ID: 904045313

View in Genome Browser
Species Human (GRCh38)
Location 1:27604819-27604841
Sequence TGCTCAGCAGAATTCGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904045313_904045315 -7 Left 904045313 1:27604819-27604841 CCTTTTCCGAATTCTGCTGAGCA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 904045315 1:27604835-27604857 CTGAGCATTTGCGTTGTGTCAGG 0: 1
1: 0
2: 6
3: 47
4: 486
904045313_904045316 0 Left 904045313 1:27604819-27604841 CCTTTTCCGAATTCTGCTGAGCA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 904045316 1:27604842-27604864 TTTGCGTTGTGTCAGGAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 126
904045313_904045317 15 Left 904045313 1:27604819-27604841 CCTTTTCCGAATTCTGCTGAGCA 0: 1
1: 0
2: 0
3: 18
4: 151
Right 904045317 1:27604857-27604879 GAAGCAGGATTCAGATTGAACGG 0: 1
1: 0
2: 0
3: 22
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904045313 Original CRISPR TGCTCAGCAGAATTCGGAAA AGG (reversed) Intergenic
904045313 1:27604819-27604841 TGCTCAGCAGAATTCGGAAAAGG - Intergenic
905321437 1:37120165-37120187 TGCTCTGTAGAATTTGGTAAAGG + Intergenic
919300532 1:195757642-195757664 TTGTCAGCAGAAATGGGAAATGG + Intergenic
919565314 1:199177928-199177950 TACTCAACAGAACTTGGAAATGG - Intergenic
921816393 1:219568931-219568953 TGCTCAGCATCATTAGGAAGAGG - Intergenic
923282993 1:232462532-232462554 GACTCAGCAAAATGCGGAAAGGG + Intronic
924785971 1:247200106-247200128 TGCTCAGCAGAATCTGTATAGGG - Intergenic
1064976632 10:21123690-21123712 TGATCATCAGAATTCAGAGAAGG - Intronic
1066696451 10:38083022-38083044 TGGTCATGAGAATTAGGAAAGGG + Intergenic
1066996100 10:42564714-42564736 TGGTCATGAGAATTAGGAAAGGG - Intergenic
1067749396 10:48960133-48960155 TGCTCAGCATAGTTCAGAGAGGG + Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068918432 10:62458407-62458429 TCTTCAGCAGAATTTTGAAAAGG + Intronic
1070446123 10:76505147-76505169 TTCTCAGCAGAATTCTTACAAGG - Intronic
1073805261 10:107090761-107090783 TGATAAGCAGATTTCTGAAAGGG + Intronic
1074493282 10:113957738-113957760 TGATCAGCAAAACTGGGAAAAGG + Intergenic
1077574508 11:3371616-3371638 CGCTCAGCAGAATTTGTACAGGG - Exonic
1093919087 12:24839179-24839201 TGCTGAGGAGAAATGGGAAATGG + Intronic
1094330447 12:29286115-29286137 TGATCAGCAGTTTTTGGAAATGG + Intronic
1094544070 12:31387659-31387681 TGGTCTGCAGAATTCGGATAAGG + Exonic
1095436876 12:42198683-42198705 TGCTCTGTAAAATTCCGAAATGG + Intronic
1097952434 12:65446818-65446840 TGCCCAGCAGAATTACAAAAAGG + Intronic
1098100931 12:67016532-67016554 TGCTCAGCAGTCGACGGAAATGG + Intergenic
1099924604 12:89002172-89002194 TGCTCAGCAGGTTTCAGCAAAGG - Intergenic
1105230033 13:18485357-18485379 TGCTCAGCAGAATTTGTGTATGG - Intergenic
1109906825 13:68854127-68854149 TGCAAAGCAAAATTCGCAAAAGG + Intergenic
1110805633 13:79751175-79751197 TGCTCCTCAGAATTGTGAAAAGG + Intergenic
1112579540 13:100666427-100666449 TGCTCAGCAGAACCACGAAATGG + Intronic
1114014288 14:18412173-18412195 TGCTCAGCAGAATTTGTATAAGG - Intergenic
1116887545 14:50235763-50235785 TGCTGAGCAAAAGTGGGAAAAGG + Intergenic
1117317237 14:54583457-54583479 TGCACAACAGAATTCTGAAGAGG - Intronic
1119791109 14:77350892-77350914 TGCTCTGGAGAATTAGAAAAGGG + Intronic
