ID: 904045576

View in Genome Browser
Species Human (GRCh38)
Location 1:27606324-27606346
Sequence CTGAAGTAGCCTGGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904045576_904045583 -2 Left 904045576 1:27606324-27606346 CCTCCCACCCCAGGCTACTTCAG 0: 1
1: 0
2: 6
3: 53
4: 468
Right 904045583 1:27606345-27606367 AGCGGTCCCCTTCCCCTGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 165
904045576_904045591 12 Left 904045576 1:27606324-27606346 CCTCCCACCCCAGGCTACTTCAG 0: 1
1: 0
2: 6
3: 53
4: 468
Right 904045591 1:27606359-27606381 CCTGTGAGGGTGAATTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 105
904045576_904045584 -1 Left 904045576 1:27606324-27606346 CCTCCCACCCCAGGCTACTTCAG 0: 1
1: 0
2: 6
3: 53
4: 468
Right 904045584 1:27606346-27606368 GCGGTCCCCTTCCCCTGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904045576 Original CRISPR CTGAAGTAGCCTGGGGTGGG AGG (reversed) Intergenic
900427662 1:2587812-2587834 CTTGGGTAGCGTGGGGTGGGGGG + Intronic
900547290 1:3236089-3236111 CTGCAGTTGTCTGGGGAGGGTGG - Intronic
900590007 1:3455205-3455227 TTGAAAGAGCATGGGGTGGGGGG + Intronic
900613245 1:3553269-3553291 CCGGAGTACCCTGGGGTGGGGGG - Intronic
900634265 1:3654243-3654265 CAGAGGTAGCCTGGGGTGAACGG + Intronic
901002759 1:6156772-6156794 CTGCTGAGGCCTGGGGTGGGGGG + Intronic
901024632 1:6272698-6272720 CTGGAGTATCCTGGGGCTGGAGG - Intronic
901514773 1:9737749-9737771 CAAAAGAAGCCTGGGGTTGGGGG - Intronic
901831966 1:11898392-11898414 TAGAAGTCGCCTGGGGTGGGTGG + Intergenic
903211677 1:21822545-21822567 GGGATGTGGCCTGGGGTGGGCGG + Exonic
903971537 1:27122193-27122215 CTGACTCAGCCTGGGGAGGGCGG - Intronic
904045576 1:27606324-27606346 CTGAAGTAGCCTGGGGTGGGAGG - Intergenic
904074691 1:27831085-27831107 CTGAAGAAACCCGGGGTTGGGGG + Intronic
904424920 1:30417076-30417098 CTGAAGTAGCCTGTGAGGGGTGG - Intergenic
904492499 1:30869768-30869790 CAGAACCTGCCTGGGGTGGGTGG - Intronic
904525788 1:31132859-31132881 CAAAATTAGCCTGGTGTGGGTGG + Intergenic
904724260 1:32534905-32534927 CTTCAGGAGGCTGGGGTGGGAGG + Intronic
904882703 1:33712782-33712804 CTGAACCTTCCTGGGGTGGGTGG + Intronic
905182900 1:36177770-36177792 CTGATGTAGCCTGGGGGAGGGGG + Intronic
905183643 1:36180912-36180934 CTGAAGAAGCCTCGGGCTGGTGG + Intergenic
905396817 1:37671860-37671882 ATGCAGGAGGCTGGGGTGGGAGG - Intergenic
906324155 1:44833879-44833901 CTTTAGGAGGCTGGGGTGGGAGG - Intronic
907251760 1:53144093-53144115 TTGCAGTAGCTTGGGGTGGGGGG + Intergenic
907488426 1:54793045-54793067 GTGAACCTGCCTGGGGTGGGTGG + Intronic
908510986 1:64850010-64850032 GTGAAGGAGCCTGGGGAGAGTGG - Intronic
911975286 1:104487348-104487370 CTGGGGTGGGCTGGGGTGGGCGG - Intergenic
912263747 1:108133639-108133661 CTGAAGTGGCCTGGGGTTAGTGG + Intergenic
912823754 1:112887250-112887272 CTGTGGGAGCCTGGGGTGGGTGG - Intergenic
913162832 1:116160930-116160952 CTTTAGAAGCCTGAGGTGGGTGG + Intergenic
915412687 1:155714957-155714979 CTTTGGGAGCCTGGGGTGGGAGG + Intronic
915431996 1:155874055-155874077 CTTAAGGAGGCTGAGGTGGGCGG + Intronic
916496596 1:165353371-165353393 CAGGAGTTCCCTGGGGTGGGGGG - Intronic
917853814 1:179085977-179085999 CTGGAGAAGCCTGGGGAGGTGGG + Intronic
918144063 1:181740501-181740523 CTCAAGTGGCCTGGTGGGGGTGG + Intronic
919730626 1:200911752-200911774 CAGCAGTAGCTTGGGGTGGTGGG - Exonic
920153939 1:203933104-203933126 CTTTAGGAGGCTGGGGTGGGAGG + Intergenic
921057498 1:211554690-211554712 CTGAAAGAGGCTGAGGTGGGAGG + Intergenic
922991859 1:229920948-229920970 CTGCAGCACCCAGGGGTGGGTGG - Intergenic
924239709 1:242029575-242029597 CTGACGGAGGCTGAGGTGGGAGG - Intergenic
924246881 1:242093804-242093826 CGGGGGCAGCCTGGGGTGGGGGG + Intronic
1062909287 10:1202184-1202206 CTTAAGGAGGCTGAGGTGGGAGG - Intronic
1062994815 10:1855859-1855881 CTCAAGGTGCCTGTGGTGGGAGG + Intergenic
1063458610 10:6202165-6202187 CTGAAGTGGACTGGGGCTGGGGG - Intronic
1064139642 10:12779536-12779558 CTGCAGGAGGCTGAGGTGGGAGG - Intronic
1064187940 10:13179393-13179415 CTTAAGTAACTTGGGGTCGGGGG + Intronic
1064553305 10:16523222-16523244 CTGGAGTAGGCTGGGGGGCGGGG - Intergenic
1065001372 10:21340698-21340720 TTCAAGGAGCCTGGGGAGGGTGG - Intergenic
1065047045 10:21754185-21754207 TTGAAGTAGGATGGGGTGGGGGG - Intergenic
1065440118 10:25744423-25744445 CTCAAGGAGGCTGAGGTGGGAGG + Intergenic
1065916846 10:30359970-30359992 CGGAAGATGCCTGGGGTGGATGG + Intronic
1067158139 10:43799867-43799889 CTGGGTTAGCGTGGGGTGGGAGG + Intergenic
1067806791 10:49398161-49398183 CCGCAGCAGCCGGGGGTGGGTGG - Intergenic
1069707373 10:70467306-70467328 CTGGAGAAGCCTGGGGGTGGGGG + Intergenic
1070664546 10:78333848-78333870 CTGAGGAAGGCTGGAGTGGGTGG + Intergenic
1071133135 10:82418842-82418864 CTGAGGGAGCCTGAGGTGCGAGG - Intronic
