ID: 904043870

View in Genome Browser
Species Human (GRCh38)
Location 1:27599117-27599139
Sequence GCTCCTTCCTGACCTACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 592}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904043870 Original CRISPR GCTCCTTCCTGACCTACCAT GGG Intronic
900874603 1:5332488-5332510 GCTCCCTTCTGAACTTCCATGGG + Intergenic
901400328 1:9011199-9011221 TCTGCTTCCTGACCAACCCTGGG + Intronic
904043870 1:27599117-27599139 GCTCCTTCCTGACCTACCATGGG + Intronic
906651663 1:47517160-47517182 GTTCCTTCCGGAGCTACCCTGGG - Intergenic
907674801 1:56508605-56508627 GCTCCTTCCTGGCATTCCCTGGG + Intronic
907712831 1:56900163-56900185 GCTCCTTTCAGGACTACCATTGG + Intronic
908339488 1:63161944-63161966 GCTCCTTTTTGAACTACCAGAGG + Intergenic
913736096 1:121785620-121785642 GCTCTTTCCTTTACTACCATAGG + Intergenic
913761965 1:122144367-122144389 GCTCTTTCCTTTACTACCATAGG - Intergenic
914998566 1:152566035-152566057 GCTGCTTCCTGAACCACCACAGG - Exonic
914999919 1:152579763-152579785 GCTGCTTCCTGAACCACCACAGG - Exonic
915971090 1:160355841-160355863 GCCCCCTCCTCACCTACCACAGG + Exonic
916616874 1:166450665-166450687 GATCCTGCCTGTTCTACCATTGG - Intergenic
917381474 1:174413910-174413932 GCTCCCTGCTTAACTACCATAGG + Intronic
917487443 1:175467767-175467789 GCTCCTCTCTGACCTACAAGTGG + Intronic
918318071 1:183339825-183339847 GCTCCTTCAGGACCTCTCATTGG - Intronic
920736547 1:208538018-208538040 TCCCCTTCCTCACCTGCCATTGG + Intergenic
921933836 1:220777809-220777831 GATGCTTCTTGACTTACCATGGG + Intronic
922478319 1:225922003-225922025 GCGCCTTCCTGCACTACCACAGG + Exonic
924571588 1:245241786-245241808 GCACCTTCCAGACCTTCCAGAGG - Intronic
1062778907 10:182775-182797 GCTACTTCCTAACTTACCTTAGG - Intronic
1065646903 10:27844513-27844535 GCTCCTCTCTGAACCACCATTGG - Intronic
1065900215 10:30199514-30199536 GCTCCTTCCTGATCCAGCATTGG + Intergenic
1067060388 10:43075361-43075383 GCTCCTGCCTAGCCTACCTTAGG - Intergenic
1072501209 10:96019630-96019652 GCTCCTTCCTTACCAACAATGGG + Intronic
1075662980 10:124210964-124210986 CCTGCTTCCTCATCTACCATGGG - Intergenic
1076331584 10:129674479-129674501 GCTCCTTCCTGACCTCTTAATGG + Intronic
1078532576 11:12148507-12148529 GCTCTGACCTGAGCTACCATGGG - Intronic
1082157269 11:48839246-48839268 GATATTTCCTTACCTACCATAGG - Intergenic
1083823313 11:65184393-65184415 GCTCCTCCCTGGCCTCCGATTGG + Intronic
1085521286 11:77140355-77140377 GCTCTTTCCTGACATTCCCTGGG - Intronic
1089146910 11:116335928-116335950 GCCCCTTCCTCACCTCACATAGG + Intergenic
1089215205 11:116830697-116830719 GCTCCTGCTTGACCACCCATTGG - Intronic
1089810821 11:121130032-121130054 GCTCCTTCCTGGAGTGCCATGGG + Exonic
1090707540 11:129352746-129352768 GCTTCTTGCTCACCTACCACTGG + Intergenic
1090889447 11:130910329-130910351 GCTCTTTCCAGATCTTCCATTGG - Exonic
1091771186 12:3152301-3152323 GCTCCTCCCTCACCTGCCACAGG + Intronic
1095900697 12:47325251-47325273 GCTCCTTACTTACCTACAACGGG - Intergenic
1096111924 12:49033952-49033974 GCTGTTTCCGGACCTAACATGGG + Exonic
1103681071 12:122694155-122694177 GCTCCTTCCTGGCTGACTATAGG - Intergenic
1103682666 12:122706892-122706914 GCTCCTTCCTGGCTGACTATAGG - Intergenic
1104771924 12:131369058-131369080 GATCCTTCCTGCCCTGCCGTGGG - Intergenic
1112914779 13:104534990-104535012 TCTCATTCCTGATCTGCCATAGG - Intergenic
1118018091 14:61681256-61681278 GCTCTTTCCTGCCCTAGCAAGGG - Intergenic
1120950153 14:90033422-90033444 GATCCTTCCTGACTTACACTGGG + Intronic
1121510944 14:94513042-94513064 GCTGCTTCCAGAGCTACCCTCGG - Intronic
1121822528 14:96983027-96983049 GTTGCTTCCTGGCCTCCCATTGG + Intergenic
1130570756 15:85041386-85041408 GCTCTCTCGTGACCTGCCATAGG + Intronic
1130903892 15:88226604-88226626 CCTCCATCCTGACATACCAGGGG + Intronic
1133441026 16:5820972-5820994 CCTCCTTCCTGCCCTCCCAGAGG - Intergenic
1135664207 16:24322240-24322262 GCTCCTTCCTCACCTAACGAAGG - Intronic
1140900550 16:79363267-79363289 GCTCCTTCTTGACTTACAATGGG + Intergenic
1145035213 17:19535803-19535825 GCTGCTTCCTGACTTACTTTCGG - Intronic
1145424011 17:22871276-22871298 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145424706 17:22880792-22880814 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145536106 17:24485018-24485040 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145550902 17:24700607-24700629 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145571493 17:24999637-24999659 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145578503 17:25101738-25101760 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145594105 17:25328254-25328276 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145607723 17:25527459-25527481 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145616380 17:25653368-25653390 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145629186 17:25839686-25839708 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145631583 17:25874648-25874670 GCTCTTTCCTTTACTACCATAGG - Intergenic
1145654400 17:26205229-26205251 GCTCTTTCCTTTACTACCATAGG - Intergenic
1147010999 17:37447812-37447834 ATTCCTTCCTGACTTTCCATGGG - Intronic
1148125860 17:45236463-45236485 GCTCCTTCATGCCCAGCCATGGG - Intronic
1149449356 17:56737875-56737897 CCTGCTTCCTGACCTCACATCGG + Intergenic
1151366678 17:73622177-73622199 GCTCATTCCTGCCCAGCCATGGG + Intronic
1152150656 17:78598284-78598306 GCTCATTCCTGAACTAGCTTTGG - Intergenic
1155651590 18:28150209-28150231 GCTCCGGCCTGACCTGTCATGGG - Intronic
1157329368 18:46692325-46692347 GCTCCCTCCTGATCTCCCATAGG + Intronic
1158389523 18:57033825-57033847 CCTCTTTCCTGACCCATCATGGG - Exonic
1158416485 18:57253466-57253488 GGTCCATCCTGATCTACCCTGGG + Intergenic
1160580292 18:79879875-79879897 GCCCCTTCCTGTCCTGCCTTTGG - Intronic
1161388646 19:4009948-4009970 GCGCCTTCCTGAGCTACCCCCGG + Intronic
1162143325 19:8597536-8597558 CCTCCTGCCTGGCCTCCCATAGG + Intronic
1163155281 19:15436876-15436898 GCAGCTTCCTGACCTCCCGTCGG - Exonic
1164630274 19:29757548-29757570 CCTCCTTCCTGACTGCCCATGGG - Intergenic
1165758740 19:38308724-38308746 AGACCTTCCTGACCAACCATGGG + Intronic
1165971871 19:39638494-39638516 ACACCCTCCTGACCTACAATGGG - Intergenic
1166359998 19:42249104-42249126 GCGCCTTCCTGCACTACCCTGGG - Exonic
