ID: 904043236

View in Genome Browser
Species Human (GRCh38)
Location 1:27596078-27596100
Sequence ATGCCCCTCTGGGAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904043220_904043236 29 Left 904043220 1:27596026-27596048 CCTGGACCCCAGAGAGGTGATGG 0: 1
1: 0
2: 4
3: 44
4: 283
Right 904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG 0: 1
1: 0
2: 2
3: 19
4: 166
904043226_904043236 21 Left 904043226 1:27596034-27596056 CCAGAGAGGTGATGGGGCTGCAG 0: 1
1: 0
2: 2
3: 55
4: 371
Right 904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG 0: 1
1: 0
2: 2
3: 19
4: 166
904043224_904043236 23 Left 904043224 1:27596032-27596054 CCCCAGAGAGGTGATGGGGCTGC 0: 1
1: 1
2: 3
3: 27
4: 317
Right 904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG 0: 1
1: 0
2: 2
3: 19
4: 166
904043219_904043236 30 Left 904043219 1:27596025-27596047 CCCTGGACCCCAGAGAGGTGATG 0: 1
1: 0
2: 5
3: 22
4: 229
Right 904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG 0: 1
1: 0
2: 2
3: 19
4: 166
904043225_904043236 22 Left 904043225 1:27596033-27596055 CCCAGAGAGGTGATGGGGCTGCA 0: 1
1: 0
2: 9
3: 39
4: 308
Right 904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG 0: 1
1: 0
2: 2
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904043236 Original CRISPR ATGCCCCTCTGGGAGAATGA AGG Intronic
903807437 1:26015576-26015598 ATGCCCCAGTGGGAGGATTAAGG + Intergenic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
904702362 1:32365549-32365571 CTGCACCTCTGGGGGAATGAGGG - Intronic
905975119 1:42168771-42168793 CTGCCCATATGGAAGAATGAGGG - Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910758235 1:90712717-90712739 CTGCCACCCAGGGAGAATGAAGG - Intronic
911873555 1:103130106-103130128 AGACACCTGTGGGAGAATGAAGG + Intergenic
913430024 1:118780664-118780686 GTGCCCCTCTGGGGAAATTAAGG - Intergenic
914449745 1:147780553-147780575 AGGCACCTCTGGTAGAAGGAAGG + Intergenic
916127064 1:161581120-161581142 CTGGGCCTCTGGGAGAAAGAGGG - Intergenic
916136984 1:161662924-161662946 CTGGGCCTCTGGGAGAAAGAGGG - Intronic
920036624 1:203069806-203069828 AGGCTCCTCTTGGAGAATGAAGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922680749 1:227593357-227593379 ATGACCCTCTAGTAAAATGAAGG + Intronic
922728492 1:227937706-227937728 ATGCCCCTCTGGAGGCTTGAGGG - Intronic
923098718 1:230795505-230795527 GTGCCTCTGTGGGAGGATGATGG + Intronic
923447637 1:234087420-234087442 GTGCCCCTCTGTAAGTATGAAGG - Intronic
924284202 1:242469254-242469276 ATCCCCATTTGGGAGAATGTAGG - Intronic
1063979369 10:11441354-11441376 ATGGCCCTCTGCGAGAAACAAGG + Intergenic
1064622561 10:17229969-17229991 ATGCGCCTCCGGGAGAAGTAAGG + Exonic
1067848163 10:49739042-49739064 ATGCCACTCAGGGATAATGGTGG + Intronic
1068546796 10:58356091-58356113 ATCCCACTCTGAGAGAATGGAGG - Intronic
1069285560 10:66710459-66710481 ATGCTCCACTGCTAGAATGATGG + Intronic
1074431946 10:113401785-113401807 AGGCCCATCTAGGAGAAGGAGGG - Intergenic
1074722968 10:116279173-116279195 AGGCCCCTCTGCAACAATGAAGG + Intergenic
1076353476 10:129834670-129834692 ATGCCCCTCTTGCAGAACGTAGG + Intergenic
1076695763 10:132246619-132246641 AAGTCCCTCCGGGAGAAGGACGG + Intronic
1077034552 11:488398-488420 CTGCCCCCCGGGGAGAATGAGGG - Intronic
1080183233 11:29448338-29448360 ATGACACTCTGGTAGACTGATGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083049363 11:59763201-59763223 ATGCCTCTCTGAGTTAATGAAGG + Intronic