1120909693 14:89654952-89654974 TCCTCAGCAGGATTTGCAAAAGG - Intergenic
1125785597 15:42314285-42314307 TTCTCAGCAGAATTTCCAAAGGG + Intronic
1129179321 15:73862307-73862329 TGGTCAGAGGAATTGGGAAAGGG + Intergenic
1130447420 15:84016088-84016110 TATTCAGCAGAATTCCAAAAGGG - Intronic
1130636437 15:85625355-85625377 TCATCAGCAGAATTAGGAGACGG - Intronic
1130912616 15:88281474-88281496 TGTTCAGCAGCAGTCGCAAATGG - Intergenic
1131969898 15:97881516-97881538 TGCTCCGCAGCATCCAGAAATGG + Intergenic
1134294671 16:12935194-12935216 TGGTCAGAAGAAGTAGGAAATGG + Intronic
1134357440 16:13496969-13496991 TGCTAACCAGAATTCTAAAAAGG + Intergenic
1136101040 16:27996216-27996238 TCCTGAGCAGAATTCAGATATGG - Intronic
1136624300 16:31452559-31452581 TGCTCAGCAAATTTCTGAATGGG + Intergenic
1137611864 16:49823598-49823620 TGCTCTGCAACATTCCGAAAGGG + Intronic
1137726123 16:50657902-50657924 TGCTAAGCAGAAATTGGGAAAGG + Intergenic
1138330332 16:56209760-56209782 TTCACAGCAGAATTGAGAAAGGG + Intronic
1144249602 17:13402397-13402419 AGCTGAGCAGAATTCAGAAAAGG + Intergenic
1144249756 17:13404008-13404030 AGCTGAGCAGAATTCAGAAAAGG + Intergenic
1146368932 17:32252156-32252178 TGTTCAGCATAATTCCAAAATGG - Intronic
1147552479 17:41453945-41453967 TCCTCAGCAGCAGTGGGAAAGGG - Intergenic
1148360359 17:47006934-47006956 TTCTCAGCACTATTCGGAAATGG - Intronic
1148878701 17:50708243-50708265 TGCCCAGCAGGATGGGGAAATGG + Intergenic
1148902626 17:50889855-50889877 TTCCCAGCAGCATTGGGAAAAGG - Intergenic
1149086826 17:52727989-52728011 TGATCATCACAATTCGGAAGGGG + Intergenic
1152838137 17:82548678-82548700 TGCTCAGCTGAATTAGCAGAAGG + Intronic
1154523373 18:15254484-15254506 TGCTCAGCAGAATTTGTATATGG + Intergenic
1156004118 18:32419752-32419774 TGATAGGCAGAATTCTGAAATGG - Intronic
1158130035 18:54142292-54142314 TGCTCAGCAAAATTTGTATAGGG + Intergenic
1159012903 18:63075177-63075199 TGGGCAGCAGATTCCGGAAAGGG - Intergenic
1163212550 19:15851927-15851949 CACTCAGCAGAAATCAGAAAAGG + Intergenic
1164434145 19:28214430-28214452 TGCTCCTGAGAATTGGGAAAAGG - Intergenic
1164781184 19:30894666-30894688 GGCTAAGCAGCATTAGGAAAAGG - Intergenic
1164989121 19:32672061-32672083 AGCTCAGCAGAATTCAGCATGGG + Intronic
927793343 2:26028126-26028148 CACACGGCAGAATTCGGAAACGG + Intergenic
928379834 2:30808232-30808254 TACTCATCAGAATTTGGGAATGG - Intronic
928840967 2:35604109-35604131 TGGTTGGCAGAATTTGGAAATGG + Intergenic
934652428 2:96100177-96100199 TGCTGAGCAGAAGTCGGCACTGG + Intergenic
935720883 2:105978176-105978198 TCCTCAGCAGAAATCCAAAATGG + Intergenic
936902287 2:117495237-117495259 TGCTCAGCAGAATCATAAAAGGG + Intergenic
938274390 2:130005029-130005051 TGATCAGCAGCTTTTGGAAATGG - Intergenic
938440990 2:131332225-131332247 TGATCAGCAGCTTTTGGAAATGG + Intronic
938522674 2:132087354-132087376 TGCTCAGCAGAATTTGTATATGG + Intergenic
938540694 2:132281466-132281488 TGCTCATCAGACCTCAGAAAAGG - Intergenic
938556091 2:132425510-132425532 TGCTAGGCAGAATTCTGAAATGG + Intronic
939614192 2:144344433-144344455 TGCAATGCAGAATTTGGAAATGG - Intergenic
942078354 2:172378054-172378076 TGCTTCTCAGAATTAGGAAATGG + Intergenic
945261798 2:207850635-207850657 TCCTTAGCAGCATTAGGAAAGGG + Intronic
946185844 2:217979934-217979956 TTCTCAGCAGACTGCAGAAAGGG + Intronic
