ID: 904037111

View in Genome Browser
Species Human (GRCh38)
Location 1:27564878-27564900
Sequence GCCCTAGACACTGACATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904037111_904037116 4 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037116 1:27564905-27564927 CGTTTTACAGGAGCCCAGAGAGG 0: 1
1: 0
2: 1
3: 15
4: 123
904037111_904037117 5 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037117 1:27564906-27564928 GTTTTACAGGAGCCCAGAGAGGG 0: 1
1: 0
2: 3
3: 32
4: 298
904037111_904037112 -8 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037111_904037121 22 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037121 1:27564923-27564945 AGAGGGAAAGGCCTAGCCTGAGG 0: 1
1: 0
2: 2
3: 28
4: 326
904037111_904037118 10 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037118 1:27564911-27564933 ACAGGAGCCCAGAGAGGGAAAGG 0: 1
1: 2
2: 19
3: 188
4: 1274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904037111 Original CRISPR GCCCTAGACACTGACATCTC AGG (reversed) Intronic
904037111 1:27564878-27564900 GCCCTAGACACTGACATCTCAGG - Intronic
904453499 1:30632222-30632244 GGCATAGACACTGCCCTCTCTGG - Intergenic
906295037 1:44644526-44644548 GCCCCTGACCCTGACATTTCAGG - Intronic
910753794 1:90663867-90663889 GTCCAAGTCACTGTCATCTCTGG + Intergenic
919929666 1:202213249-202213271 CCCCTAGACACTGCCACCTTAGG + Intronic
920555398 1:206900499-206900521 ACCCCAGACACTGACTTCCCTGG - Intronic
920837278 1:209523020-209523042 TCCCTAAACACTGATTTCTCTGG - Intergenic
1067723671 10:48750055-48750077 GCCCTAAACACTTACTCCTCTGG + Intronic
1074031881 10:109697135-109697157 GCCCTAGACAGTGAGCTCCCAGG - Intergenic
1074122069 10:110499953-110499975 GCTCTATAGACTCACATCTCAGG + Intronic
1076886074 10:133263043-133263065 GCCCTAGACCCTGACTTTGCAGG - Exonic
1078131302 11:8616457-8616479 GTCCTGGCCACTGACATGTCAGG + Exonic
1080212890 11:29807745-29807767 GCCCTAGACACAGCCATCCCTGG + Intergenic
1080255583 11:30287311-30287333 TCCAGAGGCACTGACATCTCTGG + Intergenic
1080272859 11:30468984-30469006 CCCCTGGTCACTGATATCTCTGG + Intronic
1082071622 11:47944050-47944072 GTCCTAGACACGGAAATCGCCGG - Intergenic
1086522312 11:87683436-87683458 TCCCTAGCCACACACATCTCAGG + Intergenic
1091453673 12:589739-589761 GTCCTAGGCACTGATGTCTCAGG + Intronic
1095917723 12:47497303-47497325 GCTCAAGTCACTGACCTCTCTGG - Intergenic
1096519099 12:52174108-52174130 GCCCCAGAGCCTGACTTCTCTGG - Intronic
1096812669 12:54181738-54181760 GCCCTAGACAGTAACTTCTAAGG - Exonic
1102458245 12:113084230-113084252 GCACTGGACACTGACCCCTCAGG - Intronic
1102988936 12:117300893-117300915 TCCCTTGAGGCTGACATCTCAGG - Intronic
1105972946 13:25447564-25447586 CCCCTAGACACTGCCATGGCTGG - Intronic
1105985527 13:25562526-25562548 CCCATAGACACTGACATCTAGGG - Intronic
1118807022 14:69246648-69246670 TCCCCACACACAGACATCTCTGG - Intergenic
1119409771 14:74423249-74423271 GCCCTGCACCCTGACAGCTCTGG + Intronic
