ID: 904037107

View in Genome Browser
Species Human (GRCh38)
Location 1:27564853-27564875
Sequence CTCTAGTCCTTCCAAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904037107_904037112 17 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037107_904037117 30 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037117 1:27564906-27564928 GTTTTACAGGAGCCCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 298
904037107_904037116 29 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037116 1:27564905-27564927 CGTTTTACAGGAGCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 123
904037107_904037109 0 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037109 1:27564876-27564898 GACCTGAGATGTCAGTGTCTAGG 0: 1
1: 0
2: 0
3: 20
4: 167
904037107_904037110 1 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037110 1:27564877-27564899 ACCTGAGATGTCAGTGTCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904037107 Original CRISPR CTCTAGTCCTTCCAAGCACC AGG (reversed) Intronic
900471508 1:2857228-2857250 CTCCAGGCCCTCCAAGCACGAGG + Intergenic
903371420 1:22838554-22838576 CTCAAGACCTTCCATGCACCAGG + Intronic
904037107 1:27564853-27564875 CTCTAGTCCTTCCAAGCACCAGG - Intronic
905372422 1:37490659-37490681 CTCTAAGCCTCCCAAGCAGCTGG + Intergenic
905471626 1:38196504-38196526 ATCTACAACTTCCAAGCACCCGG - Intergenic
906806686 1:48785934-48785956 CTCTGCTCATCCCAAGCACCTGG + Intronic
906870757 1:49477557-49477579 CTCAAGTTCTTTCAAACACCTGG + Intronic
907144964 1:52223341-52223363 TTGTAGACCTTCTAAGCACCTGG - Intronic
909615833 1:77606812-77606834 CTCAAGTCCTTTCAAATACCTGG + Intronic
909717121 1:78722620-78722642 CTCTTTTACTTCCAAGCATCTGG - Intergenic
910529660 1:88221188-88221210 CTCTGGTGCTGCCAAACACCTGG + Intergenic
916581508 1:166113618-166113640 CTCCAGTCCTTCCAGCCAGCTGG - Intronic
917541142 1:175915892-175915914 CTATAGTCCTTCCAATGTCCTGG + Intergenic
919088461 1:192949522-192949544 CTCTAAGCCTTCCAAGTAGCTGG - Intergenic
919571928 1:199259923-199259945 CTCTGCTCCTTCCAGGCACAAGG - Intergenic
922613599 1:226947375-226947397 CTCTAGTTCTTACAAAGACCTGG - Intronic
923436646 1:233973518-233973540 CTCAATTCCTCCCAAGAACCTGG - Intronic
923503082 1:234582609-234582631 CTGTTGCCCTTCCAAGTACCTGG - Intergenic
924942027 1:248818625-248818647 CTCCAGTCCTTCCAGGGGCCAGG - Intronic
1064847763 10:19674712-19674734 GTGTAGTCCTTCCAAGAAACAGG - Intronic
1072610473 10:97014279-97014301 CTCTAACCCTACCCAGCACCTGG - Intronic
1075633365 10:124014785-124014807 CTGTAGTCTGTCCGAGCACCTGG + Intronic
1076928786 10:133512877-133512899 TTCCAGCCCTTCCAAGCTCCAGG - Intergenic
1077865344 11:6217570-6217592 CTCTAGTCCTGCCATGCCCTCGG + Exonic
1080511075 11:32972108-32972130 ATCTATTGTTTCCAAGCACCTGG - Intronic
1082644268 11:55702176-55702198 CTCCATGCCTTCCAAGCAGCAGG + Intergenic
1083891499 11:65598026-65598048 CTCTGGTCCTCCCAACCAGCTGG + Exonic
