ID: 904042670

View in Genome Browser
Species Human (GRCh38)
Location 1:27593441-27593463
Sequence CTGGTGTCCATGGGCAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 257}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904042650_904042670 25 Left 904042650 1:27593393-27593415 CCACTGCTGCCGCCACCACTACC 0: 1
1: 3
2: 21
3: 198
4: 1032
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042656_904042670 10 Left 904042656 1:27593408-27593430 CCACTACCCCCAGGCAGGCTGGG 0: 1
1: 0
2: 2
3: 48
4: 500
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042661_904042670 2 Left 904042661 1:27593416-27593438 CCCAGGCAGGCTGGGACCCAGGT 0: 1
1: 0
2: 1
3: 41
4: 391
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042662_904042670 1 Left 904042662 1:27593417-27593439 CCAGGCAGGCTGGGACCCAGGTC 0: 1
1: 0
2: 3
3: 43
4: 393
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042658_904042670 4 Left 904042658 1:27593414-27593436 CCCCCAGGCAGGCTGGGACCCAG 0: 1
1: 0
2: 5
3: 43
4: 432
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042659_904042670 3 Left 904042659 1:27593415-27593437 CCCCAGGCAGGCTGGGACCCAGG 0: 1
1: 0
2: 8
3: 69
4: 534
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042649_904042670 26 Left 904042649 1:27593392-27593414 CCCACTGCTGCCGCCACCACTAC 0: 1
1: 0
2: 8
3: 43
4: 335
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042652_904042670 16 Left 904042652 1:27593402-27593424 CCGCCACCACTACCCCCAGGCAG 0: 1
1: 0
2: 5
3: 84
4: 855
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257
904042654_904042670 13 Left 904042654 1:27593405-27593427 CCACCACTACCCCCAGGCAGGCT 0: 1
1: 0
2: 0
3: 43
4: 399
Right 904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG 0: 1
1: 0
2: 1
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904042670 Original CRISPR CTGGTGTCCATGGGCAAAGA TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901475345 1:9485581-9485603 CTGGGGTTCATGGGAAAAGTTGG - Intergenic
901824400 1:11851266-11851288 CTGGGGCCCCTGGGCAATGAAGG + Intergenic
903302641 1:22390286-22390308 CTGGTGTACCTGGGCACAGGTGG - Intergenic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
904276133 1:29385509-29385531 CTGGGGTCCCTGGGCCAAGAGGG - Intergenic
905742886 1:40387960-40387982 CTGCTGGCCCTGGGCAATGAGGG + Intronic
909904572 1:81178860-81178882 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
910240873 1:85085014-85085036 CTGGTGTCCTTGTGATAAGATGG + Intronic
910609759 1:89128294-89128316 CTGTTGGCCCTGGGCAATGAGGG - Intronic
912476288 1:109937790-109937812 CTGGTGACCATCATCAAAGAGGG + Intergenic
914243799 1:145871489-145871511 ACGATGTCCATTGGCAAAGAGGG - Intronic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
916910117 1:169337330-169337352 CTGCTGGCCCTGGGCAATGAGGG - Intronic
917389397 1:174517957-174517979 CTGGTGTCAATGGATACAGAAGG + Intronic
917513694 1:175689315-175689337 CTGGTATCCCTGTGGAAAGACGG - Intronic
917610403 1:176683641-176683663 CTGGTGACCAAGGACAAAAATGG - Intronic
917737741 1:177936072-177936094 CCTGTGTCCATGGGGAGAGAGGG - Intronic