1167146187 19:47681787-47681809 GCTCCATTCTGAGCTCCCATTGG - Intronic
925102473 2:1259851-1259873 GCTCAGTCCTTACCTACCCTAGG - Intronic
925171963 2:1755445-1755467 GCTCCTTCGTCCCCTACCCTGGG + Intergenic
926386156 2:12337784-12337806 GCTCCTTCCTGCTCTCTCATCGG - Intergenic
926392538 2:12408119-12408141 GCCCTTTCCTTACCAACCATTGG - Intergenic
927211755 2:20643109-20643131 GCTCCATCCTGAGATCCCATGGG + Intronic
928957137 2:36880897-36880919 ACTCCTTCCTTACATACCAGTGG + Intronic
929604724 2:43226743-43226765 GCGCCTTCCCGGCCTCCCATTGG + Intergenic
930403921 2:50929799-50929821 GCTCCATCCTGTGCCACCATGGG - Intronic
936732453 2:115400570-115400592 GATGCTTCCTGACTTACGATAGG + Intronic
936925306 2:117730826-117730848 GCTCCTTCATGACACACCCTGGG + Intergenic
940948220 2:159643329-159643351 GCTCCTTCCTAACATGGCATAGG + Intergenic
944517369 2:200526052-200526074 GCCCCTTCCTGCCCTAGCAGCGG + Intronic
945381979 2:209151052-209151074 GATGCTTCCTGACCTATCAGTGG + Intergenic
946721180 2:222609994-222610016 GCTCCCTTCTGAGCTACCAAGGG + Intronic
947001708 2:225464503-225464525 CCTCCCTACTGACCTAGCATTGG - Intronic
1171057432 20:21921019-21921041 CCTGCTTCCTGGCCTCCCATTGG + Intergenic
1173033715 20:39388702-39388724 GCTCCTTCCTGACTCACCAGAGG - Intergenic
1180011027 21:45051635-45051657 GCTCCCTCCGGCCCTACCGTGGG - Intergenic
1180971603 22:19818993-19819015 GCTGCTTCCTGGCCTACCTCCGG + Intronic
1184975771 22:48060574-48060596 TCTCCTTCCTGAGAAACCATGGG - Intergenic
1185056589 22:48582028-48582050 GCTCCTTTGAGACCAACCATGGG + Intronic
950453378 3:13078336-13078358 GCTCCATCCTGTCCTGCCATTGG - Intergenic
951749095 3:26013954-26013976 GTTACATCCTGACCTGCCATGGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
963629555 3:147716035-147716057 GCTAGTTCCTGAAATACCATAGG - Intergenic
968905628 4:3449408-3449430 GCTCCCTCCTGACCCTCCAGCGG + Exonic
970922983 4:21416773-21416795 CATCTTTCCTGACCTATCATGGG + Intronic
977737791 4:100438329-100438351 GATGCTTTCTGACTTACCATGGG - Intronic
979612168 4:122700707-122700729 CCTCCTTCATTACCTAACATGGG - Intergenic
979806339 4:124976577-124976599 TCTCATTCCTGCCTTACCATAGG + Intergenic
980971789 4:139573953-139573975 CCGCCTTTCTGATCTACCATAGG + Intronic
981838503 4:149082980-149083002 GCTCCTTCCTTCCCTTCCCTGGG - Intergenic
982358136 4:154491239-154491261 GCTGCTGCCTGACCGCCCATGGG + Intronic
990849688 5:60188573-60188595 TCTCCTCCCTGCCCTACCTTGGG - Intronic
990917454 5:60925445-60925467 GCTCCTTCTGGTCTTACCATGGG + Intronic
991963044 5:72064865-72064887 GCTCCTGCCTGGCCTCCCAGAGG + Intergenic
995800049 5:115984197-115984219 GCACCTTGTTGACCTACCGTGGG + Intronic
997261939 5:132472058-132472080 GCTCCTTCCAGACCTGCCCTGGG - Intronic
998253223 5:140566508-140566530 GCTCCTTCCTGACTGTCCAGGGG - Intronic
999499969 5:152137053-152137075 GCTCCATCCTGATCTCCAATAGG - Intergenic
1000712769 5:164601241-164601263 CCTCCTTCTTGGCCTAGCATAGG + Intergenic
1001164017 5:169347094-169347116 GCTCCATCATGACCTAACCTTGG - Intergenic
1006456407 6:34134482-34134504 GCTCCTCCCTGGCCTTCCCTTGG - Intronic
1010861965 6:80923668-80923690 GATACTTCCTGACTTACAATAGG + Intergenic
1012322031 6:97861673-97861695 GCTCCTTCCTTTCCTTCCCTTGG + Intergenic
1013005459 6:106068903-106068925 GCCCCTTGCTGACCTAACAGTGG - Intergenic
1014781804 6:125573401-125573423 GCTCTTTCCTGTATTACCATGGG - Intergenic
1016902416 6:149115491-149115513 CCTCCTTCCTGACCTACTCAAGG - Intergenic
1019460691 7:1156832-1156854 GCCCCTTCCTGCCCCAGCATGGG - Intronic
1019706248 7:2498532-2498554 GCTCCTGCCTCCCCTACCCTGGG - Intergenic
1023303938 7:38803505-38803527 GCACCTTCCTGACGTAGCACAGG - Intronic
1032054540 7:128673788-128673810 GCTCATTCCTAACATACCCTTGG + Intronic
1034817136 7:154182352-154182374 GCCCATTGCTGACCTACCAGGGG + Intronic
1036396627 8:8376601-8376623 GCTCCTTCCTGCCGGACCAACGG - Exonic
1037905808 8:22715506-22715528 GTTCCTTCCTGCCCTACGGTGGG - Intronic
1041545765 8:59040723-59040745 GATTCTTCCTGAACTACCCTTGG - Intronic
1045290012 8:100825040-100825062 TCTCATTCATCACCTACCATTGG + Intergenic
1046173258 8:110541181-110541203 TCTTCTTCCTCACCTAACATTGG - Intergenic
1047535830 8:125718847-125718869 GCCTCTTCCTGACCATCCATTGG - Intergenic
1051981081 9:23017932-23017954 CTTCCTTCCTGACAAACCATTGG + Intergenic
1052823626 9:33159337-33159359 GCTCCTTCCTGCCCCACCACGGG - Intronic
1053511019 9:38687805-38687827 GATCTTTCCTGCCCTGCCATCGG - Intergenic
1054968836 9:71061239-71061261 GCCACTTCCTGCACTACCATGGG + Intronic
1056831853 9:89923568-89923590 ACTTCTTCCTCACCCACCATGGG - Intergenic
1057525925 9:95801080-95801102 GCCACATCCTGACCTACCTTGGG + Intergenic
1060261015 9:122073533-122073555 GCTCCTTCCTTCCCCACCTTGGG - Intronic
1189476851 X:41362740-41362762 GCTCCTGCCCCACCTCCCATAGG - Intronic
1189883636 X:45516982-45517004 GATGCTTCTTGACTTACCATGGG - Intergenic
1191277018 X:58611876-58611898 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191278232 X:58628167-58628189 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191279617 X:58646685-58646707 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191280980 X:58665031-58665053 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191281136 X:58667088-58667110 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191281897 X:58677380-58677402 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191283283 X:58695894-58695916 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191283904 X:58704120-58704142 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191284788 X:58716127-58716149 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191286030 X:58732581-58732603 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191286350 X:58736926-58736948 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191288307 X:58763324-58763346 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191288766 X:58769493-58769515 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191288923 X:58771550-58771572 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191289076 X:58773607-58773629 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191289230 X:58775664-58775686 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191289542 