGG - Intergenic
958168915 3:89914583-89914605 CAACCCCTAGATGCTGCTGCAGG - Intergenic
959542609 3:107557665-107557687 CAAACACTAAGAGCTGCTGCAGG - Intronic
961651090 3:128417022-128417044 GAAGCAACAGGACCTGCTGCTGG - Intergenic
962826031 3:139101670-139101692 CAAGCACCTGCAGCTGCTCCTGG + Intronic
962910337 3:139842848-139842870 CAAACACCAGGGCCTGCTGGGGG - Intergenic
963599502 3:147365446-147365468 CAGGTACCAGGTGCTTCAGCAGG - Intergenic
966824594 3:183953113-183953135 CAACCACCAGGTGCTGAAGGCGG + Exonic
968244492 3:197129261-197129283 AAAGCAGCAAGTGCTGCTGTAGG - Intronic
968501967 4:954757-954779 GAACCACCATGTGCTGCTGGTGG - Intronic
968551177 4:1224008-1224030 CCAGCGCCAGGGGCAGCTGCTGG + Intronic
968568482 4:1327292-1327314 AGAGCAGCAGGTGCAGCTGCTGG - Intronic
968673857 4:1866514-1866536 CCAACTCCAGGTGCTGCTGTGGG - Intergenic
968682401 4:1930035-1930057 CATGCTCCGGGTGCTGATGCTGG + Intronic
968829381 4:2924729-2924751 CACACACCAGGCCCTGCTGCTGG + Intronic
968854586 4:3110009-3110031 CAAGAAGCTGGTGCTGCTGAAGG - Intronic
969266346 4:6066590-6066612 GAAGCATGAGCTGCTGCTGCTGG - Intronic
969412951 4:7041918-7041940 CAAGAAGCAGGTGGTGATGCAGG - Exonic
969639962 4:8391410-8391432 CAAGGACCAAGTGCTCCTGGAGG + Intronic
971240708 4:24886299-24886321 CAACCACCAGGTCTTGTTGCAGG + Intronic
972165755 4:36281977-36281999 CAAGCAGCACATGCAGCTGCTGG - Intronic
973557207 4:52096051-52096073 AAAGCATCAGGTGCTGGTTCTGG - Exonic
973907536 4:55546590-55546612 ACAGCCCCAGGTGCTGCTGGAGG - Intronic
976100933 4:81562498-81562520 TAAGCACAAGGTGCTACTCCTGG - Intronic
977197058 4:94076580-94076602 CTATCATCATGTGCTGCTGCAGG - Intergenic
977536573 4:98261409-98261431 GGAGCAGCTGGTGCTGCTGCAGG - Intronic
978905590 4:114001813-114001835 CAAACTTCAGGTTCTGCTGCTGG - Intergenic
979954567 4:126935971-126935993 AGAGCGCCATGTGCTGCTGCAGG + Intergenic
985548415 5:521261-521283 CAAGGAACAGGTGCTGCTGTTGG - Intronic
989617151 5:43348532-43348554 GCAGCACCAGGTGCTGGAGCAGG - Intergenic
992769384 5:80033272-80033294 AATGCACCACGTGCTGCTGGAGG - Intronic
993119698 5:83759451-83759473 CACACACCAGGGGCTGCTGGGGG + Intergenic
997274252 5:132570486-132570508 GAAGCAGCAAGTGCTGATGCAGG - Intronic
997353027 5:133244320-133244342 CGAGCACAGGGTGCTGCTGGTGG + Intronic
997668959 5:135654816-135654838 CCAGCAGCAGCTGATGCTGCAGG - Intergenic
998330296 5:141320318-141320340 CAACCTCTAGGTGCCGCTGCCGG + Exonic
998336215 5:141374650-141374672 CAAGTACCCGGAGCTGGTGCTGG + Exonic
1001211358 5:169812959-169812981 GAAGCGGCAGATGCTGCTGCTGG + Intronic
1002088744 5:176792446-176792468 GAGCCACCAGGTGCTGCAGCAGG + Intergenic
1002160523 5:177311791-177311813 CAACATCCAGGTCCTGCTGCAGG - Exonic
1002296057 5:178232108-178232130 CCAGGCCCAGGTGCTGCTGACGG + Intronic
1002424231 5:179166234-179166256 CAGGCTCCCGGTGCTGCTGTGGG - Intronic
1003573293 6:7269962-7269984 CAAGGACCACATGGTGCTGCTGG - Intronic
1004661360 6:17712792-17712814 CAAGCACCAGCTGCAGCCCCCGG + Intergenic
1005253344 6:23972577-23972599 CATTCACCATGTGCTGCTTCTGG - Intergenic
1006183497 6:32167616-32167638 CAGCGACCAGGTGCTGCTGCTGG + Exonic
1006364974 6:33610003-33610025 CAGGCAGCAGGTGCTGGGGCTGG - Intergenic
1006368282 6:33628783-33628805 CAAGCACCTGCAGCTGCTCCTGG - Intronic
1006939153 6:37740178-37740200 GAATCTCCAGGTGCTGGTGCAGG - Intergenic
1007472205 6:42098368-42098390 CCAGCATCTGGTGCTGCTCCTGG - Intergenic
1007820858 6:44559633-44559655 CAAGCAAGAGGTGCTGCCACTGG - Intergenic