946640553 2:221779395-221779417 TCTTCTGCAGACTTCGGAAAGGG + Intergenic
1170003861 20:11645354-11645376 TGCACAGGAGAATTTGAAAAAGG + Intergenic
1172017357 20:31885690-31885712 TGCTAAGCAGAATTCTCAGATGG + Intronic
1172360007 20:34305503-34305525 TGCACTGCAGAATGCTGAAAGGG - Intronic
1173853577 20:46234609-46234631 GGCTCAACAGAATGTGGAAACGG - Intronic
1173919405 20:46732561-46732583 TGAACAGCAGATTTGGGAAATGG + Intronic
1175025014 20:55892865-55892887 TTTTCAGCAGAACTAGGAAATGG - Intergenic
1176774019 21:13113703-13113725 TGCTCAGCAGAATTTGTGTATGG - Intergenic
1179270965 21:39850738-39850760 AGCTCAGCAGAACTGGGAGAAGG - Intergenic
1180438784 22:15342979-15343001 TGCTCAGCAGAATTTGTATAAGG - Intergenic
1180521637 22:16213426-16213448 TGCTCAGCAGAATTTGTATATGG - Intergenic
1184877278 22:47283764-47283786 TGCTCAGGAGCATTTGGAGAGGG - Intergenic
950741264 3:15053455-15053477 TGCTCCCCAGAATCTGGAAACGG + Exonic
952025482 3:29075849-29075871 TGCTTAGCAGAATGCGAAAAAGG - Intergenic
952772500 3:37014897-37014919 TGCACAGCAGGATACGGAAAAGG + Intronic
955923173 3:63979767-63979789 AACTCAGCAGACTTCAGAAATGG - Intronic
956092950 3:65687491-65687513 TGCTCAGCAGAATCAGGAGCTGG - Intronic
957779437 3:84799457-84799479 TGGTAAGCAGAATTCGAAGATGG + Intergenic
959861900 3:111226004-111226026 AGCTCTGCAGAAGTCTGAAATGG + Intronic
961535803 3:127569800-127569822 TGCTCAGCAGAATGGGGCCATGG - Intergenic
962695261 3:137941529-137941551 TGCTCTGCAGAATGCTTAAAAGG + Intergenic
963072554 3:141316707-141316729 TGCTCAGATGAATTCCTAAAGGG - Intergenic
966595298 3:181720105-181720127 TGCCCAGCAGAATTAGGGAAGGG + Intergenic
968606028 4:1536173-1536195 GGCGCAGCAGAATCCGGGAAAGG + Intergenic
971508963 4:27400166-27400188 ACCTCAGCAGAAGTCTGAAATGG + Intergenic
972678814 4:41286140-41286162 TGCTTGGCAGAATTCTAAAATGG + Intergenic
972835527 4:42865693-42865715 GCCTTAGCAGAATTTGGAAAAGG - Intergenic
973051804 4:45607712-45607734 GGCTCAGAAGAATAGGGAAAAGG - Intergenic
973145271 4:46817932-46817954 TTCTCAGCAGAACACAGAAAAGG + Intronic
976684033 4:87790482-87790504 AGCTCAGCAGAATACTGTAAAGG + Intergenic
976908020 4:90263840-90263862 TGCACAGAAGAATTCACAAAGGG - Intronic
979906999 4:126306674-126306696 TGCTCAGGAGAATACGGCAGGGG - Intergenic
981108666 4:140910764-140910786 TGCTCAGCAGGACTGGGATAGGG - Intronic
981417924 4:144514915-144514937 TTCTCAGCAAAATTCCAAAATGG - Intergenic
983338422 4:166425404-166425426 TGTTCAGGAGAACTGGGAAAAGG + Intergenic
985365699 4:189229839-189229861 TGGTCACCAGAAGTCGGGAAGGG + Intergenic
988906742 5:35798324-35798346 GGCTGAGCAGAATTGGCAAAGGG - Intronic
990548369 5:56846658-56846680 TACACATCAGAATTCGGAGAGGG - Intronic
990699735 5:58461187-58461209 TGCACAGCAAAATCTGGAAATGG - Intergenic
990948577 5:61274841-61274863 TGCTCAGGTTAATTCTGAAATGG + Intergenic
991215153 5:64151580-64151602 CACTCAGCAGAATTAGGGAAGGG - Intergenic
995602384 5:113811969-113811991 TTGTCAACAGAATTCAGAAAAGG + Intergenic
996525519 5:124475045-124475067 TGCCAAGCAGATTTCGAAAATGG + Intergenic
998035488 5:138911676-138911698 TGGACATCAGAATTCTGAAATGG - Intronic
999374560 5:151077800-151077822 TCCTTAGCAGCATTGGGAAATGG - Intronic
1000219930 5:159204897-159204919 TTCTCAGCAAAATTCTTAAAAGG - Intronic