X:58779778-58779800 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191290004 X:58785947-58785969 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191290927 X:58798293-58798315 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191291081 X:58800350-58800372 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191291239 X:58802407-58802429 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191291397 X:58804461-58804483 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191291761 X:58809018-58809040 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191292068 X:58813132-58813154 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191292225 X:58815189-58815211 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191293465 X:58831649-58831671 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191293618 X:58833704-58833726 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191294535 X:58846049-58846071 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191295749 X:58862504-58862526 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191297278 X:58882731-58882753 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191297588 X:58886844-58886866 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191297900 X:58890958-58890980 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191298056 X:58893015-58893037 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191298675 X:58901244-58901266 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191300229 X:58922154-58922176 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191300853 X:58930384-58930406 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191301471 X:58938612-58938634 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191301784 X:58942727-58942749 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191301938 X:58944783-58944805 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191302520 X:58952668-58952690 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191303139 X:58960892-58960914 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191304626 X:58980607-58980629 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191304784 X:58982664-58982686 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191305248 X:58988837-58988859 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191306079 X:58999569-58999591 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191306683 X:59007797-59007819 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191308532 X:59032481-59032503 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191308836 X:59036595-59036617 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191310077 X:59053056-59053078 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191311443 X:59071405-59071427 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191311903 X:59077596-59077618 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191312215 X:59081714-59081736 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191312526 X:59085829-59085851 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191312680 X:59087886-59087908 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191313291 X:59096114-59096136 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191313601 X:59100228-59100250 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191314954 X:59118739-59118761 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191315106 X:59120796-59120818 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191315250 X:59122668-59122690 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191315402 X:59124721-59124743 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191316956 X:59145291-59145313 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191317245 X:59149066-59149088 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191317714 X:59155239-59155261 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191317869 X:59157297-59157319 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191318488 X:59165527-59165549 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191318955 X:59171699-59171721 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191319403 X:59177868-59177890 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191319558 X:59179925-59179947 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191320177 X:59188155-59188177 GTTCCTTCCTATACTACCATAGG - Intergenic
1191320481 X:59192269-59192291 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191320947 X:59198436-59198458 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191321413 X:59204607-59204629 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191321875 X:59210778-59210800 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191322490 X:59219006-59219028 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191324321 X:59243689-59243711 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191324927 X:59251916-59251938 GTTCCTTCCTGTACTACCATAGG - Intergenic
1191325083 X:59253973-59253995 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191325845 X:59264256-59264278 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191325993 X:59266309-59266331 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191326150 X:59268366-59268388 GTTCCTTCCTATACTACCATAGG - Intergenic
1191326459 X:59272481-59272503 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191327535 X:59286881-59286903 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191327845 X:59290992-59291014 GTTCCTTCCTATACTACCATAGG - Intergenic