1008189256 6:48433970-48433992 CCAGCACCCAGTGCTCCTGCAGG - Intergenic
1008539612 6:52535251-52535273 AAAGCACCACGTGGTGCAGCAGG + Intronic
1010007832 6:71015016-71015038 CAAGCTCCAGGTGATACTGATGG + Intergenic
1011684647 6:89814726-89814748 CCAGCACCAGGAGCAGCCGCTGG + Intronic
1012878957 6:104762531-104762553 CACGCACCAGGGCCTGCTGAGGG + Intronic
1012919901 6:105210557-105210579 CAAACACTGGGTGCTGCTGCTGG + Intergenic
1013117323 6:107113528-107113550 AGAGCGCCAGTTGCTGCTGCTGG - Intronic
1014061416 6:117076151-117076173 CAAGCACCAGGAGTTGAGGCAGG + Intergenic
1014428162 6:121334391-121334413 CGAGGACCAGGCGATGCTGCAGG - Exonic
1015829244 6:137350022-137350044 CTAGCAACAGGTGCAGCTTCAGG - Intergenic
1015993016 6:138967816-138967838 CAAGTACCAGGCGCTGTTCCTGG + Intronic
1017265086 6:152435492-152435514 CAAGCTCCAGGAGCTTCTTCAGG + Intronic
1018827323 6:167419121-167419143 AAAGCAACAGGTGAAGCTGCTGG + Intergenic
1018934853 6:168267059-168267081 CTAGCAGCTGCTGCTGCTGCGGG + Intergenic
1019577588 7:1744920-1744942 CAACCTGCAGGTGCTGCAGCTGG + Exonic
1019592831 7:1844325-1844347 GGAGCCCCAGCTGCTGCTGCTGG + Intronic
1020016483 7:4834795-4834817 CAAACTCCAGGAGCAGCTGCTGG + Exonic
1020210782 7:6156685-6156707 CAAGCTCCAGGGTCTGCTGCTGG + Intronic
1021397897 7:20172922-20172944 CTGGCACCAGGTGGTGCTGTGGG - Intronic
1021573125 7:22084784-22084806 CAAGTTCCAGGTCCTGCTGCTGG - Intergenic
1023234583 7:38070999-38071021 GAAGGACCATGTGCTGCTGCTGG - Intergenic
1023836926 7:44073889-44073911 CAACCTCCAGGGGCTGCTGTGGG - Exonic
1024062275 7:45708147-45708169 CAAGCCCCAGGGGCTCCTGAGGG - Intronic
1027230955 7:76272128-76272150 CTAGCACCAGGTTGTGCTGGTGG - Intronic
1029110942 7:98212768-98212790 CAGCCACCTGCTGCTGCTGCTGG - Exonic
1029235125 7:99109204-99109226 GAACCACCATCTGCTGCTGCTGG - Intronic
1030164791 7:106543375-106543397 CAAGGACCAGGTGCTGTTCTAGG + Intergenic
1030741616 7:113116432-113116454 CAAGCCCCAGGTGATGTTGCTGG + Intergenic
1031636729 7:124109931-124109953 CAAGAATCAGGAGCTACTGCAGG + Intergenic
1034300295 7:150009340-150009362 CAAGAACCAGGCTCTGCAGCAGG + Intergenic
1034333460 7:150304499-150304521 CAAGCAGCAGGTGTTGATGTAGG - Intronic
1034664581 7:152805391-152805413 CAAGCAGCAGGTGTTGATGTAGG + Intronic
1034805759 7:154087968-154087990 CAAGAACCAGGCTCTGCAGCAGG - Intronic
1035253472 7:157612125-157612147 CAGGCACCAGGTGCTGCTCAGGG - Intronic
1035521511 8:278115-278137 CAGACACCATGTGCTGCTGGTGG - Intergenic
1036166343 8:6437651-6437673 CACGCACCAGGTGAGGCAGCGGG - Intronic
1037770037 8:21793204-21793226 CATGCACCAGGAGCCGCTGAAGG + Intronic
1037890050 8:22619277-22619299 CCAGCTCCAGCGGCTGCTGCAGG + Exonic
1037906817 8:22720342-22720364 CAAGCACCAGTCCCGGCTGCTGG - Intronic
1039970374 8:42316823-42316845 GGAGGACCAGGAGCTGCTGCAGG + Exonic
1040477011 8:47787639-47787661 GCAGGATCAGGTGCTGCTGCAGG + Intronic
1041381468 8:57258183-57258205 CAGGCGCCATGTGCAGCTGCAGG - Intergenic
1042271537 8:66961486-66961508 CAAGCTGGACGTGCTGCTGCTGG - Exonic
1042693928 8:71534733-71534755 CATGCACCAGGGCCTGTTGCAGG + Intronic
1042847318 8:73181398-73181420 CAACCACCATCTGCTCCTGCAGG - Intergenic
1043443139 8:80294508-80294530 CAAGCCCCAGATGCTGATGCTGG - Intergenic
1043641230 8:82452553-82452575 CAAGCACCAGGTCCAGCAGCTGG + Intergenic
1044789561 8:95833884-95833906 CCAGCACCGGGGTCTGCTGCTGG - Intergenic
1046281386 8:112037074-112037096 AAGGCACCAGCTGCTGCTGTGGG - Intergenic
1046772937 8:118135000-118135022 CAAGCTTCAGGTGCTGCTGCTGG + Intergenic