1071680272 10:87697745-87697767 CTGAAAAAGCCAGGGCTGGGTGG + Intronic
1072304938 10:94098014-94098036 CTGAAGTAGCCTGATTTGGAAGG + Intronic
1072618619 10:97065845-97065867 CTGGAATAGTCTGGGGTTGGAGG - Intronic
1073178146 10:101569074-101569096 CTCAGGTAGCTTGGGGTGGGAGG + Intergenic
1073401583 10:103261844-103261866 CTTAAGGAGGCTGAGGTGGGTGG - Intergenic
1074120516 10:110490731-110490753 GGGAAGTAGGCTGGGGTGGGAGG - Intergenic
1074142438 10:110685728-110685750 TTGAGGTAGCCTTGGGCGGGAGG + Intronic
1074544178 10:114389654-114389676 ATGAATAAGCCTGGGGTGGTAGG - Intronic
1075161283 10:120026820-120026842 CTACAGGAGGCTGGGGTGGGAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076142624 10:128091801-128091823 CCCAACTAGCCTGGGCTGGGGGG + Intergenic
1076453923 10:130576181-130576203 CTGAAGAAGGCTGGTGTGGGCGG - Intergenic
1076898164 10:133324521-133324543 CTGCAATTGGCTGGGGTGGGCGG + Intronic
1076898173 10:133324554-133324576 CTGCAATTGGCTGGGGTGGGCGG + Intronic
1076905398 10:133358405-133358427 CTGAGGGAGCTCGGGGTGGGAGG - Intergenic
1077865026 11:6214902-6214924 ATGAAGGGGCCTGGGTTGGGGGG + Exonic
1078297286 11:10085969-10085991 CTGAGGATACCTGGGGTGGGGGG - Intronic
1079898688 11:26153738-26153760 GTGAGGTAGCCTGGGGGGAGAGG + Intergenic
1080616298 11:33947560-33947582 CTGAAGGGGCCTGGGGAGGGAGG - Intergenic
1082128135 11:48456049-48456071 CTGGAGCAGCCTGGGATGTGGGG + Intergenic
1082249279 11:49961370-49961392 CTGGAGCAGCCTGGGATGTGGGG - Intergenic
1082846019 11:57726167-57726189 CTTTGGTAGGCTGGGGTGGGCGG + Intronic
1083212229 11:61195417-61195439 GTGCCTTAGCCTGGGGTGGGCGG - Intergenic
1083255427 11:61492534-61492556 CAGCAGGAGCCAGGGGTGGGGGG - Intergenic
1083318549 11:61831139-61831161 CTTGAGCAGCGTGGGGTGGGTGG + Intronic
1083473233 11:62898453-62898475 CTTCAGGAGCCTGAGGTGGGAGG - Intergenic
1083634002 11:64110338-64110360 CTGCAGGAGGCTGAGGTGGGAGG + Intronic
1083737209 11:64688218-64688240 CTCCAGTCTCCTGGGGTGGGTGG + Intronic
1083975349 11:66114959-66114981 CTTTAGTAGGCTGAGGTGGGAGG + Intronic
1084183525 11:67458324-67458346 CTGAGGCAGCTTTGGGTGGGAGG + Intronic
1084868515 11:72080196-72080218 CTGAAGGTGACTGGGGTCGGGGG - Intronic
1085270426 11:75266843-75266865 CAGAAGAAGGCTGGGGTAGGAGG + Intronic
1085418183 11:76333707-76333729 CTGAAGGAGCCAAGGGTGGGAGG + Intergenic
1085503229 11:77040826-77040848 CTGAAATCAGCTGGGGTGGGGGG + Exonic
1086095342 11:83044797-83044819 CTGAAGCATCCTGGGGTTTGTGG - Intronic
1087153156 11:94876872-94876894 CTGGAGGAGCCAGGAGTGGGCGG - Intergenic
1088323881 11:108582355-108582377 CTTAGGGAGGCTGGGGTGGGAGG + Intronic
1088612444 11:111590728-111590750 CTGATCTAGTCTGGGGTTGGGGG - Intergenic
1089642483 11:119856930-119856952 CTGAGATCACCTGGGGTGGGCGG - Intergenic
1089696074 11:120217058-120217080 CTAAAGAACCCTGGGGAGGGAGG + Intronic
1089732153 11:120525781-120525803 GGGAAGTAGCCTGGTGTGGTGGG + Intronic
1089937300 11:122377338-122377360 CTGAAGGAGGCGGGGGGGGGGGG + Intergenic
1090629936 11:128637167-128637189 CTTCACAAGCCTGGGGTGGGAGG + Intergenic
1091313746 11:134596222-134596244 CTGTAGGAGGCTGAGGTGGGAGG - Intergenic
1091562945 12:1628780-1628802 CTGGGGTGGGCTGGGGTGGGAGG - Intronic
1093011656 12:14113292-14113314 CTGGAGTGGGGTGGGGTGGGGGG + Intergenic
1093654959 12:21683974-21683996 CTGAAGTAGACTGAAGAGGGAGG - Intronic
1094821742 12:34231510-34231532 CTGGAGGAGTCTGAGGTGGGAGG + Intergenic
1095122040 12:38430870-38430892 CACATGTAGCCTGGGCTGGGAGG + Intergenic
1096103810 12:48985323-48985345 CTGAAATATCCTGGGGGGAGTGG + Intergenic
1096349940 12:50889345-50889367 ATGCAGGAGGCTGGGGTGGGAGG - Intergenic
1096626110 12:52897147-52897169 CTGATGTCCACTGGGGTGGGAGG - Intergenic
1097326658 12:58284758-58284780 CTGAGGAAGTATGGGGTGGGAGG + Intergenic
1099887848 12:88553895-88553917 TTAAAGAAGTCTGGGGTGGGAGG + Intronic
1101123361 12:101606545-101606567 CTTTAGGAGACTGGGGTGGGTGG - Intronic
1102990550 12:117312664-117312686 CTTCAGGAGGCTGGGGTGGGAGG - Intronic
1103035065 12:117649894-117649916 CTGATCTGGCCTGGGGTTGGAGG + Intronic
1103503182 12:121421247-121421269 CTGAACTAGGCTGGGCTTGGTGG + Intronic
1103575886 12:121876848-121876870 CTGAAGTGGGCTGAAGTGGGAGG + Intergenic
1103709370 12:122899986-122900008 CTTTGGAAGCCTGGGGTGGGAGG + Intergenic
1104725455 12:131072819-131072841 CTGAAGCAGCCTGGGCTGAGTGG + Intronic
1104976205 12:132553088-132553110 CAGAAGTGGGCTGGGGTGGGTGG - Intronic
1105780441 13:23701403-23701425 TTGGAAGAGCCTGGGGTGGGTGG + Intergenic
1106198952 13:27520418-27520440 CTTCAGTAGGCTGAGGTGGGCGG + Intergenic
1106436974 13:29731871-29731893 CTATAGTGGCCTGGGGAGGGAGG - Intergenic
1107828542 13:44352910-44352932 CTGAAGCAGACAGGGGTGGTGGG - Intergenic