1191327999 X:59293049-59293071 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191328153 X:59295107-59295129 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191329071 X:59307447-59307469 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191329381 X:59311561-59311583 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191332705 X:59356311-59356333 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191334089 X:59374826-59374848 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191334398 X:59378940-59378962 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191335325 X:59391285-59391307 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191335480 X:59393342-59393364 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191335791 X:59397457-59397479 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191336102 X:59401572-59401594 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191336717 X:59409795-59409817 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191338726 X:59436539-59436561 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191338879 X:59438598-59438620 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191339346 X:59444770-59444792 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191339501 X:59446829-59446851 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191339966 X:59452996-59453018 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191340113 X:59455054-59455076 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191341184 X:59469455-59469477 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191341338 X:59471512-59471534 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191341800 X:59477684-59477706 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191342923 X:59492473-59492495 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191343542 X:59500700-59500722 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191343847 X:59504817-59504839 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191344000 X:59506874-59506896 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191344154 X:59508931-59508953 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191345841 X:59531558-59531580 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191346312 X:59537726-59537748 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191346770 X:59543897-59543919 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191346926 X:59545954-59545976 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191348156 X:59562415-59562437 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191349078 X:59574751-59574773 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191350464 X:59593258-59593280 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191352717 X:59623419-59623441 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191353178 X:59629590-59629612 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191353945 X:59639872-59639894 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191354713 X:59650159-59650181 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191354869 X:59652216-59652238 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191355173 X:59656333-59656355 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191355636 X:59662506-59662528 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191356715 X:59676910-59676932 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191357027 X:59681024-59681046 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191357181 X:59683081-59683103 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191357646 X:59689251-59689273 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191358694 X:59703138-59703160 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191359464 X:59713428-59713450 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191361000 X:59734001-59734023 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191361611 X:59742229-59742251 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191361764 X:59744287-59744309 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191361915 X:59746344-59746366 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191362224 X:59750459-59750481 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191362530 X:59754575-59754597 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191362684 X:59756633-59756655 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191363444 X:59766744-59766766 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191364197 X:59776688-59776710 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191365126 X:59789033-59789055 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191365724 X:59797091-59797113 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191365880 X:59799147-59799169 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191366033 X:59801201-59801223 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191366189 X:59803258-59803280 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191367111 X:59815599-59815621 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191367772 X:59824511-59824533 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191368385 X:59832745-59832767 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191368688 X:59836858-59836880 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191368844 X:59838915-59838937 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191368999 X:59840972-59840994 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191369154 X:59843029-59843051 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191369757 X:59851256-59851278 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191370992 X:59867709-59867731 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191371457 X:59873881-59873903 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191372377 X:59886223-59886245 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191372511 X:59887939-59887961 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191372816 X:59892051-59892073 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191372969 X:59894109-59894131 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191373898 X:59906451-59906473 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191374055 X:59908508-59908530 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191374368 X:59912621-59912643 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191374985 