1120161054 14:81144629-81144651 ATCCTACACAATGACATCTCTGG - Exonic
1121818923 14:96950158-96950180 GCCCTGGACACTGACAGCTGAGG - Intergenic
1122795839 14:104205809-104205831 GCCCTCGACACTCACAAGTCAGG - Intergenic
1127031306 15:54866719-54866741 GCCCTAGACGCTGAGATCGAAGG + Intergenic
1128320854 15:66692868-66692890 GCCTTAGACACTGCCTTCACAGG - Intergenic
1130022730 15:80244656-80244678 GCCCCAGACACTGCCCTCTGTGG + Intergenic
1131150787 15:90046130-90046152 GCCCAGGCCACTGACATCTCAGG - Intronic
1132279282 15:100598948-100598970 GACCTTGACACTGACATCACTGG + Intronic
1134213027 16:12294173-12294195 GCCATAGACGCAGACATCTGAGG - Intronic
1135192758 16:20368208-20368230 GTCGTAGACACTGACATCTCTGG + Intronic
1148718445 17:49732675-49732697 GGCCTACACACTGACTTTTCTGG + Exonic
1149773853 17:59342077-59342099 ACTCTAGACTCTGACATCTGTGG - Intronic
1155580141 18:27295539-27295561 GCCATAGACAGTGATTTCTCTGG - Intergenic
1163012657 19:14434970-14434992 GCCCAAGGCATTGAAATCTCCGG + Intronic
1164884385 19:31765198-31765220 GCCCTAGCCTCTGAATTCTCAGG + Intergenic
1166121164 19:40687679-40687701 GCCCAAGATACTGACGTCACAGG + Intronic
1166212560 19:41316485-41316507 GCCCTGGACAGTGACACCTCCGG + Exonic
925712428 2:6754380-6754402 GCCCCAGACTTTGTCATCTCAGG - Intergenic
927118667 2:19930796-19930818 TCCCTAGTCACTGAGATCACTGG + Intronic
931966727 2:67543669-67543691 GAACTGGTCACTGACATCTCTGG + Intergenic
933014671 2:77110095-77110117 TCCTTAGACACAGACATCACAGG + Intronic
938865933 2:135420180-135420202 GCCCCAGATACTGGCAACTCTGG - Intronic
942185391 2:173420514-173420536 GCCCTAGTCGCTGACATCCCAGG + Intergenic
946863109 2:224018875-224018897 GCCCAAGCCACCAACATCTCCGG + Intronic
947702477 2:232246064-232246086 GCCACAGACACTGAAACCTCAGG - Intronic
948892150 2:240912730-240912752 GCCCCACACCCTGACATCTGGGG - Intergenic
1172903795 20:38354298-38354320 GCCCTTGACACTGACATCAAAGG - Exonic
1174183178 20:48687681-48687703 GCCCTTGGCACTGTCCTCTCCGG + Intronic
1179036854 21:37765531-37765553 GCCCCAGACACGGAATTCTCTGG + Intronic
1179377110 21:40860250-40860272 GTCCTCCACACAGACATCTCAGG - Intergenic
1181492217 22:23267696-23267718 GCAGCAGACACTGCCATCTCTGG - Intronic
1185023652 22:48395289-48395311 ACCCTGGACACTGTCTTCTCTGG - Intergenic
950525118 3:13518835-13518857 GCCCTAGACTCTGCCAACCCTGG - Intergenic
955506684 3:59639680-59639702 GCCCCAAACCCTGACATCTGGGG - Intergenic
960993508 3:123326505-123326527 GCCCTAGACCCTGAGTTCCCTGG - Intronic
961495106 3:127285612-127285634 TCCCAAGAAACTGACATCTAAGG + Intergenic
961921377 3:130429907-130429929 GCCCTTGACACTGGCTTCTTGGG + Intronic
966374214 3:179279146-179279168 GCCCGAGACACAGAGCTCTCTGG + Intergenic
968655897 4:1778325-1778347 GCCCTGGCCACGGCCATCTCCGG - Intergenic
969054072 4:4390759-4390781 GCCCTGGACACTCACAGCCCTGG - Intronic
969947872 4:10802869-10802891 GACCTAGACTCTGCCATCTGAGG - Intergenic
970083377 4:12316186-12316208 GCCCCAGACACTCACAGCTGAGG - Intergenic