1084007159 11:66329382-66329404 CTGTAGTCCTTCAAAGCAGAGGG - Intergenic
1085091856 11:73723262-73723284 CTCTATTCCTTCCAAATACTGGG + Intronic
1088944353 11:114494855-114494877 CACAAGTCCCTCCGAGCACCTGG - Intergenic
1089377185 11:118002782-118002804 AGCGAGTCCTTCCAAGCAGCCGG + Intergenic
1089626827 11:119756180-119756202 CTCTAGGCCTTTCAAGCAGAGGG - Intergenic
1092530732 12:9342617-9342639 CTCTAGCCCTGCCAAGCAACTGG - Intergenic
1092991424 12:13905672-13905694 CTGTAGTTCTTTTAAGCACCTGG - Intronic
1093435696 12:19131132-19131154 CTCAAGCCTTTCCAATCACCAGG - Intronic
1098667216 12:73179574-73179596 CCCAAGTCCTTCCAAATACCTGG - Intergenic
1098731526 12:74041200-74041222 CTCACTTCATTCCAAGCACCAGG + Intergenic
1099221875 12:79924285-79924307 CTGTATTCCTTCCAAGTACATGG - Intronic
1102856517 12:116299219-116299241 TTCTAGTCCTTGCAAGCCCAGGG - Intergenic
1103318889 12:120078915-120078937 CTCAAGACCTACAAAGCACCTGG - Intronic
1104527752 12:129540152-129540174 CTTTAGTCTTCCCAAGCAGCTGG + Intronic
1111700020 13:91675468-91675490 ATCTTGTACTTCTAAGCACCAGG - Intronic
1114684887 14:24519288-24519310 CTCTATTCCTTCCAAGTTCTGGG + Intergenic
1115163266 14:30419326-30419348 CTCTCATCCTTCCTAGCACATGG + Intergenic
1115574292 14:34695662-34695684 CTCTCTTCCTTCCAAGGCCCTGG + Intergenic
1116930607 14:50687545-50687567 CTCAAGTCCTTTCAAATACCTGG - Intergenic
1117863818 14:60123417-60123439 CTCAAGTTCTTGCCAGCACCTGG + Intronic
1119216082 14:72870092-72870114 CTCCAGATCTTCCAAACACCAGG - Intronic
1119970564 14:78965470-78965492 CTCTTGACCTTTCAACCACCTGG - Intronic
1119975198 14:79017269-79017291 TTCTAGCCCTGCCAAGCAACTGG + Intronic
1122898205 14:104770915-104770937 CTCAAGACCTTCAAAGCACCTGG + Intronic
1126516288 15:49542035-49542057 CTCCACTCCCTCCAACCACCTGG + Intronic
1127788942 15:62381135-62381157 GTCTAGTCCTTCCAGGCACGTGG - Intergenic
1129007406 15:72385323-72385345 CTCTATTCCTTGCAAGCAAAAGG - Intergenic
1130073443 15:80668472-80668494 CTAAAGTCCTTGCAACCACCAGG + Intergenic
1130626672 15:85522798-85522820 CTGTAGTCCTACCTAGTACCTGG + Intronic
1133599632 16:7326573-7326595 CTGGATGCCTTCCAAGCACCAGG + Intronic
1141475645 16:84271483-84271505 TTCCATTCCTTCCAAGCAACAGG - Intergenic
1146218595 17:30998903-30998925 CCATAGTCCTTCCCAGGACCTGG - Exonic
1146227620 17:31080343-31080365 CTCTAGTCCTCCCAAACAACTGG - Intergenic
1148581849 17:48749789-48749811 CTGTAGCCCCTCCAGGCACCTGG + Intergenic
1149342927 17:55705200-55705222 CTCCAGTCCTTCCATGCTGCTGG - Intergenic
1152346386 17:79754898-79754920 CTCTAATCCTGCCAGGCACGGGG + Intergenic
1153914169 18:9731363-9731385 CTTTATTCTGTCCAAGCACCTGG - Intronic
1155263215 18:24065299-24065321 ATCAGGTCCTTCCAAGAACCAGG + Intronic
1156491152 18:37496988-37497010 CTCTAGCCCTTCCCAGGACCGGG - Intronic
1156869864 18:41933370-41933392 CACTTGTCCTACCAAGAACCAGG - Intergenic
1157951610 18:52044286-52044308 CACCAGTCCTACCAAGAACCAGG + Intergenic