1107843180 13:44481268-44481290 CAGAAAAAGCTTGGGGTGGGAGG + Intronic
1107964278 13:45585564-45585586 CTGCAGTTACTTGGGGTGGGGGG - Intronic
1108132520 13:47318041-47318063 CTAAAGAAACCTTGGGTGGGAGG - Intergenic
1109331138 13:60932297-60932319 CTAAAGTATCCTGAGGTGTGGGG + Intergenic
1111006988 13:82260473-82260495 ATGCAGGAGCCTGAGGTGGGAGG + Intergenic
1112766755 13:102753921-102753943 CTGAAGCAGGCTGGGCGGGGTGG + Intronic
1113400908 13:109992565-109992587 CTGGAGCAGCCTGAGGAGGGGGG - Intergenic
1113419176 13:110156551-110156573 CTGAATCAGCCTGGCTTGGGAGG - Intronic
1113842858 13:113370164-113370186 CTGAGGGAGCCCGGGGTGGCCGG - Intergenic
1114455110 14:22848988-22849010 GTGGAGGAGCCTGGGGAGGGGGG + Intronic
1114542899 14:23475939-23475961 CTGGAGTACCCTGGGGTGGTGGG - Intronic
1118275028 14:64378639-64378661 CTTCAGGAGGCTGGGGTGGGAGG + Intergenic
1118401262 14:65381723-65381745 CTGGAGCAGCCTGGGGTGGGTGG - Intergenic
1118745033 14:68767437-68767459 CTGTAGTAGCCTGGGGAGAAAGG - Intergenic
1119340827 14:73876060-73876082 CTTAAGGAGGCTGAGGTGGGTGG - Intronic
1120417183 14:84234331-84234353 CTTTAGGAGGCTGGGGTGGGCGG - Intergenic
1121054728 14:90843313-90843335 CAGAAGCAGCCTGTGGTGGAAGG - Intergenic
1121288140 14:92752535-92752557 CTGAAATAGCCCTGGGTGGCAGG + Intergenic
1121734013 14:96205475-96205497 CAGAAGCAGGCGGGGGTGGGGGG + Intronic
1122130363 14:99601718-99601740 CTGAAGCAGCCTGTGGTGGGAGG + Intronic
1122216099 14:100205613-100205635 CTGAGGTACACTGGGGTGGTAGG - Intergenic
1122785070 14:104159805-104159827 CTGACGTGGGCTGGGGTCGGTGG + Intronic
1124090461 15:26595146-26595168 CTAAAGATGCCTGGGTTGGGAGG - Intronic
1124376112 15:29129853-29129875 CTGAGGTAGCATGGGGTGCATGG - Intronic
1124490036 15:30150003-30150025 GGGAAGACGCCTGGGGTGGGTGG - Intergenic
1124753496 15:32388324-32388346 GGGAAGACGCCTGGGGTGGGTGG + Intergenic
1124975239 15:34524026-34524048 GGGAAGACGCCTGGGGTGGGTGG + Intergenic
1125618025 15:41033440-41033462 CTCAAGGAGGCTGAGGTGGGAGG - Intronic
1125722982 15:41853953-41853975 CTGAAGCAGGCTGGGGTGGGAGG + Intronic
1125906132 15:43394323-43394345 CTTAAGGAGGCTGAGGTGGGCGG - Intronic
1125954422 15:43779598-43779620 ATGAAGGAGGCTGAGGTGGGTGG - Intronic
1126045196 15:44633220-44633242 CTGTAGTAGGCTGAGGTGGGAGG + Intronic
1127231545 15:57001256-57001278 CTGTAGGAGGCTGAGGTGGGCGG - Intronic
1127640715 15:60913364-60913386 CTGTAGGAGGCTGGGGTGGAGGG - Intronic
1127761859 15:62147265-62147287 CAGAAGCAGCCTGGGTTGGCGGG - Intergenic
1127788765 15:62379716-62379738 CCGAAGGAGGCTGAGGTGGGAGG + Intergenic
1128997419 15:72307050-72307072 GAGTAGAAGCCTGGGGTGGGGGG + Intronic
1129075247 15:72989365-72989387 CTGCAGTAGCATGGGGTGGGGGG + Intergenic
1129616391 15:77101678-77101700 CTGAAGGACCCTGGGGAGGAGGG + Exonic
1131410094 15:92200316-92200338 ATTCAGTAGCCTGGGGTGGGGGG + Intergenic
1131453664 15:92566494-92566516 ATTCAGTAGTCTGGGGTGGGGGG - Intergenic
1132185117 15:99797238-99797260 CGGAAGACACCTGGGGTGGGTGG - Intergenic
1132410636 15:101575855-101575877 CAGTGGTAGCCTGGGGTTGGGGG + Intergenic
1132431871 15:101767317-101767339 CGGAAGACACCTGGGGTGGGTGG + Intergenic
1132596234 16:751748-751770 CAACAATAGCCTGGGGTGGGTGG + Intronic
1132601757 16:775941-775963 CTCAGGGAGCATGGGGTGGGGGG - Intronic
1132678282 16:1129672-1129694 CAGCCGGAGCCTGGGGTGGGGGG - Intergenic
1132744718 16:1431857-1431879 GTGAAGGCGGCTGGGGTGGGAGG - Intergenic
1132827882 16:1914054-1914076 CTGAAGTGGCAGTGGGTGGGTGG - Intronic
1133272673 16:4618145-4618167 CTGAAATGTCCTGGGGTGGGAGG + Intronic
1133305871 16:4808351-4808373 CTTAGGTAGGCTGAGGTGGGTGG + Intronic
1134614109 16:15636576-15636598 TTGAAACAGACTGGGGTGGGAGG + Intronic
1135007609 16:18840949-18840971 CTTAAGAAGGCTGAGGTGGGAGG + Intronic
1135548909 16:23383620-23383642 CTGAGGGAGGCTGAGGTGGGAGG - Intergenic
1135590175 16:23699409-23699431 CAGAAGTAGCCTGGGCTGATTGG + Intronic
1135699415 16:24618736-24618758 CTCAAGGAGGCTGAGGTGGGAGG - Intergenic
1136224989 16:28854182-28854204 CTGTGGGAGGCTGGGGTGGGAGG + Intronic
1136230508 16:28882929-28882951 CTGACCAAGCTTGGGGTGGGTGG - Intronic
1136520875 16:30795013-30795035 CTCCAGTGGCCTGGGGTGGGGGG - Intergenic
1137256826 16:46782390-46782412 CTTTAGGAGCCTGAGGTGGGTGG - Intronic
1137468689 16:48734806-48734828 ATAAAGTAGCCAGGAGTGGGAGG - Intergenic
1139201305 16:64980397-64980419 GTGATGTAGCCTGGGGGGTGAGG + Intronic
1139518511 16:67465941-67465963 CTCAAGGAGCCTGGGGAGGGAGG - Intronic
1139652479 16:68369437-68369459 CAGAAGTGGGCTGGGGTAGGGGG + Intronic
1139964061 16:70735798-70735820 CTGAATCAGCCTGGCTTGGGAGG + Intronic
1140824278 16:78691461-78691483 CTGAAGTAGGCTGAAGTGGGAGG + Intronic
1141176009 16:81719746-81719768 CTTAAGGAGGCTGAGGTGGGAGG - Intergenic