920003624 1:202816317-202816339 CTGGTCTCCATGGTTGAAGATGG + Intergenic
921703990 1:218298981-218299003 CAGGTGTCTAAGGGCATAGACGG - Intronic
921897092 1:220412539-220412561 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
921946700 1:220890879-220890901 CAAGTGTCCAGGGGCACAGAAGG + Intergenic
922493265 1:226035866-226035888 CTGCTGCCCACAGGCAAAGAGGG - Intergenic
923747818 1:236718992-236719014 CTGGTGTCCATTGGCGCTGAAGG + Exonic
1062975620 10:1680369-1680391 AGGGTGTTGATGGGCAAAGATGG - Intronic
1063300399 10:4845168-4845190 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1065299352 10:24307290-24307312 CTTGTGTTCATGAGCAGAGAAGG + Intronic
1065966168 10:30772333-30772355 CTGGTCTACAGGGGCCAAGATGG + Intergenic
1067037907 10:42933059-42933081 ATGGTGACCAGGAGCAAAGACGG - Intergenic
1067066793 10:43108568-43108590 CTGGTGTCCCTTGGCCAAGAGGG + Intronic
1068874317 10:61980320-61980342 TTTGTAACCATGGGCAAAGAAGG - Intronic
1068902108 10:62280485-62280507 CTGCTGGCCCCGGGCAAAGAGGG + Intergenic
1069694639 10:70377578-70377600 CTGGGGTCTGGGGGCAAAGAAGG - Intronic
1071728137 10:88220034-88220056 CTGGTGTCCATCTGCAGTGAAGG + Intergenic
1074424358 10:113338151-113338173 TTGTACTCCATGGGCAAAGAGGG + Intergenic
1075090433 10:119441313-119441335 CTGGTGTCCATAGGCAGGGAAGG + Intronic
1076090958 10:127685021-127685043 CTGGTGTCCATGTGAAATGGGGG - Intergenic
1076455277 10:130588458-130588480 CTGGTGTCAAAGGACATAGAAGG - Intergenic
1077478919 11:2803818-2803840 CTGGGGTCCATGGGCATAGCAGG - Intronic
1079557242 11:21774549-21774571 ATGTTGACCATGGCCAAAGAGGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1079968411 11:27006613-27006635 CTCCTGTCCATCTGCAAAGATGG - Intergenic
1083278703 11:61612076-61612098 CTGGTGTCCTTCTGAAAAGAAGG + Intergenic
1083822332 11:65180568-65180590 CAGGTGTCCAGGGACAGAGAAGG - Exonic
1083938751 11:65883832-65883854 CTGGTGTCCGTGTACAAGGATGG - Intronic
1084183459 11:67457905-67457927 AAGGTGTGCATGGGCAGAGATGG + Intronic
1088847365 11:113679919-113679941 CTGGTCTCCATGGGTATTGATGG - Intergenic
1090307690 11:125704955-125704977 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1092366548 12:7881390-7881412 CTGGTGGCCCCGGGCAATGAGGG + Intronic
1096493852 12:52027732-52027754 CTGGTGGCCCTGGGCACAGGGGG + Intronic
1096559519 12:52425503-52425525 CTGGTGTCCATACAGAAAGAAGG + Intronic
1096603260 12:52745750-52745772 GTGGTGTCCATGGGCCCAGAAGG - Intergenic
1101719900 12:107342211-107342233 CTGGCATCCATCTGCAAAGAAGG - Intronic
1101886320 12:108666370-108666392 CTTGTGTCCACTGGTAAAGAGGG + Intronic
1102506445 12:113387422-113387444 CTGGTGTCAATGTGTAAAGATGG + Intronic
1102551774 12:113696576-113696598 CTGCTGGCTATGGCCAAAGATGG + Intergenic
1103322686 12:120101142-120101164 CTGGTGGCCATGGGAAACGTCGG - Intronic
1104653676 12:130557167-130557189 CAGGTGAAGATGGGCAAAGAAGG + Intronic
1106636433 13:31533594-31533616 CGTGTGTCCATGCGCACAGAGGG - Intergenic
1108181266 13:47842055-47842077 CTCCTGTGCATGGGCCAAGAGGG + Intergenic
1108858967 13:54829753-54829775 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1110046820 13:70842131-70842153 CTGCTGCCCGTGGGCCAAGAAGG + Intergenic