1083507332 11:63170716-63170738 TTGCACCTCTGGGAGAATTCAGG - Intronic
1085380355 11:76111450-76111472 ATGCCCTAGTGGGAAAATGAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086566482 11:88232180-88232202 TTTCTCCTCTGTGAGAATGAAGG - Intergenic
1091299456 11:134498222-134498244 ATGGACCCCTGGGAAAATGAAGG - Intergenic
1091818247 12:3455465-3455487 ATTCCCCTTAGGGAGAAGGAGGG - Intronic
1092641262 12:10513259-10513281 ATGCTCCTCTGGGAGAATCAAGG + Intronic
1092965283 12:13635353-13635375 ATGCTCCTCTGGGTGAAGAATGG + Intronic
1093787717 12:23212086-23212108 ATGACCCTCTGGGACAATCTGGG + Intergenic
1094024232 12:25945510-25945532 GTGCCCATCTGGAAGGATGAAGG + Intergenic
1094477467 12:30852322-30852344 AAGCTCCTCTGGGAAAACGAGGG + Intergenic
1095788209 12:46134470-46134492 ATGCCCCTGGGAGAGAAAGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1101999007 12:109545106-109545128 TAGCCCCTCTGGGAGACAGAAGG - Intergenic
1103042632 12:117708544-117708566 AGGACCCCCTGGAAGAATGAAGG + Intronic
1104609301 12:130215439-130215461 ATGCCCCTGTGGGAGGAAAAGGG - Intergenic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1114454295 14:22845326-22845348 ATGACCCTCTGGGAGACTCAGGG - Exonic
1118299850 14:64605675-64605697 ATGCCATTCTGGATGAATGAGGG + Intergenic
1119442346 14:74636905-74636927 CTGCGCCTCTGGATGAATGATGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122871673 14:104641590-104641612 AGGCCCCACGGGGTGAATGAAGG + Intergenic
1124460928 15:29891020-29891042 ATGCTGCTCTAGGAGAATGTGGG - Intronic
1125929257 15:43588867-43588889 ATGCACCTCTGGGAGAAGATGGG + Intronic
1125942424 15:43688699-43688721 ATGCACCTCTGGGAGAAGATGGG + Intergenic
1127046588 15:55032446-55032468 CTGCATCTCTGTGAGAATGAGGG - Intergenic
1131516649 15:93082593-93082615 ATGCCCCACATGTAGAATGACGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134642046 16:15837156-15837178 ATTCCCCTCTGTGACAAGGAAGG + Intronic
1138238433 16:55406065-55406087 AAGCCACACTGGGAGAATCAAGG - Intronic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1143449707 17:7028616-7028638 AGGCCCCCGTGGGAGGATGATGG - Exonic
1144253645 17:13444116-13444138 AGGGCCCTCTGGGAGAAAGGAGG + Intergenic
1146679944 17:34799862-34799884 AGGGCCATCAGGGAGAATGAAGG - Intergenic
1150641782 17:66954207-66954229 ATGCCCATCAGGGAGAATGAGGG - Intergenic
1150856423 17:68757522-68757544 GTGTTCCTCTGTGAGAATGAGGG + Intergenic
1152967901 18:133232-133254 ATCTCCATCTGGGAAAATGAGGG - Intergenic
1154125511 18:11689347-11689369 ATGACCCTCTGGGGCAGTGAGGG + Exonic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1160446967 18:78935553-78935575 ATGCACCCCTGGGAGACTGCTGG - Intergenic
1160477426 18:79204974-79204996 CTGAGCCTTTGGGAGAATGAAGG - Intronic
1161737334 19:5999496-5999518 AAGCCACACTGGGATAATGAGGG - Intronic
1163459404 19:17427558-17427580 ATGCACTTATGGGAGAAGGAAGG - Intronic
1166258538 19:41621982-41622004 AAGCACCTGTGGGAGAATGTAGG - Intronic
1167862608 19:52297418-52297440 ATGGCCCTGTGGCAGAAGGACGG - Intronic
1168152379 19:54456027-54456049 CTGCCCCTCTAGGAGGGTGAAGG - Exonic
1168330749 19:55566536-55566558 ATGCCCCTCTGGGCCAAGCAAGG - Intergenic
925331293 2:3060710-3060732 AGGCCCCTATGGGAGAAGGAGGG + Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929540759 2:42818818-42818840 ATGCCCCTTTGGGAGGCTGATGG + Intergenic
