ID: 904046181

View in Genome Browser
Species Human (GRCh38)
Location 1:27610028-27610050
Sequence GTGACCCGCCTGTAATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904046181 Original CRISPR GTGACCCGCCTGTAATCTCA GGG Intergenic
900630716 1:3633746-3633768 GTCTCCCGTCTGTAATCACAGGG - Intronic
901614937 1:10531148-10531170 GTGCTCTGCCTGGAATCTCAAGG + Intronic
904046181 1:27610028-27610050 GTGACCCGCCTGTAATCTCAGGG + Intergenic
905658681 1:39703010-39703032 GTGACCTGCCTGAAGTCACATGG - Intronic
912496616 1:110095751-110095773 GTGACCAGCCTCTATGCTCAAGG - Intergenic
914343144 1:146776971-146776993 GGGACCAGGCTGTAATGTCATGG + Intergenic
919376648 1:196802938-196802960 GTGACCCGCCCATATTATCAAGG - Intergenic
1066276155 10:33870750-33870772 GTGGCTCCCCTGTATTCTCACGG - Intergenic
1069479543 10:68769106-68769128 GGCACACGCCTGTAATCCCAGGG - Intronic
1069974991 10:72205842-72205864 GTCTCACGCCTGTAATCCCAGGG + Intronic
1070947779 10:80407876-80407898 GGCTCACGCCTGTAATCTCAGGG - Intronic
1076231960 10:128827563-128827585 GTGACCCCCATGTAATCTCAAGG - Intergenic
1077824490 11:5790132-5790154 GTGACCCACCTGTCACTTCAGGG + Intronic
1083641667 11:64148990-64149012 GGTACCCGCCTGGAATCCCAGGG - Intronic
1084561282 11:69906686-69906708 GTGACCTGCCTGTGGTCACAGGG - Intergenic
1097698867 12:62800627-62800649 GTGCCCGGCCTGTAATCTCCAGG + Intronic
1098821916 12:75243064-75243086 GTGACCCCACCCTAATCTCATGG + Intergenic
1103199209 12:119072780-119072802 GTGAAGTGCCTGGAATCTCAGGG - Intronic
1106144125 13:27036622-27036644 GCAACCAGCCTGGAATCTCAGGG - Intergenic
1115559466 14:34570199-34570221 GGCACATGCCTGTAATCTCAAGG - Intronic
1121543105 14:94743240-94743262 GGCACCCGCCTGTAATCTGGAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1135398603 16:22149881-22149903 GTGACCCACCTGCAAGCTCAGGG + Exonic
1138814554 16:60189123-60189145 GTGACCTATGTGTAATCTCAGGG - Intergenic
1138989756 16:62376843-62376865 GGCACACGCCTGTAATCCCAAGG - Intergenic
1139569845 16:67804955-67804977 GCCACCGGCCTGTCATCTCAGGG - Intronic
1139990847 16:70938357-70938379 GGGACCAGGCTGTAATGTCATGG - Intronic
1140350803 16:74260475-74260497 GGTGCACGCCTGTAATCTCAGGG + Intergenic
1140492412 16:75349242-75349264 GGGTCACACCTGTAATCTCAAGG + Intronic
1142227964 16:88886594-88886616 GTGAGCCGCCTGTAGGCCCAGGG - Intronic
1144579798 17:16452026-16452048 GCGCCCGGCCTGGAATCTCAGGG + Intronic
1144856166 17:18269207-18269229 GAGACCAGCTTGTAATCCCAGGG - Intergenic
1147414152 17:40276394-40276416 GGTGCCTGCCTGTAATCTCAGGG + Intronic
1148493874 17:48040337-48040359 GGGTCACACCTGTAATCTCAGGG - Intergenic
1152073545 17:78145658-78145680 GTGACCCTCATGTAATCACTGGG - Intergenic
1152248412 17:79198423-79198445 GTGTCCCGCCTGCCAGCTCATGG + Intronic