1141944933 16:87303431-87303453 CTACAGCAGCCGGGGGTGGGGGG - Intronic
1142214563 16:88824293-88824315 CTGGGGTAGCCTGGGGCGGCAGG + Intronic
1142249470 16:88984519-88984541 CCGAAGTAGCCACTGGTGGGAGG - Intergenic
1142523623 17:522144-522166 CTGAGGAAGACTGAGGTGGGTGG + Intronic
1142760843 17:2041238-2041260 CTGGAGTGGAGTGGGGTGGGTGG + Intronic
1142839071 17:2613260-2613282 CTGAAGTGGCCAGGGGTGGGTGG - Intronic
1143450188 17:7031695-7031717 CTGAAGTTTCCTGGGGGGAGGGG + Intergenic
1143632248 17:8146074-8146096 CGGAAGGAGCCAGTGGTGGGAGG - Exonic
1144218581 17:13079680-13079702 CAGAAGATGCCTGAGGTGGGTGG - Intergenic
1146189259 17:30750463-30750485 CAGAAGTAAAATGGGGTGGGAGG + Intergenic
1146334148 17:31954765-31954787 CAGAAGTAAAATGGGGTGGGAGG + Intronic
1146419130 17:32665901-32665923 GTGAAGGGGTCTGGGGTGGGTGG + Intronic
1147511631 17:41074551-41074573 CTGAAGTAGCTAGGGGAGGTTGG - Intergenic
1147996207 17:44361800-44361822 GTTAAGTGGCATGGGGTGGGGGG + Intronic
1148043776 17:44729447-44729469 CTGTAGGAGGCTGAGGTGGGAGG - Intronic
1148433680 17:47663874-47663896 ATGGAGGAGGCTGGGGTGGGAGG + Intronic
1149884501 17:60327490-60327512 CTGAGGTGGGGTGGGGTGGGCGG - Intronic
1150073609 17:62173402-62173424 CTGAAGAAGCCTGGGCGGGTTGG - Intergenic
1150289042 17:63971282-63971304 CTGTCAGAGCCTGGGGTGGGTGG + Intronic
1150442719 17:65204150-65204172 CAGGAACAGCCTGGGGTGGGAGG - Exonic
1151084027 17:71360555-71360577 GGGAAGTTGACTGGGGTGGGTGG - Intergenic
1151623615 17:75262484-75262506 CTGAGTTAGCCTGGGAGGGGGGG - Exonic
1152039011 17:77891176-77891198 CTTAAGTAGATTGGGATGGGAGG + Intergenic
1152454158 17:80403343-80403365 CTGAAGTAACGGGGGGGGGGGGG - Intergenic
1152892519 17:82890613-82890635 CTGGAGGAGCCTGGCGTGAGTGG + Intronic
1153018770 18:607803-607825 CTCAAGGAGGCTGAGGTGGGAGG - Intronic
1153569444 18:6454116-6454138 CTTTGGGAGCCTGGGGTGGGTGG - Intergenic
1154985283 18:21545176-21545198 CTTAAGGAGGCTGAGGTGGGAGG - Intronic
1155447332 18:25926001-25926023 CTAAAGGAGGCTGAGGTGGGAGG - Intergenic
1155530334 18:26760217-26760239 ATGAATTAGGCAGGGGTGGGGGG - Intergenic
1156499339 18:37547267-37547289 CTGGAGCAGCCTTGGGTGGACGG + Intronic
1157293385 18:46425380-46425402 CTGGGGTAGCCCCGGGTGGGTGG + Intronic
1157585375 18:48797644-48797666 CTGTGGTATTCTGGGGTGGGGGG + Intronic
1158050000 18:53205621-53205643 CTGCAGTGGCCTGGCGTGTGTGG + Intronic
1158349255 18:56548434-56548456 CTCAGGGAGCCTGAGGTGGGCGG - Intergenic
1158662242 18:59398674-59398696 AAGAAATAGCCTGGGGTTGGAGG + Intergenic
1158783850 18:60685315-60685337 CCGGAGTGGCCTGGGGTGGCTGG - Intergenic
1159531232 18:69658058-69658080 CCTCAGTAGGCTGGGGTGGGAGG - Intronic
1159599712 18:70417265-70417287 CTTCAGGAGCCTGAGGTGGGTGG + Intergenic
1160592870 18:79953490-79953512 CTGATGTAGACTGGGGGTGGGGG - Intergenic
1160600740 18:80010793-80010815 AGAAAGCAGCCTGGGGTGGGGGG - Intronic
1161093773 19:2377005-2377027 CTGGAGTGGCCACGGGTGGGCGG + Intergenic
1161285675 19:3467218-3467240 CAGAATGAGACTGGGGTGGGGGG - Intronic
1162333082 19:10042426-10042448 CTGCAGTGGCCTGGTGTGAGAGG - Intergenic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162521767 19:11185052-11185074 CTGAAGTAGACTGGGCGTGGTGG - Intronic
1162920166 19:13896797-13896819 CTTGAGTGGCCTGAGGTGGGAGG - Intronic
1163132721 19:15285822-15285844 CTTAAATGGCCAGGGGTGGGTGG + Intronic
1163288195 19:16362630-16362652 CTGTAGGAGGCTGAGGTGGGAGG - Intronic
1163312541 19:16522812-16522834 CTGAAGCTCCCTGTGGTGGGAGG + Intronic
1163520423 19:17788389-17788411 CTCAGGGAGGCTGGGGTGGGAGG - Exonic
1163543130 19:17923770-17923792 CTTTAGGAGGCTGGGGTGGGCGG - Intergenic
1163626844 19:18395126-18395148 CTTAAGGAGGCTGAGGTGGGCGG + Intronic
1163730893 19:18948682-18948704 CAGAAGGAGCGTGGGATGGGGGG - Intergenic
1164157193 19:22603897-22603919 CTGCAGTTGCCTGGGCTGGACGG - Intergenic
1164464359 19:28475043-28475065 CTGAGGGAGCAGGGGGTGGGCGG - Intergenic
1164837655 19:31367925-31367947 TTGAAGGAGGCTGAGGTGGGAGG - Intergenic
1164949452 19:32324273-32324295 CTCTAGGAGGCTGGGGTGGGTGG + Intergenic
1165326671 19:35118110-35118132 CTGAGGGAGGCCGGGGTGGGTGG + Intronic
1165595395 19:37008198-37008220 CAGGAGTTGCCTGGGGCGGGCGG + Intronic
1165638091 19:37360737-37360759 CTTAAGGAGGCTGAGGTGGGAGG - Intronic
1165898101 19:39155431-39155453 CTGACCCAGCCTGGGGTGGCAGG + Intronic
1165950192 19:39469981-39470003 CTAAGGTAGTCTGGGGTGGGTGG + Intronic
1167296242 19:48651866-48651888 CTGACCCAGCCTGGGGGGGGGGG - Intergenic
1167314410 19:48755396-48755418 CTGAAATAACCTGGGGGGAGGGG - Intergenic
1167358794 19:49019155-49019177 CTGAAGTTCCCTGGCGTGGGTGG - Intergenic
1167366485 19:49057403-49057425 CTGAAGTTCCCTGGCGTGGGTGG - Exonic
1167808292 19:51805673-51805695 CTGAAGTAGCCTCGCTTGGTTGG + Intronic