1111591016 13:90348706-90348728 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1114593527 14:23891864-23891886 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1114614451 14:24060850-24060872 CTGGGGTCCCTGGGCTAGGAAGG - Intronic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1116416198 14:44680625-44680647 CAGGTGTCTATGGGCCGAGAAGG + Intergenic
1117262534 14:54050956-54050978 CCGGGTTCCCTGGGCAAAGAAGG - Intergenic
1118927742 14:70208345-70208367 CTAGTGTCCAAGGGCAGTGATGG - Intergenic
1120384860 14:83831925-83831947 CTAGGGTCCATAGGCCAAGATGG + Intergenic
1121820844 14:96964632-96964654 CTGGTGTCCATGGGAACAAGGGG - Intergenic
1121950470 14:98167070-98167092 TTGCTGACCATGAGCAAAGAGGG + Intergenic
1122865675 14:104602991-104603013 CTGGTGTCCCTGTAAAAAGAGGG + Intronic
1124238305 15:28008546-28008568 CTGGTTTCCATTGGCTAGGACGG - Intronic
1124637928 15:31376766-31376788 CCGGTGTCCATGAGGGAAGAGGG + Exonic
1126185908 15:45830080-45830102 GTGGTGTCCATGGACTAAGAGGG - Intergenic
1126639665 15:50812076-50812098 CTGCAGTCCCTGGGCAATGAGGG + Intergenic
1127835672 15:62789084-62789106 CTGATGTTCATGGGCCAGGAGGG - Intronic
1127898983 15:63327279-63327301 CCGGGGGCCATGGGCTAAGATGG - Intronic
1129673328 15:77619078-77619100 CTAGTGACCTTGAGCAAAGAGGG + Intronic
1131831845 15:96359654-96359676 CTGGGGTCAAATGGCAAAGAGGG + Intergenic
1132423772 15:101696655-101696677 CTGGGGTCCTTTGGCCAAGAGGG - Intronic
1132583925 16:697657-697679 AGGGTGTCCATGGGCAATGAAGG - Intronic
1132743425 16:1427195-1427217 CTGGGGTCCGTGGGCACAGCAGG + Intergenic
1133161110 16:3912425-3912447 GTGATGTCCATGGGCAACGGGGG + Intergenic
1134006171 16:10819918-10819940 CTGGTCTCCATGGGCGGAGGTGG + Intergenic
1137861475 16:51850919-51850941 CTGTTGTGCATAGGCACAGAGGG - Intergenic
1139649065 16:68353013-68353035 CTGGTTTTCATGGCCAAAGAGGG + Intronic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1140949301 16:79800805-79800827 TTGATGCCCATGGGCAAAGGTGG + Intergenic
1142281490 16:89150508-89150530 CTGGTGTCCCTGGGCAGGGGCGG - Intronic
1142619411 17:1155155-1155177 CTGGAGCAGATGGGCAAAGAAGG + Intronic
1146320620 17:31843724-31843746 CTTGTGTGCCTGGGCTAAGACGG - Intergenic
1146565900 17:33912557-33912579 CTGCTGTCAAGGGGAAAAGATGG - Intronic
1146809262 17:35890419-35890441 CTTGTGAACAGGGGCAAAGAAGG - Intergenic
1146951553 17:36910156-36910178 CAGGGGGGCATGGGCAAAGAAGG + Intergenic
1148486880 17:47996358-47996380 CTGTCATCCATGGCCAAAGATGG + Intergenic
1150385081 17:64752655-64752677 AAGGTGTCTAAGGGCAAAGATGG + Intergenic
1150771503 17:68045376-68045398 AAGGTGTCTAAGGGCAAAGATGG - Intronic
1151817519 17:76478649-76478671 CTGGGATCCCTGGGCAAAGAGGG - Intronic
1152316534 17:79583848-79583870 GTGGTGGCCATGGGAAAGGAGGG + Intergenic
1152738908 17:82010702-82010724 CTGGTGTCCATGGCCCAGCATGG + Intronic
1152761035 17:82107183-82107205 CTGGTCTCCAGGGGAGAAGAGGG - Intronic
1155565618 18:27131220-27131242 CTGGGGTCCCTGGGCCAGGAGGG - Intronic
1156289224 18:35730996-35731018 CTCCTGTCCATCTGCAAAGACGG + Intergenic
1156791998 18:40986924-40986946 CTGGTTACCAAGGGCAGAGAAGG + Intergenic