X:59920847-59920869 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191375597 X:59929075-59929097 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191375909 X:59933189-59933211 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191376174 X:59936795-59936817 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191376329 X:59938853-59938875 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191377551 X:59955308-59955330 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191377707 X:59957365-59957387 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191378166 X:59963543-59963565 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191378931 X:59973834-59973856 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191380790 X:59998527-59998549 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191383201 X:60030733-60030755 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191384439 X:60047192-60047214 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191385206 X:60057479-60057501 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191385360 X:60059536-60059558 GTTCCTTCCTATACTACCATAGG - Intergenic
1191386744 X:60078051-60078073 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191387795 X:60092109-60092131 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191388696 X:60104111-60104133 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191389144 X:60110106-60110128 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191389605 X:60116279-60116301 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191390371 X:60126561-60126583 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191390821 X:60132563-60132585 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191391281 X:60138735-60138757 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191392362 X:60153134-60153156 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191394194 X:60177816-60177838 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191394661 X:60183988-60184010 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191395276 X:60192220-60192242 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191395430 X:60194277-60194299 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191395585 X:60196334-60196356 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191395741 X:60198391-60198413 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191396354 X:60206623-60206645 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191397253 X:60218950-60218972 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191397714 X:60225120-60225142 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191398022 X:60229234-60229256 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191398329 X:60233348-60233370 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191400853 X:60267111-60267133 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191402370 X:60287510-60287532 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191402657 X:60291284-60291306 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191402817 X:60293342-60293364 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191403126 X:60297454-60297476 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191404049 X:60309799-60309821 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191404358 X:60313913-60313935 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191405692 X:60331895-60331917 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191405850 X:60333951-60333973 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191406003 X:60336008-60336030 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191406925 X:60348349-60348371 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191407539 X:60356577-60356599 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191407990 X:60362747-60362769 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191408142 X:60364804-60364826 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191408450 X:60368917-60368939 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191408607 X:60370974-60370996 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191409208 X:60379199-60379221 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191411112 X:60404738-60404760 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191411722 X:60412965-60412987 GTTCCTTCCTATTCTACCATAGG - Intergenic
1191412482 X:60423250-60423272 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191413092 X:60431474-60431496 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191413247 X:60433531-60433553 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191414789 X:60454097-60454119 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191415560 X:60464384-60464406 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191415716 X:60466443-60466465 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191416186 X:60472608-60472630 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191417735 X:60493177-60493199 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191418047 X:60497293-60497315 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191419433 X:60515808-60515830 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191420045 X:60524041-60524063 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191420200 X:60526098-60526120 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191421432 X:60542556-60542578 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191422049 X:60550848-60550870 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191422820 X:60561136-60561158 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191424037 X:60577592-60577614 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191424658 X:60585818-60585840 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191425883 X:60602274-60602296 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191426034 X:60604331-60604353 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191426344 X:60608446-60608468 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191426802 X:60614617-60614639 GTTCCTTCCTATACTACCATAGG - Intergenic
