ID: 904037112

View in Genome Browser
Species Human (GRCh38)
Location 1:27564893-27564915
Sequence TCTAGGGCCCCTCGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904037111_904037112 -8 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037104_904037112 29 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037107_904037112 17 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904037112 Original CRISPR TCTAGGGCCCCTCGTTTTAC AGG Intronic