1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG + Intergenic
1159179420 18:64882299-64882321 TTGGTTACCAGGGGCAAAGAGGG + Intergenic
1159483428 18:69021727-69021749 CTGGAGTAGATGGGCAAGGACGG + Intronic
1160559409 18:79746818-79746840 CTGGTCTCAATGGGCAACAAAGG - Intronic
1162632710 19:11941548-11941570 CTGCTGGCCCTGGGCAATGAGGG - Intronic
1162829649 19:13276335-13276357 CTGGTCCCCATGGGCGATGACGG - Intronic
1164076318 19:21822177-21822199 CTGGTGTCCATGGCAGAGGAGGG - Intronic
1164817170 19:31213395-31213417 GTGGTGTCCAGGGGTAAGGAGGG + Intergenic
1164992430 19:32693922-32693944 CTGCTGGACAGGGGCAAAGAAGG + Intronic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1167144453 19:47673434-47673456 CTTGAGTCCATGGGGATAGATGG - Intronic
1168245309 19:55110139-55110161 CTGGGGTCCAAGGGAAAAGGAGG + Intronic
925015225 2:518918-518940 CTGGGGTCAGTGGGCAAAGAAGG - Intergenic
925216743 2:2103049-2103071 ATGGTGTCCATGGCAACAGAAGG - Intronic
925858077 2:8149740-8149762 GTGGTGTCCTGGGGCAAAGTGGG - Intergenic
926321721 2:11753077-11753099 CTCCTGTCCCTGGGCAAGGAGGG + Intronic
926573394 2:14554162-14554184 CTGTTGTCTATGAGCCAAGACGG + Intergenic
927010154 2:18895785-18895807 CTGGTGGCCCTGGGGAAAGGAGG - Intergenic
928121360 2:28586097-28586119 CACTTGTCCATGGGCAAACATGG + Intronic
929871210 2:45760848-45760870 CTGGTGTCCAGAGGCATAAAGGG + Intronic
929912867 2:46106649-46106671 CAGGTGTGCATGTGCACAGAGGG - Intronic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
930836804 2:55802761-55802783 CTGGTGGCAATAGGAAAAGACGG + Intergenic
931599646 2:63990527-63990549 CTGGTGTGCATGTGTGAAGAAGG - Intronic
933014977 2:77113682-77113704 CTGGTATCCATGTGTGAAGAAGG + Intronic
933726341 2:85429717-85429739 ATGGTCTCCCTGGGCAGAGAGGG - Intronic
937754761 2:125523694-125523716 CTTCTGTCCATGCCCAAAGACGG + Intergenic
938726038 2:134109598-134109620 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
939777364 2:146403944-146403966 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
940995229 2:160142467-160142489 TTGGTGCACATGGGCAATGAGGG + Intronic
941263536 2:163328723-163328745 CTGGTTTCCATTTCCAAAGAAGG - Intergenic
945564350 2:211378121-211378143 GTTGTGTCAATGGGCAAAAAAGG + Exonic
949042105 2:241854223-241854245 CGGGAGGCCATGGGCACAGAGGG - Intronic
1169582734 20:7042826-7042848 GTAGTATCCATGGACAAAGAAGG + Intergenic
1171449288 20:25224733-25224755 CCAGTGTCCATGGGCACAAATGG - Intronic
1171458214 20:25283607-25283629 CAGCTCTCCAGGGGCAAAGAGGG - Intronic
1173478987 20:43384393-43384415 CTGGTGAGCATGGGGACAGACGG - Intergenic
1174177516 20:48654317-48654339 TAGGTGTTCATAGGCAAAGACGG - Intronic
1175236580 20:57517197-57517219 GTGGTGTGAATGAGCAAAGAAGG + Intronic
1175254144 20:57628902-57628924 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1175724870 20:61310833-61310855 CTGGTGTCCCTGTGGGAAGAGGG - Intronic
1175972132 20:62692034-62692056 CTGGTGGCCGTGGGCAGAGCTGG - Intergenic
1176069767 20:63219994-63220016 CTGGTGTCCATCGAGACAGATGG - Intergenic
1176690988 21:9908381-9908403 CTGGTGGGCATGTGTAAAGAGGG - Intergenic