925061376 2:893473-893495 CTGCAGCAGCCTCGGGTGGGAGG - Intergenic
925061385 2:893518-893540 CTCCAGCAGCCTGGGGTGGGAGG - Intergenic
925061399 2:893567-893589 CTGTAGCAGCCTCGGGTGGGAGG - Intergenic
925061408 2:893609-893631 CTGCAGCAGCCTTGGGTGGGAGG - Intergenic
925747126 2:7052722-7052744 CTGTTGTAACATGGGGTGGGGGG + Intronic
925989782 2:9245324-9245346 CTGGAGACACCTGGGGTGGGTGG + Intronic
926103012 2:10132632-10132654 CTGAAGTATTTTGGGGTGGATGG + Intergenic
927681178 2:25140370-25140392 CTTAACTAGCCTGGGTTGGCTGG + Intronic
927864522 2:26580141-26580163 CTGAAGGAGTCTGTGGAGGGCGG + Intergenic
928068234 2:28188334-28188356 CTGATTTACTCTGGGGTGGGCGG + Intronic
929585407 2:43110869-43110891 CTGAAGTGGACTGGGCTGAGAGG + Intergenic
929994517 2:46817041-46817063 CTGGTGTAGCCAGGGGTGGCAGG + Intronic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931252465 2:60545478-60545500 CTGAAGTAGAGTGGGCTGGCAGG - Intronic
931586786 2:63838571-63838593 TTGCAGAAACCTGGGGTGGGGGG - Intergenic
932021792 2:68094899-68094921 CTGAAGTGGCCTGGAGGGTGCGG + Intronic
932076542 2:68669643-68669665 CTGGGGTAGGCTGAGGTGGGTGG - Intergenic
932497524 2:72153748-72153770 CTGAAGCTGCAAGGGGTGGGGGG - Intergenic
934942023 2:98509655-98509677 CAGGAGCAGCCTGGGGTGGGCGG - Intronic
935402158 2:102671348-102671370 ATAAATAAGCCTGGGGTGGGAGG + Intronic
936596844 2:113856341-113856363 CCTAAGTAGCCTGGGGTGGTAGG + Intergenic
936938284 2:117858999-117859021 CTGCAGTGGGCGGGGGTGGGCGG - Intergenic
937136126 2:119555047-119555069 CTGAAGCAGCATGGGATTGGGGG + Intronic
937303373 2:120856787-120856809 CTGAAGAAGCCTCGTGTGGCTGG + Intronic
937650752 2:124316275-124316297 GAGAACTAGCCTGGGGTCGGAGG + Intronic
938364046 2:130720100-130720122 CTTAAGGAGGCTGAGGTGGGTGG - Intergenic
938508936 2:131919499-131919521 CTGTAGTTGCCTGAGCTGGGTGG - Intergenic
938765759 2:134459743-134459765 CAGGAGGAGCCTGGGGAGGGGGG - Intronic
940667150 2:156622491-156622513 CACAATTAGCATGGGGTGGGGGG + Intergenic
942850589 2:180480272-180480294 GTGAATCAGCCTGGGTTGGGGGG - Intergenic
942919513 2:181354487-181354509 CTGAAGTAGTCTGGTATGGTTGG - Intergenic
944517678 2:200528527-200528549 GTGGAGTAGGTTGGGGTGGGGGG + Intronic
944612108 2:201421552-201421574 CAGATGTCCCCTGGGGTGGGGGG + Intronic
944703997 2:202270654-202270676 CTGCAGGAGGCTGAGGTGGGAGG + Intronic
944723551 2:202447446-202447468 CTGTGGGAGCCTGAGGTGGGAGG + Intronic
946179819 2:217942602-217942624 CTGAAGCTGCCTGGGGTGGGTGG - Intronic
946471974 2:219969005-219969027 CTGAAGGACCCTGGGGCGTGTGG - Intergenic
948388030 2:237593770-237593792 GTGAAGTCACCTGGGCTGGGGGG - Intronic
1168800592 20:641926-641948 GTGGAGTTGCCTGGGGGGGGAGG + Intergenic
1168800749 20:642249-642271 GTGGAGTTGCCTGTGGTGGGGGG + Intergenic
1168903837 20:1388731-1388753 CAGAAGGAGCGTGGGTTGGGGGG + Intronic
1169419410 20:5447769-5447791 TGGAAGTAGCCTTGGGAGGGAGG - Intergenic
1169454093 20:5736931-5736953 CTGTGGGAGCCTGAGGTGGGAGG + Intergenic
1169461409 20:5798859-5798881 CTGAGGGAGGCTGAGGTGGGCGG - Intronic
1169750702 20:8990463-8990485 CTTAGGGAGGCTGGGGTGGGAGG + Intergenic
1169879575 20:10331881-10331903 CTCAAGGAGGCTGAGGTGGGTGG - Intergenic
1170262765 20:14429816-14429838 CTGAAGGAGGCTGGGGAGGCAGG - Intronic
1170926637 20:20730687-20730709 ATGAAGGAGGCTGAGGTGGGAGG + Intergenic
1171508804 20:25662474-25662496 GAGAAGTAGGGTGGGGTGGGAGG + Intergenic
1172185927 20:33031050-33031072 CTGAAAAGGTCTGGGGTGGGAGG + Intergenic
1172554179 20:35826437-35826459 CTGAAATAACCAGGGTTGGGTGG + Intronic
1172699757 20:36845825-36845847 CTGAAGGAGCTGGGGGTGGGGGG + Intronic
1172708271 20:36899563-36899585 CTGATGTAGCCTAGGGTGCCCGG + Intronic
1172775022 20:37402317-37402339 CTGAAGAAGTGTGGGGAGGGTGG + Intronic
1172838042 20:37885601-37885623 GGGAAGCAGCATGGGGTGGGGGG - Intergenic
1172976837 20:38912422-38912444 CTGAGGGAGGCTGAGGTGGGAGG + Intronic
1173920654 20:46742449-46742471 CTGAAGTGGCCAGTGGAGGGAGG - Intergenic
1175076122 20:56375231-56375253 CGGAAGGAGGCTGAGGTGGGAGG - Intronic
1175974266 20:62702455-62702477 CTGAAGTGGGCTGGGGAGGTGGG - Intergenic
1177448913 21:21239278-21239300 CTGAAGATGGCTGTGGTGGGAGG - Intronic
1177698834 21:24610104-24610126 CTTAAGGAGGCTGAGGTGGGTGG - Intergenic
1178103736 21:29297572-29297594 CTGAGGCAGCCTGGGATGCGAGG + Intronic
1178295762 21:31408994-31409016 CTGATGAAGCCTGGAGGGGGGGG - Intronic
1178613426 21:34108202-34108224 CTGAAGTTGCTTTGGGTGAGTGG - Intronic
1178923734 21:36758349-36758371 CTTCAGGAGCCTGAGGTGGGTGG - Intronic
1179540460 21:42080076-42080098 GTGAAGGCGCCTGTGGTGGGCGG + Intronic
1179962411 21:44776107-44776129 GTGAAGTGGCCGGGGGTGGGGGG + Intronic
1180147470 21:45929373-45929395 ATGAGGTGACCTGGGGTGGGGGG - Intronic