1191427869 X:60629020-60629042 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191428635 X:60639298-60639320 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191430467 X:60663981-60664003 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191432289 X:60688657-60688679 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191433054 X:60698936-60698958 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191433343 X:60702712-60702734 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191434234 X:60714546-60714568 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191434546 X:60718657-60718679 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191434851 X:60722769-60722791 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191435466 X:60730998-60731020 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191436082 X:60739224-60739246 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191436545 X:60745396-60745418 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191436849 X:60749511-60749533 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191437613 X:60759797-60759819 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191437773 X:60761856-60761878 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191438694 X:60774199-60774221 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191439010 X:60778315-60778337 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191439164 X:60780372-60780394 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191440005 X:60791847-60791869 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191440161 X:60793904-60793926 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191440790 X:60802141-60802163 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191441416 X:60810374-60810396 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191441568 X:60812432-60812454 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191442033 X:60818597-60818619 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191442337 X:60822711-60822733 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191442644 X:60826825-60826847 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191443110 X:60833001-60833023 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191443423 X:60837116-60837138 GTTCCTTCCTATACTACCATAGG - Intergenic
1191445863 X:60870031-60870053 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191446483 X:60878263-60878285 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191447202 X:60887696-60887718 GCTCTTTCCTTCACTACCATAGG - Intergenic
1191447885 X:60896775-60896797 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191448646 X:60907064-60907086 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191449100 X:60913234-60913256 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191449248 X:60915121-60915143 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191451241 X:60941873-60941895 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191451704 X:60948043-60948065 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191452535 X:60959184-60959206 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191453923 X:60977699-60977721 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191454832 X:60989869-60989891 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191455606 X:61000156-61000178 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191456228 X:61008387-61008409 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191456385 X:61010444-61010466 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191458203 X:61035134-61035156 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191459275 X:61049532-61049554 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191459582 X:61053646-61053668 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191459736 X:61055703-61055725 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191460815 X:61070104-61070126 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191461892 X:61084506-61084528 GTTCCTTCCTATACTACCATAGG - Intergenic
1191462519 X:61092733-61092755 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191464674 X:61121533-61121555 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191465288 X:61129760-61129782 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191465596 X:61133875-61133897 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191465747 X:61135932-61135954 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191466875 X:61151180-61151202 GTTCCTTCCTATACTACCATAGG - Intergenic
1191467184 X:61155295-61155317 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191467490 X:61159412-61159434 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191468255 X:61169697-61169719 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191468411 X:61171754-61171776 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191468717 X:61175865-61175887 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191469391 X:61184946-61184968 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191470467 X:61199346-61199368 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191471782 X:61216830-61216852 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191472546 X:61227115-61227137 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191474064 X:61247516-61247538 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191474219 X:61249573-61249595 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191474680 X:61255743-61255765 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191475284 X:61263970-61263992 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191475743 X:61270141-61270163 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191477279 X:61290715-61290737 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191478192 X:61302889-61302911 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191478344 X:61304944-61304966 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191478499 X:61307002-61307024 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191478650 X:61309057-61309079 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191479269 X:61317287-61317309 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191479428 X:61319345-61319367 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191479585 X:61321407-61321429 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191480211 X:61329636-61329658 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191480959 X:61339751-61339773 GTTCCTTCCTATACTACCATAGG - Intergenic