1177654333 21:23998287-23998309 CTTGTGTCCATGGACACAAAGGG + Intergenic
1177693891 21:24546577-24546599 CTGTTGTCTATAGGCCAAGAAGG + Intergenic
1179907570 21:44431997-44432019 CTGTTGTGAATGGGCCAAGAGGG - Intronic
1181111241 22:20604234-20604256 ATGCTGACCATGGGCAAAGGGGG + Intergenic
1181634207 22:24166900-24166922 CTCGTGTCCATGGGCTCAGTGGG - Exonic
1182697933 22:32208822-32208844 CTGGTCTCCAAGGGAGAAGAGGG + Intergenic
1183066397 22:35366430-35366452 CTGCTGACCATGGGCAATGTGGG + Intergenic
1184364063 22:44038130-44038152 ATGGTGCCAATGGGCAAAGAGGG - Intronic
953961040 3:47265791-47265813 CTGGTCCCCAAGGGCAATGATGG + Exonic
954430799 3:50470026-50470048 GTGGAGGCCATGGGCACAGAGGG - Intronic
954684010 3:52360942-52360964 CAGGGGTCCCTGGGCAAAGCTGG + Intronic
955142744 3:56285676-56285698 CCAGTGTCCATGGGCAAACCTGG + Intronic
955186322 3:56718661-56718683 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
955370853 3:58350523-58350545 ATTGTGTCCAAGGGCATAGAAGG + Intronic
956250649 3:67230726-67230748 GTGGTGTCCCTGGGGTAAGATGG + Intergenic
957286076 3:78219103-78219125 CTGGTGTCCTTGTAAAAAGAGGG - Intergenic
961374477 3:126454712-126454734 CTGCTGTCTAAGGGCAGAGAAGG - Intronic
961460455 3:127046785-127046807 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
962473999 3:135739937-135739959 CTGGTTTCCATGGTAACAGAAGG + Intergenic
963002362 3:140694322-140694344 CTAGGGACCATGGGCACAGAAGG - Intronic
963258370 3:143169111-143169133 GTTGTGTCCATGGGCAGAGAAGG + Intergenic
964470514 3:157048799-157048821 CTGGTATTCATGGACAAAGATGG + Intergenic
969227555 4:5808626-5808648 CTGGTGGCCATGCGCACACAGGG - Intronic
969293059 4:6252872-6252894 TTGGTGTGCATGGCCAAGGAGGG - Intergenic
969500582 4:7550252-7550274 CTTGTCTCCCTGGGCAAAGATGG + Intronic
970998417 4:22294503-22294525 CCTGTGGCCATGGGCAAAGAGGG - Intergenic
971739413 4:30501499-30501521 CTAATGTCCCTGGGCAAAGTGGG + Intergenic
971899979 4:32646765-32646787 CTGGTGTCCATGTGTGAAGAAGG - Intergenic
974564603 4:63566902-63566924 GTGGTGTCCTTGGGAAAGGATGG - Intergenic
978339850 4:107710776-107710798 CTCCTGTCCATCTGCAAAGATGG + Intronic
979129918 4:117030991-117031013 CTGATGTCCATCAGCAAATATGG + Intergenic
979869140 4:125794695-125794717 CTGGTGTCTATGGGCAAAATTGG + Intergenic
980857653 4:138459173-138459195 CTGATATGTATGGGCAAAGAAGG - Intergenic
981007499 4:139890741-139890763 CTGTTCTGCAAGGGCAAAGAAGG + Exonic
981265137 4:142773868-142773890 CTGTTATCCATGGGAACAGATGG - Intronic
985841092 5:2306534-2306556 CTGGGGTGGCTGGGCAAAGAAGG - Intergenic
986033601 5:3916816-3916838 CTGCAGACCATGGGCAAAGTAGG + Intergenic
986115523 5:4770177-4770199 CTGGCCTCCATGGGCATAGAAGG - Intergenic
986252348 5:6072008-6072030 CCTGTGTCCATGGGCACAGGCGG - Intergenic
986626159 5:9725426-9725448 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
987062633 5:14257187-14257209 CTGGTGTCCAGAGGGCAAGAGGG - Intronic
987916859 5:24226602-24226624 GAGGTGTCCATGGGTAAAAATGG + Intergenic
990528439 5:56651197-56651219 CTGATGTCTGAGGGCAAAGATGG - Intergenic
993328586 5:86569775-86569797 CTGCTGGCCCTGGGCAAAGAGGG - Intergenic
994393941 5:99213308-99213330 ATAATGTCCATGGGAAAAGAGGG - Intergenic
