ID: 904037112

View in Genome Browser
Species Human (GRCh38)
Location 1:27564893-27564915
Sequence TCTAGGGCCCCTCGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904037107_904037112 17 Left 904037107 1:27564853-27564875 CCTGGTGCTTGGAAGGACTAGAG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037104_904037112 29 Left 904037104 1:27564841-27564863 CCAGCAGCAGCACCTGGTGCTTG 0: 1
1: 0
2: 3
3: 46
4: 398
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45
904037111_904037112 -8 Left 904037111 1:27564878-27564900 CCTGAGATGTCAGTGTCTAGGGC 0: 1
1: 0
2: 3
3: 10
4: 96
Right 904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904037112 Original CRISPR TCTAGGGCCCCTCGTTTTAC AGG Intronic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904705490 1:32387181-32387203 TCTAGATCACCTCATTTTACAGG - Intronic
906621087 1:47280085-47280107 TCTAGGCCCTCTTGTTTTACAGG - Intronic
910241598 1:85092608-85092630 TCTAGGGACCTTGGTTTGACAGG - Intronic
916160815 1:161911888-161911910 TCTAGCCCCCATCATTTTACAGG + Intronic
916479535 1:165202461-165202483 TTTGGGGCCCCTTGTTTTAGAGG - Exonic
1066531154 10:36340848-36340870 TCTCTGGCCCCTCGTTTCCCAGG - Intergenic
1069703400 10:70441892-70441914 TCTAGGGCTCCTGGTTTGCCCGG + Intronic
1075119828 10:119656566-119656588 TCCAGAGCCCCTTGTTTTGCAGG + Intronic
1076289361 10:129332508-129332530 TCTGGGGCTCCTGGTTGTACTGG - Intergenic
1081968497 11:47183564-47183586 TGCAGGGCCCCTCGTATTTCTGG - Intronic
1089428999 11:118405182-118405204 TCTAGGTCCTCTCATTTGACAGG + Intronic
1091131315 11:133149410-133149432 CCTGGGGCCTCTCCTTTTACTGG - Intronic
1114214125 14:20642947-20642969 ATTAAGGCCCATCGTTTTACTGG - Intergenic
1115058252 14:29157369-29157391 TCTTGCAACCCTCGTTTTACAGG + Intergenic
1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG + Intronic
1122329884 14:100904879-100904901 TCTCGGGCCCCTCGGCTTCCTGG - Intergenic
1132522889 16:399545-399567 TCCAGGGCCCCTCCCTTTGCTGG - Intronic
1140138444 16:72229905-72229927 TCTAGGGCCCTACTTTGTACTGG - Intergenic
1148714636 17:49707469-49707491 TCTAAGGGCCTGCGTTTTACAGG - Intronic
1165668487 19:37655053-37655075 TCTAGGTCCCAGCGTTTTGCAGG + Intronic
1168492418 19:56821908-56821930 TGTAGGGCCACTGGTTTTATGGG - Intronic
925180741 2:1815493-1815515 TCTAGGGCCCGTGGTTTCCCAGG - Intronic
944518217 2:200533859-200533881 TCTAGGGCCACTCCTTACACTGG + Intronic
945320316 2:208414052-208414074 ACTAGGGCCCACTGTTTTACTGG + Intronic
948400601 2:237682174-237682196 TCTAGAGCCCCTTGTTTTGCGGG + Intronic
1181456093 22:23061014-23061036 TCCACAGCCCCTCCTTTTACTGG - Intronic
1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG + Intergenic
1182767185 22:32765939-32765961 TGGAGGGCCCCTGGGTTTACAGG - Intronic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1184602764 22:45553190-45553212 TCTAGGCCCCCTCCTTCTCCTGG - Intronic
960601343 3:119462048-119462070 ACTAGGGCCCCTCCTTCCACCGG + Exonic
961397762 3:126608981-126609003 TCTAGGGCAGCAGGTTTTACTGG + Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
978232691 4:106419632-106419654 TCTAGGGCCCCTTCTTATAAGGG - Intergenic
994875336 5:105414104-105414126 TCTAGGGCCCCTCCCATTGCTGG + Intergenic
996345484 5:122483943-122483965 TCTAGGGCCCCTTGTTAAAAAGG - Intergenic
1001929269 5:175661202-175661224 TCTAGGACCCCACAGTTTACAGG + Intronic
1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG + Intronic
1019588468 7:1817035-1817057 TCAAGGGCCCCTTGTTTAATTGG - Intronic
1026262295 7:68765700-68765722 CCTAGTGCCCCTCATTTGACAGG + Intergenic
1029007721 7:97228069-97228091 TCTCAGGCCCCTCATTTTAAGGG + Intergenic
1032362704 7:131271174-131271196 TGTAGGCCCCCTCCTTTTCCTGG - Intronic
1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG + Intergenic
1046234055 8:111398185-111398207 ATTAGGGCCCACCGTTTTACTGG + Intergenic
1056504058 9:87239990-87240012 TATTGGGACCCTTGTTTTACAGG - Intergenic
1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG + Intronic