1180212242 21:46301945-46301967 CTGAGGAAGCCTGGGGGTGGAGG + Exonic
1180853150 22:19031478-19031500 CTAATGTAGCCTGGAGGGGGTGG - Intergenic
1181307916 22:21927456-21927478 CTGGAGTGGGCTGGGGTGTGTGG - Intronic
1181498139 22:23299806-23299828 CTGAAGTTCCCAGGGGTGGCTGG + Intronic
1182058869 22:27382441-27382463 CTGACCCAGCCTGGGGTTGGGGG - Intergenic
1182622462 22:31625614-31625636 CTGGAGGAGCCTGGCCTGGGGGG - Intronic
1182651865 22:31858273-31858295 TGGGAGTATCCTGGGGTGGGGGG + Intronic
1183300689 22:37057606-37057628 CAGAAGAACCCTGGGGTTGGGGG - Intronic
1184651682 22:45922200-45922222 CTGAGGCAGCCTGGGGTTGATGG - Exonic
1184830576 22:46983601-46983623 CTGGAGTAACCTGGGATGTGAGG + Intronic
1184874368 22:47263948-47263970 CTGAAGTTGGCTGGGCTGGGAGG - Intergenic
1185137729 22:49082198-49082220 CTCACGCAGCCTCGGGTGGGAGG - Intergenic
1185411929 22:50687234-50687256 CTGACACAGCCTGGGGTGGAGGG - Intergenic
949945268 3:9185003-9185025 TTGAACTAGTCTGGGGAGGGAGG - Intronic
950171904 3:10844513-10844535 CTGAACTGTCCTGAGGTGGGCGG - Intronic
950200357 3:11037945-11037967 CGGCAGCAGCTTGGGGTGGGTGG - Exonic
953891412 3:46754279-46754301 CTGACACAGCCTGGAGTGGGAGG - Intronic
953896896 3:46809947-46809969 CTGACACAGCCTGGAGTGGGAGG - Intronic
954198987 3:49013107-49013129 CTCAAGGACCCTGGGGTGGGAGG + Exonic
954199413 3:49015285-49015307 CTGAGGTATCCTGCGGTGGCTGG + Exonic
955400475 3:58587584-58587606 CACAAGTATCGTGGGGTGGGTGG + Intronic
955749327 3:62171580-62171602 CTGAGGTTGCCTGGGGTTGAGGG - Intronic
955954500 3:64274807-64274829 CTCTAGGAGGCTGGGGTGGGTGG + Intronic
955993872 3:64657947-64657969 ATTAAGTAGCCTGGGGAGTGAGG - Intronic
957202795 3:77158700-77158722 CTGAATTGCCCTGGGGTTGGTGG + Intronic
959700895 3:109298336-109298358 CTCAGGGAGCCTGAGGTGGGAGG + Intronic
959951718 3:112185936-112185958 CAGCAGTAGCTTGGGGTGGTGGG + Intronic
960011378 3:112837456-112837478 TAGAAGCAGTCTGGGGTGGGAGG - Intronic
960914606 3:122682687-122682709 CTGGAGCAGCCTGGGGGTGGAGG - Intronic
961021971 3:123515486-123515508 CTGGAACAGCCTTGGGTGGGAGG + Intronic
961210142 3:125119318-125119340 CTGGAGGAGGCTGGGGTGTGAGG - Intronic
961796224 3:129411051-129411073 CTGCAGAACCCTGGGGAGGGGGG - Intronic
961941970 3:130647185-130647207 CTGAAGAAGCCTAGGCTGGATGG - Intronic
962079061 3:132117701-132117723 CTCCAGTAGGGTGGGGTGGGGGG + Intronic
962795447 3:138845856-138845878 ATGAAGGAGGCTGGGCTGGGTGG - Intergenic
963051610 3:141148121-141148143 CTGATGTGTCCTGGGTTGGGGGG + Exonic
964124195 3:153218716-153218738 TTGAAGTAGGCTGGGGAAGGGGG + Intergenic
964209514 3:154211502-154211524 CTGTAGGAGACGGGGGTGGGTGG + Intronic
964524500 3:157603742-157603764 CTGAAGGAGGCTCAGGTGGGAGG + Intronic
964729016 3:159845200-159845222 CTGCATTAGCCTGCAGTGGGTGG - Intronic
965177769 3:165357861-165357883 CTGCGGAAGCCTGAGGTGGGTGG - Intergenic
966080154 3:175990141-175990163 CTTCAGGAGTCTGGGGTGGGAGG + Intergenic
966974586 3:185072894-185072916 CTGAAGTAGACTGGTCTGGGAGG - Intergenic
967062645 3:185885800-185885822 CTGTGGTAGCCTGGGGCTGGGGG - Intergenic
968046672 3:195627977-195627999 GTCAGGTAGCCTAGGGTGGGAGG + Intergenic
968558264 4:1261430-1261452 AGGAAGAAGCCTGGGGTGGCGGG + Intergenic
968914271 4:3490374-3490396 CTGAATGAGCAGGGGGTGGGGGG - Intronic
969561321 4:7950201-7950223 GAAGAGTAGCCTGGGGTGGGCGG - Intergenic
969613481 4:8239709-8239731 CAGACTCAGCCTGGGGTGGGAGG - Intronic
969621066 4:8279102-8279124 CCAAAGGAGCCTGGGGTGTGGGG + Intronic
969962515 4:10959519-10959541 CTGAAGTAGCATGTGGCTGGAGG - Intergenic
970243029 4:14029253-14029275 CTCAGGTAGCATGGGTTGGGAGG - Intergenic
972436863 4:39043771-39043793 TTGTGGTAGCCTGGGGTGGCTGG - Intergenic
973601541 4:52547524-52547546 CTTTAGGAGCCTGAGGTGGGCGG + Intergenic
973746482 4:53968222-53968244 CTGAAGCATTCTGAGGTGGGAGG + Intronic
975740321 4:77423311-77423333 AAGAACTTGCCTGGGGTGGGGGG - Intronic
976688251 4:87839914-87839936 CTTGAGGAGCCTGGGGAGGGAGG - Intronic
977582044 4:98735988-98736010 CTGCTGGAGCCTGGGGTGGTGGG - Intergenic
978071779 4:104481284-104481306 CTGTAGGAGGCTGGGGTGGGCGG + Intronic
978801505 4:112760042-112760064 GTCAAGGAGCCTGGGGTAGGGGG - Intergenic
978815050 4:112894729-112894751 CTGAAATAGCCAGGGGATGGTGG - Intronic
980903071 4:138923478-138923500 CTGATCTGGCATGGGGTGGGAGG - Intergenic
982203177 4:152977549-152977571 CTGAGGGAGGCTGAGGTGGGAGG - Exonic
982239238 4:153282139-153282161 CTGGTGCGGCCTGGGGTGGGTGG - Intronic
984604135 4:181764936-181764958 CTTTAGGAGCCTGAGGTGGGAGG - Intergenic
985125470 4:186689710-186689732 TTGAATTAGCCTGGTGTGGGTGG - Intronic
985569745 5:638547-638569 CCGTAGCAGCATGGGGTGGGGGG + Intronic
985585032 5:726713-726735 CTGCAGTAGCCATTGGTGGGTGG + Intronic
985598536 5:811028-811050 CTGCAGTAGCCATTGGTGGGTGG + Intronic