995379649 5:111517878-111517900 CTGGTGTCCAGGGGGAAACAGGG + Intergenic
996346434 5:122493282-122493304 CTGGTATTCATGGGCTAACAAGG - Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
999080080 5:148835063-148835085 CTGGGGTCACTGGGCAAAGTAGG + Intergenic
999353267 5:150898418-150898440 CTGGTCTCAATGGGTAAGGATGG - Exonic
999356802 5:150942540-150942562 CTGGTCTCAATGGGTAAGGATGG - Intergenic
1000066028 5:157693947-157693969 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1000881850 5:166706908-166706930 TTGGTGACCAATGGCAAAGATGG - Intergenic
1001539466 5:172527236-172527258 GTGGTTTCCATGGGAAAAAATGG + Intergenic
1001852895 5:174984936-174984958 GTGGTCTGCATGGGAAAAGAAGG + Intergenic
1002875072 6:1203123-1203145 GCTGTGTCCATGGGCCAAGAAGG - Intergenic
1003375698 6:5575109-5575131 CTGGTGTCCTTAGCCCAAGAAGG - Intronic
1005252838 6:23967106-23967128 CTGGTGTCCTTGGAAGAAGAAGG - Intergenic
1005386357 6:25289029-25289051 CTAATGACCATGGGCTAAGAAGG + Intronic
1008009986 6:46456230-46456252 ATGGTATCAATGAGCAAAGAAGG + Intronic
1009061359 6:58400960-58400982 CTGGTGTGCATGTGTGAAGAAGG - Intergenic
1009249031 6:61275512-61275534 CTGGCGTCCATGTGTGAAGAAGG - Intergenic
1009407109 6:63326705-63326727 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1009714398 6:67369898-67369920 CTTGTTTCCTTGGGGAAAGATGG - Intergenic
1010492775 6:76494720-76494742 CTGGCGTCCATGTGTGAAGAAGG + Intergenic
1012440976 6:99262061-99262083 CTGCTGGACAGGGGCAAAGAAGG + Intergenic
1013410785 6:109881394-109881416 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1013535171 6:111057247-111057269 CTGGTTTCCATGGGCAGACGTGG + Intergenic
1015229341 6:130896427-130896449 CCGGTGGCCATGGGCAGTGATGG - Intronic
1016184596 6:141183253-141183275 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
1016337570 6:143024128-143024150 CAGGTGTCCATGGCGAAACAAGG + Intergenic
1018446596 6:163864258-163864280 CTCGTGCCCATGAGGAAAGAAGG - Intergenic
1018891941 6:167989047-167989069 CCTGTGTCCCTGGCCAAAGATGG - Intergenic
1019007839 6:168817229-168817251 CTGGTTTGCAAGGGCAAAGAAGG - Intergenic
1019073355 6:169367689-169367711 CCTGTGTCCATGTGCACAGAGGG + Intergenic
1019139982 6:169936962-169936984 CTGGTGTCCTTAGGGGAAGAGGG - Intergenic
1019450619 7:1095861-1095883 CTGGGGGCCATGGGCATCGAGGG + Intronic
1019645676 7:2127555-2127577 CTGGTGTAGGTGGGCAATGAGGG + Intronic
1020279682 7:6643936-6643958 CTCGTGTCCTTGGGTAAGGACGG + Exonic
1022750429 7:33219083-33219105 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1023018159 7:35986150-35986172 CTGGCTTCCATGGCCACAGATGG + Intergenic
1024353586 7:48392784-48392806 CTGGGGTGCATGGGCCAGGAAGG + Intronic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1027288051 7:76671224-76671246 CAGCTGTGCATTGGCAAAGAAGG - Intergenic
1027665885 7:81042817-81042839 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1028576760 7:92360716-92360738 TTGGTGTGGATGTGCAAAGATGG - Intronic
1029028871 7:97448112-97448134 CTGGTGTCCACTGGGAAATATGG - Intergenic
1029256306 7:99272003-99272025 CTGGTGTCCATATAAAAAGAGGG - Intergenic