1047733516 8:127746199-127746221 CAAGCTCCAGGAGCTGCTAAAGG + Intergenic
1049322968 8:142006923-142006945 CAGGCCCCAGGTCCTGCAGCTGG + Intergenic
1049329640 8:142043339-142043361 CACACACCAGGTGATGCTGGAGG - Intergenic
1049776557 8:144408620-144408642 CCTGCAGCAAGTGCTGCTGCGGG - Intronic
1049784305 8:144443297-144443319 CCAGCTCCAGGTACTGGTGCTGG + Exonic
1050162333 9:2731626-2731648 CAAGTTCCAGGTGATGCTGATGG + Intronic
1052343906 9:27389164-27389186 CAAGTTCCAAGTGATGCTGCAGG - Intronic
1054952530 9:70869021-70869043 AAAGCAACAGGAGCTGCTCCGGG - Intronic
1055278121 9:74642472-74642494 GAAGCACCAGCAGCGGCTGCAGG + Exonic
1056771553 9:89481306-89481328 CAAGCAACAGGAGCTGGTTCAGG + Intronic
1057294597 9:93827811-93827833 CAGGCAGCCGGTGCAGCTGCGGG + Intergenic
1057723883 9:97554750-97554772 CAAGTCCCTGGTGCTGGTGCTGG - Intronic
1058579239 9:106437019-106437041 CAAGGCCCTGGTACTGCTGCTGG - Intergenic
1059112002 9:111566420-111566442 CAAGCTCCAGTGGCTGCTGGAGG + Intronic
1059308037 9:113369959-113369981 CGAGCCCCTGGGGCTGCTGCGGG + Exonic
1059343590 9:113613319-113613341 CCAGCTCCAGGTGCAGTTGCTGG + Intergenic
1061120215 9:128637295-128637317 CAAGCCTCAGGGGCTGCAGCAGG + Intronic
1062390615 9:136332255-136332277 CACCCACCTGGTGCAGCTGCAGG + Intronic
1185465379 X:351252-351274 CAAGGACCCGGTGCTGCACCCGG - Intronic
1187392597 X:18895914-18895936 CAAGCACCATGAGCCCCTGCAGG + Intronic
1187484282 X:19687407-19687429 AAAGCGCCAGGGGCTGGTGCTGG + Intronic
1187506695 X:19884047-19884069 CAAGAACCAGGTGTGGCTGGAGG + Intronic
1187537619 X:20157617-20157639 CAAACACCAGGTGCAGCTGGAGG + Intronic
1188370963 X:29369232-29369254 GAAGCAGCAGCAGCTGCTGCTGG + Intronic
1188451029 X:30308505-30308527 CCAGCACCAGCTGCTGGTCCAGG + Exonic
1189266274 X:39719156-39719178 CAAGCACTAAGAGCTGCTCCAGG + Intergenic
1190322423 X:49186830-49186852 CGAGCACCAGCTGGGGCTGCGGG - Intergenic
1190723558 X:53171530-53171552 CTACCACCAGGAGGTGCTGCTGG - Intergenic
1190745321 X:53319055-53319077 CAAGCTACAGCTGCTGCTCCTGG + Intronic
1194465377 X:94228692-94228714 CCAGGGCCAGGTGCTGCTGCTGG + Intergenic
1195552556 X:106185445-106185467 CAAGTTCCAGGGACTGCTGCAGG - Intronic
1195647516 X:107249498-107249520 CAACCCCTAGATGCTGCTGCAGG - Intergenic
1197643543 X:128993080-128993102 CTACAGCCAGGTGCTGCTGCTGG - Intergenic
1198311932 X:135432986-135433008 AAAGAACCAGCTGCTGCAGCAGG + Intergenic
1198341675 X:135720143-135720165 GGAGCCCCAGGAGCTGCTGCTGG - Intronic
1198346323 X:135763218-135763240 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198348229 X:135780503-135780525 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198350131 X:135797766-135797788 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198352041 X:135815039-135815061 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198353949 X:135832307-135832329 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198355857 X:135849557-135849579 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198357768 X:135866836-135866858 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198359686 X:135884118-135884140 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198366540 X:135945896-135945918 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1199970036 X:152852878-152852900 AAAGCATCAGATGCTGCTACAGG - Intronic
1201241250 Y:11958792-11958814 CATACACCAGGTCCTGCTGGCGG - Intergenic
1201730133 Y:17193622-17193644 CAAGCTCCAGGTCCTGCAGCAGG - Intergenic