1191483228 X:61370103-61370125 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191484299 X:61384500-61384522 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191485374 X:61398903-61398925 GTTCCTTCCTATACTACCATAGG - Intergenic
1191486429 X:61413306-61413328 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191488421 X:61439882-61439904 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191489042 X:61448109-61448131 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191490242 X:61464230-61464252 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191490395 X:61466288-61466310 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191491464 X:61480691-61480713 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191492081 X:61488923-61488945 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191492237 X:61490980-61491002 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191493320 X:61505382-61505404 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191493475 X:61507439-61507461 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191493925 X:61513442-61513464 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191494211 X:61517215-61517237 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191494367 X:61519272-61519294 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191494523 X:61521330-61521352 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191494826 X:61525445-61525467 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191495862 X:61539307-61539329 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191496019 X:61541364-61541386 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191497256 X:61557818-61557840 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191497996 X:61567758-61567780 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191498454 X:61573931-61573953 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191499532 X:61588332-61588354 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191499842 X:61592447-61592469 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191499995 X:61594507-61594529 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191500615 X:61602743-61602765 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191500921 X:61606857-61606879 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191501080 X:61608910-61608932 GTTCCTTCCTATACTACCATAGG - Intergenic
1191502011 X:61621249-61621271 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191502099 X:61622456-61622478 GCTCTTTCCTTCACTACCATAGG - Intergenic
1191502609 X:61629139-61629161 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191502917 X:61633254-61633276 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191503071 X:61635311-61635333 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191503227 X:61637367-61637389 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191503533 X:61641483-61641505 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191504748 X:61657943-61657965 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191504902 X:61660001-61660023 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191505524 X:61668230-61668252 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191506298 X:61678513-61678535 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191506450 X:61680571-61680593 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191506763 X:61684681-61684703 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191507218 X:61690852-61690874 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191508602 X:61709363-61709385 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191509372 X:61719648-61719670 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191510597 X:61736076-61736098 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191510749 X:61738133-61738155 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191511204 X:61744304-61744326 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191511953 X:61754420-61754442 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191512866 X:61766764-61766786 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191513020 X:61768821-61768843 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191513484 X:61774994-61775016 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191513791 X:61779108-61779130 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191513946 X:61781165-61781187 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191514843 X:61793167-61793189 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191516209 X:61811514-61811536 GTTCCTTCCTATACTACCATAGG - Intergenic
1191516671 X:61817683-61817705 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191517753 X:61832089-61832111 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191518215 X:61838263-61838285 GCTCCTTCCTATACTACCGTAGG - Intergenic
1191518675 X:61844431-61844453 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191518831 X:61846489-61846511 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191519144 X:61850608-61850630 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191520989 X:61875286-61875308 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191521590 X:61883169-61883191 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191521748 X:61885227-61885249 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191522058 X:61889340-61889362 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191522208 X:61891398-61891420 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191522365 X:61893456-61893478 GTTCCTTCCTATACTACCATAGG - Intergenic