1001882445 5:175256238-175256260 TGCTCTGCAGAGTTCTGAGATGG + Intergenic
1003756582 6:9128001-9128023 TGGTAAGCAGAATTCTGAGATGG + Intergenic
1005357286 6:24996690-24996712 GGCTCAGAAGAATTGGGGAAGGG - Intronic
1009508057 6:64511014-64511036 TGCTATTCAGAATTAGGAAAGGG - Intronic
1010708518 6:79143387-79143409 TGTTCAGCAGAATTCTGAACAGG + Intergenic
1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG + Intronic
1013690589 6:112637504-112637526 TTCTAAGCAGAATTCCAAAATGG + Intergenic
1014418232 6:121210550-121210572 TGGTAGGCAGAATTCGAAAATGG + Intronic
1015452732 6:133389756-133389778 TGACCAGCAGGATTAGGAAAGGG - Intronic
1016011811 6:139144636-139144658 TGGTCAGCTGAATTTGAAAAGGG + Intronic
1016554115 6:145316096-145316118 GAGTCAGCAGAATTGGGAAAGGG + Intergenic
1018263870 6:161999047-161999069 TTCTCAGTAGATTTAGGAAAGGG + Intronic
1020750763 7:12138634-12138656 TGCTTAGCAGAGTTAGAAAAGGG + Intergenic
1021372519 7:19866990-19867012 TTCTCAGAAGAATTCGGGTATGG + Intergenic
1021504432 7:21365782-21365804 TGCACAGCATAACTAGGAAAAGG + Intergenic
1023549001 7:41348784-41348806 TCCTCAGCAGAAGTTAGAAAAGG - Intergenic
1025717968 7:63981389-63981411 TGCTCAGCAGCATTTGCACAGGG - Intergenic
1031108328 7:117573538-117573560 TACTCAGGAGAATTTGGACAGGG - Intronic
1032113442 7:129096612-129096634 TGCACAGCAGAATTTGTATAGGG - Intergenic
1034014797 7:147570299-147570321 TGCTAAACAGAATTCTAAAATGG - Intronic
1034875255 7:154719781-154719803 TGTTCAGCAGAAATGGGAAACGG + Intronic
1038094899 8:24297408-24297430 TTCTCAGCACCATTCAGAAATGG - Intronic
1039359519 8:36860762-36860784 TGGAAAGCAGAATTCTGAAAAGG + Intronic
1039686338 8:39805985-39806007 TGCTCAGGGGAAATTGGAAAGGG + Intronic
1042261243 8:66861674-66861696 TGTTCAGCAGAATTGGGCAGTGG + Exonic
1043378564 8:79678080-79678102 TGCTCAGCAAAACCTGGAAAGGG - Intergenic
1043753858 8:83977115-83977137 TGCTCAGTTGAATTCTGACAAGG + Intergenic
1045287597 8:100805336-100805358 TGCACAGGAGATTTCAGAAAAGG + Intergenic
1046092779 8:109522854-109522876 TCCTCAGCAGCCTTCGGTAAAGG + Exonic
1047678747 8:127231750-127231772 TGCACAGCAGAATTCAGAGGAGG + Intergenic
1048583017 8:135745978-135746000 TGCTGAGCAGACCTAGGAAATGG + Intergenic
1049315786 8:141966620-141966642 TGCTCAGCATAATTGGCCAATGG - Intergenic
1050211064 9:3256685-3256707 TGTTCAGCAGTAATCAGAAAAGG - Intronic
1053701361 9:40694482-40694504 TGCTCAGCAGAATTTGTATATGG + Intergenic
1054411425 9:64817938-64817960 TGCTCAGCAGAATTTGTATATGG + Intergenic
1186414004 X:9367929-9367951 TGGTCAGCAGAATTCTAAGATGG + Intergenic
1186754385 X:12654827-12654849 TGTTCTGTAGAATTCAGAAATGG - Intronic
1188408988 X:29848482-29848504 TGCTCTGCACAAGTCTGAAAAGG - Intronic
1189646793 X:43141985-43142007 AGCTCAGCTGGATTCAGAAAGGG + Intergenic
1195585980 X:106566092-106566114 TGCTCAGCAGAATGTGTATAGGG + Intergenic
1198314454 X:135452127-135452149 TGCTCTGCAGAACTGGGAGAGGG - Intergenic
1198431053 X:136566651-136566673 TTCTCAGTAGCATTAGGAAAAGG - Intergenic
1198827042 X:140709919-140709941 TAATCAGCAGCATTGGGAAATGG + Intergenic
1199194771 X:145015684-145015706 TGCCCAGCAGAATGGGGAGAGGG - Intergenic
1199534462 X:148886412-148886434 TTCTCAGCTGCATTCTGAAATGG - Intronic
1199835482 X:151585962-151585984 TGATCAGCAGAATTCTTACATGG + Intronic