1034652112 7:152699839-152699861 CTGGCTTCTGTGGGCAAAGAGGG + Intergenic
1035426717 7:158783022-158783044 CACGTGTCCATGGGGAAGGAGGG - Intronic
1037983518 8:23272225-23272247 CTGCTGGCCCTGGGCAATGAGGG + Intronic
1038401392 8:27287353-27287375 CTCCTGACCATGGGCACAGAAGG + Exonic
1039284857 8:36028935-36028957 CTGCTGGCCCTGGGCAATGAGGG + Intergenic
1039333329 8:36562817-36562839 CTTGGCTTCATGGGCAAAGATGG - Intergenic
1040778842 8:51081649-51081671 CTGGTGACCATGCCCAAATAAGG + Intergenic
1040807392 8:51409081-51409103 CGGGTGTTCATGGGGAAACAAGG + Exonic
1041034666 8:53776150-53776172 CTGCTGGCCCTGGGCAATGACGG - Intronic
1041566147 8:59281163-59281185 CTGGTTTCCAGGGGCAAGGAGGG + Intergenic
1046097978 8:109582822-109582844 CTGGTGTCCTTATACAAAGAAGG + Intronic
1048237031 8:132701017-132701039 GTGGTATCCATGGGGGAAGATGG + Intronic
1048386592 8:133918030-133918052 CTGGTTTCCATTGGGAAACAGGG - Intergenic
1049680346 8:143915367-143915389 CTGGTGTCCCTGGGCCCAAAGGG + Exonic
1049734781 8:144199214-144199236 CAGATGCCCATGGGCAAAGCTGG - Intronic
1051666619 9:19472287-19472309 CTGGGGTCCATTGAGAAAGAGGG - Intergenic
1052687335 9:31772538-31772560 TTGGTGTCCATGTGTGAAGAAGG - Intergenic
1053268891 9:36736422-36736444 GTGGTGTACCTGAGCAAAGAGGG - Intergenic
1053627728 9:39892911-39892933 CTGGTGGGCATGCGTAAAGAGGG - Intergenic
1053778268 9:41573119-41573141 CTGGTGGGCATGCGTAAAGAGGG + Intergenic
1054216160 9:62357798-62357820 CTGGTGGGCATGCGTAAAGAGGG + Intergenic
1054671321 9:67797552-67797574 CTGGTGGGCATGCGTAAAGAGGG - Intergenic
1056069230 9:82968595-82968617 CTGGTGTCCATACATAAAGAGGG - Intergenic
1056080972 9:83093549-83093571 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1057385982 9:94606404-94606426 CTGGGGTCCATGGTCCCAGATGG - Intronic
1057495126 9:95554487-95554509 CTGGTTACCATGGGCATAGGAGG - Intergenic
1057625420 9:96672073-96672095 GTGGTTTCCAGGGGTAAAGAAGG + Intergenic
1058412275 9:104747403-104747425 GTGTTGACCATGGGGAAAGAAGG - Intergenic
1058786487 9:108393622-108393644 CTGGTGGCCCCGGGCAATGAGGG + Intergenic
1058818740 9:108709666-108709688 CTGATCTTCATGGGCCAAGATGG - Intergenic
1059434575 9:114268234-114268256 CTGGTGTCTAGGGGCACAGGAGG - Intronic
1059434600 9:114268368-114268390 CTGGTGTCTAGGGGCACAGGAGG - Intronic
1060051995 9:120384300-120384322 ATGGGGTCAATGGGAAAAGAGGG + Intergenic
1061169535 9:128944263-128944285 GTGGTGTCCATAGAGAAAGATGG - Intronic
1062583308 9:137237700-137237722 CTGGGGGCCAAGGGCACAGAGGG - Intergenic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1185663755 X:1747820-1747842 CTGGTGTACATGTGCCATGATGG + Intergenic
1185844291 X:3423069-3423091 ATGGTGTCCATGGGGAGAAATGG + Intergenic
1193707257 X:84836856-84836878 CAGGTGTCTATGGGGAAAGGAGG + Intergenic
1193832754 X:86308686-86308708 GTGGTCTCCTTGGGGAAAGATGG - Intronic
1197344839 X:125319315-125319337 CTGCTGGCCCTGGGCAATGAGGG - Intergenic
1198555488 X:137788887-137788909 CTCCTGTGCATGGACAAAGAAGG - Intergenic
1198792224 X:140357893-140357915 TTAGTCTCTATGGGCAAAGAAGG + Intergenic
1201630728 Y:16069713-16069735 CTGGTGTTCATTGGCAATGTGGG - Intergenic