1191523106 X:61903573-61903595 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191523558 X:61909743-61909765 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191524020 X:61915915-61915937 GTTCCTTCCTGTACTACCATAGG - Intergenic
1191524784 X:61926202-61926224 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191525396 X:61934433-61934455 GTTCCTTCCTATACTACCATAGG - Intergenic
1191525549 X:61936488-61936510 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191525705 X:61938549-61938571 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191526772 X:61952781-61952803 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191527387 X:61961012-61961034 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191527541 X:61963070-61963092 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191527695 X:61965128-61965150 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191528152 X:61971302-61971324 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191528912 X:61981414-61981436 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191529069 X:61983472-61983494 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191530072 X:61996849-61996871 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191531150 X:62011250-62011272 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191531305 X:62013306-62013328 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191531778 X:62019478-62019500 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191532701 X:62031822-62031844 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191533163 X:62037996-62038018 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191533472 X:62042110-62042132 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191534064 X:62049997-62050019 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191534217 X:62052051-62052073 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191534683 X:62058221-62058243 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191535766 X:62072855-62072877 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191536538 X:62083147-62083169 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191538219 X:62105776-62105798 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191538995 X:62116260-62116282 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191539613 X:62124486-62124508 GTTCCTTCCTATTCTACCATAGG - Intergenic
1191539918 X:62128600-62128622 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191540837 X:62140943-62140965 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191541453 X:62149170-62149192 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191541907 X:62155346-62155368 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191542066 X:62157404-62157426 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191542685 X:62165635-62165657 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191542838 X:62167693-62167715 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191543611 X:62177982-62178004 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191543765 X:62180039-62180061 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191544692 X:62192383-62192405 GTTCCTTCCTATACTACCATAGG - Intergenic
1191544843 X:62194441-62194463 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191545142 X:62198557-62198579 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191545765 X:62206787-62206809 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191546368 X:62214848-62214870 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191546673 X:62218964-62218986 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191546830 X:62221021-62221043 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191546985 X:62223078-62223100 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191547139 X:62225135-62225157 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191547446 X:62229250-62229272 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191548517 X:62243636-62243658 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191550057 X:62264206-62264228 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191550827 X:62274491-62274513 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191551289 X:62280664-62280686 GTTCCTTCCTATACTACCATAGG - Intergenic
1191552977 X:62303294-62303316 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191553131 X:62305351-62305373 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191554515 X:62323695-62323717 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191554669 X:62325752-62325774 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191555128 X:62331924-62331946 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191555280 X:62333981-62334003 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191555430 X:62336038-62336060 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191555582 X:62338091-62338113 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191556328 X:62348032-62348054 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191557254 X:62360376-62360398 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191558945 X:62382999-62383021 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191559258 X:62387115-62387137 GTTCCTTCCTGTACTACCGTAGG - Intergenic
1191561276 X:62464255-62464277 GTTCCTTCCTATACTACCATAGG + Intergenic
1191561433 X:62466312-62466334 GTTCCTTCCTGTACTACCGTAGG + Intergenic
1191561584 X:62468370-62468392 GTTCCTTCCTATACTACCATAGG + Intergenic
1191563600 X:62495107-62495129 GTTCCTTCCTGTACTACCGTAGG + Intergenic
1191563755 X:62497164-62497186 GTTCCTTCCTGTACTACCGTAGG + Intergenic
1191563910 X:62499221-62499243 GTTCCTTCCTGTACTACCGTAGG + Intergenic
1199436158 X:147815016-147815038 GCTCTTTCCTGCCAAACCATGGG + Intergenic