985744963 5:1641206-1641228 GTCAGGTAGCCTAGGGTGGGAGG - Intergenic
985875780 5:2592744-2592766 TCCAAGTATCCTGGGGTGGGGGG + Intergenic
985984783 5:3505602-3505624 CTGAAGCAGGCTGAGCTGGGTGG + Intergenic
986787813 5:11130962-11130984 CTGCAGTGGCGTGTGGTGGGTGG - Intronic
987386214 5:17332049-17332071 CTTTGGGAGCCTGGGGTGGGTGG + Intergenic
987717208 5:21587256-21587278 CTGAAGTATCCTGGTGGGTGCGG - Intergenic
987741667 5:21916665-21916687 CTGGAGTGGCCTGGAGTGGCTGG + Intronic
988367829 5:30324315-30324337 ATGAAGTAGGCTGGGGTGTGAGG - Intergenic
990569716 5:57066018-57066040 CTGCAGGAGGCTGAGGTGGGAGG - Intergenic
991989176 5:72320452-72320474 TTGGTGTATCCTGGGGTGGGAGG + Exonic
992381595 5:76242787-76242809 CTTTAGGAGCCTGAGGTGGGAGG + Intronic
992802389 5:80305283-80305305 CTTCAGGAGCCTGAGGTGGGCGG - Intergenic
992992777 5:82301304-82301326 CTGTAGTTGCCTGGGGTTGAGGG + Intronic
993052624 5:82943501-82943523 CTGCAGGAGGCTGAGGTGGGTGG + Intergenic
997475924 5:134142433-134142455 CAGAAGTAGGAGGGGGTGGGTGG + Intronic
997581353 5:135019403-135019425 CGGAGGTAGGCTGGGCTGGGTGG + Intergenic
997651672 5:135526404-135526426 CTGAGGTAGGCTGAGGTGGGAGG + Intergenic
998006802 5:138662431-138662453 CTTTGGTAGGCTGGGGTGGGAGG + Intronic
998284253 5:140843014-140843036 CTGCTGGAGCCTCGGGTGGGTGG + Exonic
999201387 5:149818992-149819014 CAGAAATAGCCTGAGTTGGGGGG - Intronic
999540455 5:152566078-152566100 TTGGAGTAGGCTGGGGTGGGTGG - Intergenic
1000087623 5:157901847-157901869 ATGATGTAGCCAGGGGTGTGTGG - Intergenic
1000139229 5:158385259-158385281 ATGAAGTAGCCTGGCCTGAGAGG + Intergenic
1000456472 5:161455636-161455658 CTGGAGGAGGCTGAGGTGGGAGG - Intronic
1001210634 5:169807153-169807175 CTGAATTGGTCTGGGGTGGGTGG + Intronic
1001238067 5:170046389-170046411 CTGCAGAAGCCTGGGTTTGGCGG + Intronic
1002067532 5:176659572-176659594 GTGAGGGAGCCTGGGGTGGCTGG + Intergenic
1003431572 6:6043423-6043445 TGGAAGTAGCCTGGGGTAGAGGG + Intergenic
1003458097 6:6302599-6302621 CAGAAGTAGCCCTGGGTGAGTGG + Intronic
1004657581 6:17678835-17678857 CTCAAGGAGGCTGAGGTGGGAGG + Intronic
1005582745 6:27249893-27249915 CTGAAGGAGGCTGGGGTGAGAGG - Intronic
1006020367 6:31114338-31114360 GAGAGGTGGCCTGGGGTGGGGGG + Intergenic
1006183822 6:32169280-32169302 CTGAAGAAGCCTGGGGGCGGTGG - Exonic
1007409392 6:41653241-41653263 GTGAAATAGCCGGGGGTGTGGGG - Intronic
1007411945 6:41669355-41669377 CAGTAGTTGCCTGGGGTTGGAGG + Intergenic
1007738271 6:43995328-43995350 GTGAACTGGCCTGGGGTGGGTGG - Intergenic
1008184726 6:48374607-48374629 CTGAGGTGGCATGGGGTGGTTGG + Intergenic
1008234360 6:49026186-49026208 CTGTCACAGCCTGGGGTGGGAGG - Intergenic
1008650420 6:53555746-53555768 CTGATGGAGCCTGTGATGGGAGG + Intronic
1008949383 6:57138846-57138868 CTTAAGGAGGCTGAGGTGGGAGG - Intronic
1012366076 6:98442725-98442747 TTGGAGTAGGCTGAGGTGGGTGG - Intergenic
1013164705 6:107579235-107579257 CAGAAGCTGCCTGGGGTGTGAGG + Intronic
1013226120 6:108120206-108120228 CTGAAGTAAATAGGGGTGGGGGG + Intronic
1015560082 6:134504634-134504656 CTCAAGGAGGCTGAGGTGGGAGG + Intergenic
1015931306 6:138362769-138362791 CTGTAGGAGGCTGAGGTGGGAGG - Intergenic
1016141545 6:140618013-140618035 CTCAAGGAGGCTGGGATGGGAGG - Intergenic
1016493984 6:144638827-144638849 CTCAAGGAGGCTGAGGTGGGAGG + Intronic
1017937321 6:159017069-159017091 CATAACTATCCTGGGGTGGGAGG + Intergenic
1018949305 6:168368850-168368872 AATAAGGAGCCTGGGGTGGGGGG - Intergenic
1019304088 7:324334-324356 CTGGGGGAGGCTGGGGTGGGAGG - Intergenic
1019622305 7:1998589-1998611 CTGGAACAGCCTGGGGTGGGTGG - Intronic
1019797513 7:3062825-3062847 CTGCAGGAGCCTGGAGTAGGTGG + Intergenic
1019971988 7:4548843-4548865 GTGAATTAACCTGGGGAGGGTGG - Intergenic
1019992153 7:4699609-4699631 CTGTGGAAGCCTGAGGTGGGTGG - Intronic
1020657001 7:10940176-10940198 CTGAAGGACCCTTGGCTGGGAGG + Exonic
1024100798 7:46030733-46030755 CTGAGGAACCCTGGGGAGGGTGG + Intergenic
1024615678 7:51109518-51109540 CAGGGGTAGCCAGGGGTGGGGGG - Intronic
1024726411 7:52201467-52201489 CTCAAGTTGGCTGAGGTGGGTGG - Intergenic
1025099718 7:56124348-56124370 CTGAAGTAGTCTAGGGGGGCAGG - Intergenic
1025104256 7:56157903-56157925 CTGAGGTAGGCAGGGGTAGGGGG - Intergenic
1025238493 7:57251594-57251616 CTTTAGGAGCCTGAGGTGGGCGG - Intergenic
1025928381 7:65976686-65976708 CTTGAGGAGGCTGGGGTGGGAGG + Intronic
1025970033 7:66314402-66314424 CTGCAGGAGGCTGAGGTGGGAGG + Intronic
1026584587 7:71646048-71646070 CTGATGGAACCTGGGGAGGGAGG - Intronic
1026653577 7:72236924-72236946 TTGAAGGAGCCTGCAGTGGGAGG + Intronic
1026741066 7:72978908-72978930 CTTTAGGAGCCTGAGGTGGGTGG - Intergenic
1027102667 7:75386170-75386192 CTTTAGGAGCCTGAGGTGGGTGG + Intergenic
1027981235 7:85225478-85225500 CTGGAGTGGCCTGGTGTGTGGGG + Intergenic