970376833 4:15467271-15467293 ACCCTACATACTGACATTTCTGG - Intergenic
971617782 4:28814562-28814584 TACCTAGAAACAGACATCTCTGG + Intergenic
986092147 5:4520250-4520272 GACCTAAAGACTGACATCACAGG + Intergenic
993635311 5:90335856-90335878 GCCCTAAACACTGCCATGTGAGG + Intergenic
997779681 5:136644150-136644172 GCCCAAGCTACTGACATTTCTGG - Intergenic
999460950 5:151757486-151757508 GGCAGAGCCACTGACATCTCAGG - Intronic
1001736136 5:174003925-174003947 TGCCTAGACACTGTCATCACTGG - Intronic
1004501788 6:16216478-16216500 ACCCTAGACTCTGAAATTTCAGG + Intergenic
1006624414 6:35387109-35387131 GCCCTAGGCTCTGAGCTCTCAGG + Intronic
1007832674 6:44650787-44650809 GCCCTAGATACTGACATGAAAGG - Intergenic
1009783233 6:68297127-68297149 ACCATAGCCACTGCCATCTCAGG - Intergenic
1011236063 6:85218494-85218516 CCCATAGCCACTGACATCCCAGG - Intergenic
1018099805 6:160427344-160427366 GCCCCAGTCACTGAGTTCTCAGG - Intronic
1018151713 6:160945812-160945834 CCTCTGGACACTGACATCTGGGG + Intergenic
1020450905 7:8319602-8319624 GCCCTAGCCTCTGAATTCTCAGG - Intergenic
1022226552 7:28369432-28369454 GAGCTGGACACTGACAGCTCAGG - Intronic
1023284894 7:38608725-38608747 CCCCCAGACACTGTCATCTGTGG + Intronic
1024872794 7:53985071-53985093 GTCCCAGACACAGAGATCTCCGG - Intergenic
1028366451 7:90038015-90038037 GCCCTAGATACTGCCCTCTGGGG + Intergenic
1028445427 7:90916516-90916538 GCCCTGGACAGTGGCATCTCTGG - Intronic
1029576931 7:101409746-101409768 ACCCTAGCCTCTGAAATCTCAGG - Intronic
1030891909 7:115008708-115008730 GGACCAGACACAGACATCTCTGG - Intronic
1032510567 7:132468994-132469016 GCCCTTGGTACTAACATCTCAGG - Intronic
1039431483 8:37528578-37528600 GCCCAAGACACTGGCCTCACAGG - Intergenic
1040855766 8:51946703-51946725 GCCCTGGACACCATCATCTCTGG - Intergenic
1046864416 8:119129977-119129999 GCACTGGATACTGACATCGCGGG - Intergenic
1049226272 8:141451967-141451989 CCCCTAAATACTGACACCTCTGG - Intergenic
1051852909 9:21529457-21529479 GCCATAGATAGTGACTTCTCTGG - Intergenic
1053144855 9:35705486-35705508 GCCCTAGACACTGACACATCAGG + Intronic
1056124742 9:83524050-83524072 GCACTAGCCACTGCCATGTCAGG - Intronic
1058576501 9:106408944-106408966 CCCTTAGACACTGACCTCTATGG - Intergenic
1059786498 9:117591879-117591901 GCCCTAGAAACTGTACTCTCAGG - Intergenic
1060638411 9:125218485-125218507 GCCCTGGGCACTGCCATCCCTGG - Intronic
1187284204 X:17887159-17887181 GCTCTGGACAATGACAGCTCTGG - Intergenic
1189068093 X:37833237-37833259 GACCTTGACATTGACATCTTGGG + Intronic
1190328036 X:49218719-49218741 GCCCCAAACACTGTCATCTGGGG + Exonic
1190404741 X:50075580-50075602 GCACTAAACACTGCCATCTGTGG - Intronic
1190731071 X:53225716-53225738 GCTCTAGACACTGACACCTCTGG + Intergenic
1192879955 X:75273461-75273483 GCCCTAGACACTCTTACCTCAGG + Intergenic
1195799297 X:108688837-108688859 GGCCCAGACAATGAGATCTCAGG - Intronic
1198834062 X:140783024-140783046 GTCATAGACACTGAAATCTCTGG - Exonic