929899139 2:45986432-45986454 ATGGGCCTTGGGGAGAATGATGG + Intronic
930058936 2:47272676-47272698 AAGCCTCTCTGGGAGAAGGCAGG + Intergenic
930538243 2:52670972-52670994 AGGCCCCTCTGGTAGGGTGAGGG + Intergenic
931515183 2:63047026-63047048 ACACCCCTGTGGGGGAATGAAGG - Intergenic
933556543 2:83837509-83837531 ATGCCCAGCTGGGGGAATAAAGG - Intergenic
933702848 2:85268195-85268217 ATCACCTTTTGGGAGAATGATGG - Intronic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
937319467 2:120952389-120952411 ATTCCTCTCGGGGAGAATGCTGG - Intronic
938579348 2:132632341-132632363 ATGCCTCTCTGTGACAAGGAAGG - Intronic
938771608 2:134505647-134505669 ATACTCCTCTGGGGGAAGGAAGG + Intronic
942242013 2:173971627-173971649 ATGGGCTTCTGAGAGAATGATGG - Intergenic
942768184 2:179482432-179482454 CTGCCCCTCTGGGCCCATGACGG - Intronic
943623719 2:190177571-190177593 TTGCACCTCTGGGAGAAGCAAGG - Intronic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945914355 2:215687023-215687045 AATGTCCTCTGGGAGAATGAGGG + Intergenic
946211411 2:218150212-218150234 AGGCGCCTCTGGGAGAATGCAGG - Intergenic
947200592 2:227611559-227611581 ATGGCCCGCAGGGTGAATGAAGG + Exonic
948042538 2:234914650-234914672 TTACCCCTCTGGGGGGATGAAGG + Intergenic
948265285 2:236631657-236631679 CTGCCCCTCGGTGAGGATGAAGG + Intergenic
1168818887 20:760426-760448 AAGCCCCTCTGTGAGACTGAGGG + Exonic
1170750058 20:19137445-19137467 ATGCTTCTCAGGGTGAATGACGG + Intergenic
1170943587 20:20869679-20869701 ATGCCCCAATGGGACAAAGACGG + Intergenic
1172307776 20:33893764-33893786 GTGCCTCTCTGGAAAAATGAAGG + Intergenic
1173334076 20:42098963-42098985 CTGCCCCTTTGGGAGAATCTCGG - Intronic
1174201569 20:48809798-48809820 ATGCCCCTTTGGGAGAACCTGGG - Intronic
1175342950 20:58246428-58246450 CTGCCCCGCCGGGAGTATGATGG + Intergenic
1176373754 21:6077306-6077328 CCGCCCCTGTGGAAGAATGAGGG - Intergenic
1179749723 21:43460937-43460959 CCGCCCCTGTGGAAGAATGAGGG + Intergenic
1180850710 22:19018680-19018702 AGGCCCCTGTGGGACAATGGAGG - Intergenic
1181061699 22:20284957-20284979 CTGCCCCCCTGGGGGAAGGATGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1181509247 22:23381719-23381741 ATGCCCCTCTGGGGGCCCGAGGG - Intergenic
1182556722 22:31133332-31133354 ATGCCACACTGGGAGACTGCTGG + Intronic
1182557889 22:31138862-31138884 ATGCCCCCCTGGTAGGAAGAGGG + Intronic
1182560080 22:31152814-31152836 TTGCACATCTGGGAGACTGAAGG - Intergenic
1185032226 22:48450188-48450210 GTGGCCCACTGGGAGAGTGAGGG - Intergenic
1185347276 22:50316080-50316102 ATGCGCACCTGGGAGAAGGAGGG + Exonic
950533766 3:13568051-13568073 ATGGGCCCCTGGGAGAATCAGGG - Intronic
951603158 3:24399291-24399313 ATGCCCTTCAGGTAGACTGAGGG - Intronic
952263646 3:31764945-31764967 ATGGCCTTTTGGGAGGATGATGG - Intronic
955334881 3:58077126-58077148 ATGCCCGTGTGGGAGGATGAAGG + Exonic
958456204 3:94334862-94334884 ATGCAACTCTGGTAGAAAGAAGG + Intergenic
963683213 3:148407336-148407358 ATGGCACTTTGGAAGAATGAAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970761851 4:19498972-19498994 ATGACCATCTGGAAGACTGAAGG - Intergenic
974756039 4:66209529-66209551 ATGGCACTCTGAGAGAAGGACGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979469056 4:121072898-121072920 GCGCCACTCGGGGAGAATGAAGG + Intronic