1029484112 7:100828847-100828869 CTGAAGTAGAAGGGGGTTGGTGG - Intronic
1029577309 7:101411991-101412013 CTCAAGTGTCCTGGGGAGGGAGG + Intronic
1031627216 7:124004961-124004983 CTGAGTTAACCTGGGGTGGAAGG - Intergenic
1032265649 7:130368282-130368304 CTGGTGTGGCCTGGGGTGGGTGG + Intronic
1034172817 7:149075948-149075970 CTGAAGTAGACTGGGCATGGTGG - Intronic
1034514943 7:151569156-151569178 CTCAAATAGGCTGAGGTGGGAGG - Intronic
1035100950 7:156396174-156396196 TTGGAGGAGCCTGGGGTGGGGGG - Intergenic
1035271770 7:157724078-157724100 CTGAAGTGTGCTGGTGTGGGTGG + Intronic
1035310420 7:157964328-157964350 ATGAATTAGCCTGGGGGGTGGGG - Intronic
1035488415 7:159250187-159250209 CTGGAGAAGCCTAGGGTAGGTGG + Intergenic
1037859371 8:22393778-22393800 CTGAGGAGGCCTGAGGTGGGAGG - Intronic
1038208140 8:25488818-25488840 GTGGAGTAGAATGGGGTGGGGGG + Intronic
1039813258 8:41068893-41068915 CTGTAGGAGTCTGAGGTGGGAGG - Intergenic
1039939584 8:42078262-42078284 CTTTAGGAGTCTGGGGTGGGAGG - Intergenic
1040580829 8:48697400-48697422 CTGAGGTATCCTGGGGTTGGGGG - Intergenic
1041670950 8:60491508-60491530 CTGGAGCAGCCTGGGTTGGCTGG - Intergenic
1042605243 8:70539357-70539379 CTAAAGGAGCCTGAGGTGGGAGG + Intergenic
1042893302 8:73636617-73636639 CTTTGGTAGGCTGGGGTGGGTGG + Intronic
1043674295 8:82930845-82930867 CTTTAGGAGCCTGAGGTGGGCGG - Intergenic
1044369662 8:91394152-91394174 CTGAGGTGGGGTGGGGTGGGGGG - Intronic
1045027722 8:98104372-98104394 AAGAAGTAGCCTGGGCAGGGTGG - Intronic
1045441402 8:102215834-102215856 CTTAAGGAGGCTGAGGTGGGAGG + Intronic
1047482786 8:125300756-125300778 CTGATGTAGCCTGGGGAGAGAGG + Intronic
1048979505 8:139695611-139695633 CTGAAGGAGCCTGGAGTCTGAGG - Intronic
1049414571 8:142489279-142489301 CAGGAGGAGCCTGGGCTGGGAGG + Intronic
1049851383 8:144832952-144832974 TTGAAGTAGGCCGAGGTGGGCGG + Intronic
1050308961 9:4333739-4333761 ATGAAGTTGCGGGGGGTGGGGGG - Intronic
1050615857 9:7401085-7401107 ATGCATTTGCCTGGGGTGGGAGG - Intergenic
1051178758 9:14388264-14388286 ATGGAGGAGGCTGGGGTGGGAGG + Intronic
1051594312 9:18809099-18809121 ATGAAGTAGCAGGGGCTGGGGGG + Intronic
1053293645 9:36898483-36898505 CAGAAGGAGCCTGTGATGGGAGG - Intronic
1053365142 9:37517599-37517621 CTCAAACAGCCTGGGGTGGGAGG + Intronic
1056268134 9:84920241-84920263 CTGAAGTAGTCTTAGGTTGGGGG + Intronic
1057385636 9:94603721-94603743 CAGATGCAACCTGGGGTGGGAGG - Intronic
1057490919 9:95518725-95518747 TTGAAGTGGCCTGGGCAGGGAGG + Intergenic
1057518004 9:95737939-95737961 CTGAACTAGGCTGGGCTCGGTGG - Intergenic
1057873059 9:98732540-98732562 CTGACGTAGCCATGGTTGGGTGG - Exonic
1058468325 9:105251198-105251220 CTGAAAAAGCCGGGGGTGAGGGG - Intronic
1059737568 9:117117626-117117648 CTGCAGTACCATGGGGTAGGGGG - Intronic
1060537678 9:124404131-124404153 CTTTAGGAGCCTGAGGTGGGAGG - Intronic
1060614079 9:124995596-124995618 CTCAAGGAGGCTGAGGTGGGAGG - Intronic
1060749915 9:126162385-126162407 GAGGAGGAGCCTGGGGTGGGTGG + Intergenic
1062098942 9:134717991-134718013 GAGAAGCAGCCTGGGCTGGGGGG + Intronic
1062425293 9:136503443-136503465 GTGAGGCAGCCTGGGGTGGTGGG + Intronic
1062495115 9:136827983-136828005 CTGAAATGGCCTCGGGAGGGAGG - Intronic
1203610310 Un_KI270748v1:90248-90270 CTGTAGGAGGCTGAGGTGGGAGG + Intergenic
1186584070 X:10852548-10852570 CTGAAGGAGCCTGGGGTCCCAGG + Intergenic
1187538853 X:20170509-20170531 CTTAAGTAGGCTGAGGAGGGAGG - Intronic
1188328772 X:28842239-28842261 CTGAAGTAACCAGAGTTGGGAGG + Intronic
1189461239 X:41244721-41244743 CTGTAGGAGGCTGAGGTGGGCGG + Intergenic
1189467537 X:41288730-41288752 CTGTAGGAGCCTGGGGCTGGGGG + Intergenic
1189910224 X:45803778-45803800 CAGAAGTTGGTTGGGGTGGGTGG - Intergenic
1190365418 X:49689095-49689117 CTTTAGTAGGCTGAGGTGGGTGG + Intronic
1190752774 X:53376552-53376574 ATGAAGATTCCTGGGGTGGGGGG - Exonic
1190802754 X:53807137-53807159 CTTTAGGAGGCTGGGGTGGGTGG + Intergenic
1190909818 X:54760584-54760606 CTGTTGTAGCATGGGGCGGGGGG - Intronic
1192364043 X:70455961-70455983 CTGAAGGAGCATGGGGGGAGGGG - Intronic
1194635717 X:96343062-96343084 CTGAACTGACCTGGGGTGGAAGG - Intergenic
1196417187 X:115483963-115483985 ATGAAGGAGGCTGAGGTGGGAGG + Intergenic
1196887496 X:120262044-120262066 CTGTAGGAGGCTGAGGTGGGTGG + Intronic
1198743292 X:139863816-139863838 CTGTAGGAGGCTGAGGTGGGTGG + Intronic
1199736973 X:150693824-150693846 CTGAGGTTTCCGGGGGTGGGGGG - Intronic
1200009903 X:153113055-153113077 CTGTGGGAGGCTGGGGTGGGAGG + Intergenic
1200029697 X:153286867-153286889 CTGTGGGAGGCTGGGGTGGGAGG - Intergenic
1200058456 X:153473496-153473518 CTTTAGTGGCCAGGGGTGGGGGG - Intronic
1200079247 X:153567432-153567454 CTGCCCAAGCCTGGGGTGGGGGG + Intronic
1200796647 Y:7346999-7347021 CTGCAGTAGGCTGAGGTGGGAGG + Intergenic