1162243672 19:9380448-9380470 CTCTATTCCTTCCCAGCAAAGGG - Intronic
1164752505 19:30667178-30667200 CTGTAGACCTCCCGAGCACCAGG + Intronic
932668038 2:73712844-73712866 CCCTTGTCCTCCCAAGCAGCTGG + Intergenic
940868960 2:158843889-158843911 CTCTAATGCATCCAAGCAGCTGG + Intronic
944684870 2:202109390-202109412 TTCCAGTCCTGCTAAGCACCAGG - Intronic
948270526 2:236670062-236670084 CTGTTCTCCTTCCAAGCACTTGG - Intergenic
1169787126 20:9370958-9370980 CCCTTGTTCTCCCAAGCACCAGG + Intronic
1177932312 21:27300079-27300101 CTGTAGTCCTTTCAACCACTGGG - Intergenic
1179363334 21:40733236-40733258 CTCTGTTCTTTCCAAGCTCCTGG - Intronic
1180840574 22:18957116-18957138 CTCTAGGCTTCCCAACCACCAGG + Intergenic
1182841743 22:33396242-33396264 CTCTAGTGCTTCAAAGCAGAAGG - Intronic
1183241527 22:36661247-36661269 CTGTAGCTCCTCCAAGCACCTGG + Intronic
1183305006 22:37078111-37078133 CACTAGTCCTTCCCAACCCCTGG - Intronic
1184949591 22:47831717-47831739 TTCTGGTCTTTCCAAGCAGCAGG + Intergenic
951819220 3:26790297-26790319 CTCAAGTCCTTCCAAATACCTGG - Intergenic
952945615 3:38476503-38476525 CTCCAGCCCTGCCGAGCACCAGG + Intronic
953159646 3:40406361-40406383 CTCAAGTCCCTCCAAGGAGCAGG - Intronic
953390875 3:42532997-42533019 CTCCAGTCCTCCCAAGCAGGGGG - Intronic
956320578 3:67991976-67991998 CTCTTGTCTTTCTAAGCACATGG + Intergenic
964139482 3:153380524-153380546 CTCTAGTACTTCCTAGCACTGGG - Intergenic
969464218 4:7345066-7345088 CTCTAATCCATCCAAGTCCCTGG - Intronic
971091919 4:23355501-23355523 CTCTCTTCCTTCCAGGCACATGG - Intergenic
974410182 4:61530853-61530875 CTCTAGTACTTTTAAGCACCAGG - Intronic
975365443 4:73523254-73523276 CCCAAGTCCTTCCAAATACCTGG - Intergenic
975650366 4:76586693-76586715 CTCTAGTCCTCTCAGGCAACGGG + Intronic
980516341 4:133867265-133867287 CTCTAGTCCTTCCTGGGAACAGG - Intergenic
980723431 4:136726962-136726984 CTCAAGTCCTTTCAAACATCTGG - Intergenic
981331246 4:143513286-143513308 CTCGCGTCCTGCCAAGCAGCAGG + Intergenic
983894951 4:173071345-173071367 CTCCAGACCTGCCCAGCACCAGG - Intergenic
986134612 5:4964168-4964190 CTCTTGTTCCTTCAAGCACCTGG - Intergenic
986273874 5:6256924-6256946 CTCCACTCCTTCCTAGCTCCAGG - Intergenic
986299382 5:6466228-6466250 CTCCAGTCCTTGTCAGCACCAGG + Intronic
990963170 5:61416162-61416184 CTCTATTCCTTCCAAGAATCTGG - Intronic
991061211 5:62378539-62378561 CTCTAGGCCATTCAAGAACCTGG + Intronic
992345332 5:75869992-75870014 CTCAAGTCCTTTCAAATACCTGG + Intergenic
995443871 5:112221338-112221360 CTCTAGTCTTGCAAAGCAGCTGG + Intronic
997058073 5:130467893-130467915 CTCCAGTGCATCCAGGCACCAGG + Intergenic
999148543 5:149411845-149411867 ATCAAGTCCTTTCAAGTACCTGG + Intergenic
1003852663 6:10241093-10241115 CTCTCATCCTTCCAAGTACCTGG - Intergenic
1004564130 6:16779771-16779793 CTGTAGTAATTCCAAGCACCAGG + Intergenic
1006270730 6:32964965-32964987 CTCTTGGACTTCCAAGCAACTGG + Intronic
1007373750 6:41443040-41443062 CTCTTGTCCCTCCCAGCCCCGGG + Intergenic