979980784 4:127252517-127252539 ATGAGCATTTGGGAGAATGAAGG + Intergenic
981527481 4:145720771-145720793 ATGCCCCTGTGGGACAGTGGAGG + Intronic
984564080 4:181306792-181306814 ATAACCCTCTGGGGGAATGGCGG + Intergenic
985791046 5:1926865-1926887 ATGCTCCTCTGGGAGAACTGGGG - Intergenic
987299303 5:16582831-16582853 ATGCCCATCAGGGAAAATGACGG + Intronic
990153793 5:52850908-52850930 AGGTACCTCTGGGAGAATAATGG + Intronic
990187172 5:53221452-53221474 AAGCCCCTCAGGGAGAACAAAGG - Intergenic
990832236 5:59972179-59972201 ATGCCCCTCTGGCAGACAGAGGG - Intronic
992780585 5:80123720-80123742 AGGACCCACTGGGAGAGTGAAGG - Intronic
996233423 5:121095639-121095661 ATGCCCTGCTGGAAGCATGAGGG - Intergenic
997512230 5:134461606-134461628 AGTCTCCTTTGGGAGAATGAGGG - Intergenic
997895179 5:137709686-137709708 CAGCCCCACTGGGAGAATGTTGG - Intronic
1002876566 6:1215837-1215859 AGGCCCCTCTGGGAGACAGCAGG + Intergenic
1004334192 6:14749395-14749417 ATGCACTTCTGTGAGACTGAAGG + Intergenic
1006113631 6:31763565-31763587 CTGCCCCTCTGTGTGAATGGGGG + Intronic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1007486156 6:42182141-42182163 GTGCCCCACTGGGCGGATGAGGG + Intergenic
1008544643 6:52574470-52574492 GTGCTTCTCTGGGAGAAAGAGGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1017454733 6:154591230-154591252 ATGCCAATCTGTAAGAATGAGGG - Intergenic
1019137825 6:169922279-169922301 ATGCCCCCCTGGAAGCAGGACGG + Intergenic
1021176052 7:17450375-17450397 AAGCCCATCTGGGAGAAACACGG - Intergenic
1022268750 7:28785262-28785284 AAGCACCTCTGAGAGAATTATGG - Intronic
1024046590 7:45589642-45589664 ATGCTCATCTGGGAAAATGCGGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1032850566 7:135791629-135791651 AGGCTCCCCTGGGACAATGAGGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034291779 7:149938094-149938116 ATTCCGCCCTGGGAAAATGAGGG + Intergenic
1034814304 7:154158804-154158826 ATTCCGCCCTGGGAAAATGAGGG - Intronic
1035386606 7:158477162-158477184 CAGCCCCTCTGAGAGGATGAAGG + Intronic
1038662174 8:29506746-29506768 ACACCCCTCTGGGACACTGAAGG - Intergenic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1043590493 8:81827129-81827151 ATGCCCATCTTGGAGGATCAAGG + Intronic
1045041683 8:98230505-98230527 ATCCTCCTCTGGGAGATTTACGG - Intronic
1049634364 8:143678958-143678980 ATGGCCCCCTGAGAGAATGATGG + Intergenic
1050327028 9:4507785-4507807 ATCGACCTCTGGGAGAAAGAAGG - Intronic
1053178177 9:35944598-35944620 AAGCCCTTCTGGGAGAAGAATGG + Intergenic
1053444758 9:38143744-38143766 ATGTCCTTTTGGGAAAATGAGGG - Intergenic
1057085591 9:92206951-92206973 GTGTCTCTATGGGAGAATGAGGG + Intergenic
1061505298 9:131028415-131028437 TTGCCCATCTGGGATAATGAGGG + Intronic
1061626295 9:131842578-131842600 AAGCCCCTCTTGGAGAAGGGAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1188428081 X:30072845-30072867 AGGCCCCTCTGGGCCAGTGATGG + Intergenic
1191069266 X:56382625-56382647 AGGCATCTCTGGGTGAATGAAGG - Intergenic
1192201124 X:69067379-69067401 CTGACCCTCTGGAAGAATCAGGG + Intergenic
1192808484 X:74529999-74530021 GTGCCCTTCTGGGAAAATGGAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195551245 X:106174114-106174136 ATGAGTCTCTGGAAGAATGATGG + Intronic
1196830097 X:119768987-119769009 ATGCTCCTTTGTCAGAATGAAGG - Intergenic
1197883876 X:131197508-131197530 ATGCCCTTCTGGAAGAATAGAGG + Intergenic