1154257637 18:12797856-12797878 GGGACCTGCCTGTAGTCTTAAGG - Intronic
1158700558 18:59742078-59742100 GTGACCCACCTATAATATAAAGG - Intergenic
1163205522 19:15799831-15799853 GTGGCACGCCTGTAATTCCAGGG - Intergenic
1166903934 19:46090627-46090649 GTTGCCCGGCTGGAATCTCATGG + Intergenic
926547755 2:14262901-14262923 GTGTCCCCACTGAAATCTCATGG - Intergenic
931700580 2:64905687-64905709 GTGGCCTGCCTGATATCTCAGGG - Intergenic
938932917 2:136102529-136102551 GTGACTAGCCTATAAGCTCATGG + Intergenic
1170144869 20:13162266-13162288 GTGTCCCTCCTGCCATCTCAGGG - Intronic
1173353046 20:42262408-42262430 GTGTCTCGCCTGGGATCTCATGG - Intronic
1175152532 20:56946448-56946470 GTGGCCCCCCTTTAATCACATGG + Intergenic
1175267941 20:57713885-57713907 GTGACCCCCCTGCACTCTCCAGG + Intergenic
1175461663 20:59156264-59156286 GGCTCCCGCCTGTAATCCCAGGG + Intergenic
1182520335 22:30881322-30881344 GGGACAGGCCTGTAATCTCCTGG - Intronic
949351664 3:3129458-3129480 GTACCCAGCCTGTAATCTCTTGG + Intronic
952074424 3:29678593-29678615 GTCACCCACTTGTGATCTCAGGG + Intronic
964816922 3:160727610-160727632 GGCTCACGCCTGTAATCTCATGG + Intergenic
986037484 5:3954063-3954085 CTGACCCACCCTTAATCTCATGG - Intergenic
986649904 5:9953043-9953065 GTGGCCCCCGTGTAATCACAGGG - Intergenic
988580428 5:32463963-32463985 GGCTCACGCCTGTAATCTCAGGG - Intergenic
992649766 5:78847391-78847413 GTCTCATGCCTGTAATCTCAGGG - Intronic
994354573 5:98780661-98780683 GTAACCTGTGTGTAATCTCAGGG + Intronic
999261616 5:150241957-150241979 GTGTCCCGCCTGGAACCTCCTGG - Intronic
1006470389 6:34225399-34225421 GGCTCACGCCTGTAATCTCAGGG - Intergenic
1009188506 6:60601593-60601615 GAGACCAGCTTGTAGTCTCATGG - Intergenic
1012908340 6:105092674-105092696 GGCTCACGCCTGTAATCTCAAGG - Intergenic
1019187789 6:170231026-170231048 GAGACACGTCTATAATCTCATGG - Intergenic
1019993780 7:4710334-4710356 GTGATCCGCCTGCAAACTCCTGG - Intronic
1020257386 7:6509668-6509690 GAGGCCCTCCTGTGATCTCAGGG - Intronic
1029596821 7:101542440-101542462 GTGTCTCCCCTGTAACCTCAAGG - Intronic
1040733508 8:50478212-50478234 TTGATCCACCTTTAATCTCATGG - Intronic
1044895332 8:96885727-96885749 GGCTCACGCCTGTAATCTCAGGG + Intronic
1049255321 8:141610643-141610665 GTGTCAGGCCTGTAACCTCAAGG + Intergenic
1052324505 9:27203098-27203120 GTGACCCTCCCAGAATCTCAAGG + Exonic
1056299036 9:85222791-85222813 GTGAGCCCCATGTAATCACAAGG - Intergenic
1056645454 9:88408057-88408079 GTGCCCAGCCTGGAATCTCTTGG + Intronic
1059333183 9:113549212-113549234 GTGACCCATCAGTAATCCCATGG - Intronic
1186712016 X:12208112-12208134 GTGACCCACTTGTAATATAATGG + Intronic
1194824699 X:98547377-98547399 GTGACCCACCTGTACTCTGAAGG + Intergenic
1195112412 X:101660803-101660825 GTGAACCTCCTGTAATTTGATGG + Intergenic
1198304168 X:135364423-135364445 GTGGCCCTCCTGAATTCTCAGGG + Intergenic