1008445119 6:51580122-51580144 CCCCAGTCCTTCCCAGCAGCAGG + Intergenic
1009702681 6:67202992-67203014 CTATGGTCCTTCCCATCACCTGG + Intergenic
1010943838 6:81951642-81951664 CCCTAGTCCTTTCAACCACAGGG + Intergenic
1012474798 6:99606977-99606999 CTCGCGCCCTTCCAAGGACCTGG + Exonic
1013281829 6:108644989-108645011 CTGAGGTCCTTCCATGCACCAGG - Intronic
1020795233 7:12670981-12671003 CTCTACTCCTTCCCAGCCCTAGG + Intergenic
1021640067 7:22727950-22727972 TTCTAGTCCTTCCAAAGCCCGGG - Intronic
1022431679 7:30329356-30329378 CTGTTGTGCTTCCAAGCACTAGG + Intronic
1024204251 7:47142311-47142333 TTCTTCTCATTCCAAGCACCTGG - Intergenic
1024258803 7:47558883-47558905 CTCGAGCCCTTCCACTCACCTGG + Intronic
1028770374 7:94613498-94613520 CTCTAGTCTTTTGAAGTACCAGG - Intronic
1029193245 7:98786537-98786559 GCCTAGGCCTTCCAATCACCTGG + Intergenic
1033691472 7:143741275-143741297 CTCAAGTCCTTTCAGGCATCTGG + Intergenic
1035394761 7:158527596-158527618 CGCTGGTCCTTCCTAACACCTGG + Intronic
1036760933 8:11508099-11508121 CTCTAGTCCTTCCCAGCCCTGGG - Intronic
1036801263 8:11794505-11794527 CTCTCCTCCTTCCAGGCAACAGG - Intergenic
1037744625 8:21632900-21632922 CTCTAGTCACGCCAAGCAACAGG + Intergenic
1039848108 8:41340536-41340558 CCCTAGTACTTCAAAGCACGTGG + Intergenic
1039987081 8:42456803-42456825 CTCCAGGCCTTCCAATTACCTGG + Intronic
1041670587 8:60487840-60487862 CCCTTGTCCTTCCCAGCCCCTGG - Intergenic
1043331288 8:79121303-79121325 CTGTAAGCCTTCCAAGAACCAGG + Intergenic
1044728446 8:95211795-95211817 CTATATTCCCACCAAGCACCTGG - Intergenic
1047718761 8:127619626-127619648 CTCTCTTCCCTCCAAGCACTGGG - Intergenic
1049220445 8:141426461-141426483 CTTCAGTCCTTCCTGGCACCTGG + Intronic
1049417956 8:142504151-142504173 CTCTAGCCCCTCCAAGCTCAGGG - Intronic
1050578619 9:7027241-7027263 CTCAAGTCCTTCCAAATACCTGG - Intronic
1050949091 9:11565924-11565946 CTCAAGTCCTTTCAAATACCTGG - Intergenic
1051036277 9:12749743-12749765 CTCTAGTTGTTCTAACCACCTGG - Intergenic
1051337139 9:16076297-16076319 CTGTACTCCATCCATGCACCTGG + Intergenic
1053371976 9:37569707-37569729 CTGTAGTCCTTCCAGCTACCTGG + Intronic
1056101146 9:83301687-83301709 CTCTGGCCCTTCCAGGCCCCAGG + Intronic
1056121870 9:83496566-83496588 CTCTAGTCCTAGAAATCACCAGG - Intronic
1058873373 9:109221417-109221439 CTCCAGGCCTTCCAAGCAAAGGG - Intronic
1061534531 9:131239394-131239416 ATCTAGTCCGTCCCAGCAACGGG + Intergenic
1061969854 9:134039066-134039088 CCCTCCTCCCTCCAAGCACCAGG + Intronic
1188197850 X:27260793-27260815 CTCTTCTCCTTTCAGGCACCTGG + Intergenic
1189984465 X:46541913-46541935 CTCTAATCCTTCCCCTCACCAGG - Intronic
1190730001 X:53219579-53219601 ATCTAGTTCTTCCAAGAACCAGG - Intronic
1192737537 X:73863454-73863476 CTCCAGGCCTGCCCAGCACCAGG + Intergenic
1197800108 X:130339589-130339611 TTCTAGTCCTTCTACGCGCCAGG + Intergenic
1198586728 X:138129534-138129556 CTCCAGCCCTCCCCAGCACCTGG - Intergenic
1200777529 Y:7182810-7182832 CTGTAAGCCTTCCAAGTACCTGG - Intergenic