ID: 904046629

View in Genome Browser
Species Human (GRCh38)
Location 1:27613083-27613105
Sequence GTGTTGGAACAGGTGGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904046629_904046634 1 Left 904046629 1:27613083-27613105 CCCTGCTCCACCTGTTCCAACAC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 904046634 1:27613107-27613129 TCCCGTTTATTCATGCCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 45
904046629_904046641 24 Left 904046629 1:27613083-27613105 CCCTGCTCCACCTGTTCCAACAC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 904046641 1:27613130-27613152 ATGGGTCTCTGTCAGTCAAAGGG 0: 1
1: 0
2: 0
3: 13
4: 136
904046629_904046638 6 Left 904046629 1:27613083-27613105 CCCTGCTCCACCTGTTCCAACAC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 904046638 1:27613112-27613134 TTTATTCATGCCTGAAGGATGGG 0: 1
1: 0
2: 0
3: 11
4: 170
904046629_904046640 23 Left 904046629 1:27613083-27613105 CCCTGCTCCACCTGTTCCAACAC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 904046640 1:27613129-27613151 GATGGGTCTCTGTCAGTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 129
904046629_904046637 5 Left 904046629 1:27613083-27613105 CCCTGCTCCACCTGTTCCAACAC 0: 1
1: 0
2: 0
3: 16
4: 219
Right 904046637 1:27613111-27613133 GTTTATTCATGCCTGAAGGATGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904046629 Original CRISPR GTGTTGGAACAGGTGGAGCA GGG (reversed) Exonic
900108214 1:994878-994900 GGGTAGGGACAGGTGGAGCTGGG - Intergenic
900820054 1:4879647-4879669 GTGCTGGAACAGGAGGATCTTGG + Intergenic
901237590 1:7675822-7675844 GTGATGGAACTGCAGGAGCAGGG + Intronic
901744331 1:11362618-11362640 GTGCTGGAAAACGTGGAGGAGGG + Intergenic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
902688619 1:18095581-18095603 GGGTTGGAACAGATAGAGGATGG - Intergenic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
904046376 1:27611641-27611663 GTGTGGAAACAAGGGGAGCAGGG - Intergenic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
905283802 1:36866193-36866215 GTTTTGGAACTGGTGTAGCATGG + Intronic
906645207 1:47469887-47469909 GTGCTGGAACACGTTGGGCAAGG + Intergenic
909002412 1:70234414-70234436 GTGTTGTAATGGGTGGAACATGG + Intronic
912481834 1:109987893-109987915 TTTTTGGAACAGGTGGAGATAGG + Intronic
913218893 1:116643712-116643734 GTGTTGTCACAGGTGTAGAAAGG + Intronic
915245512 1:154553464-154553486 TTTTAGGAACAGTTGGAGCAGGG - Intronic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
917597920 1:176548298-176548320 ATGTTGGATCTGGGGGAGCAAGG + Intronic
919167119 1:193909647-193909669 GTGCTGGAATGGGTGGAGAATGG - Intergenic
921342635 1:214149614-214149636 GAGCTGGAACAAGTTGAGCAAGG + Intergenic
1063161865 10:3424274-3424296 GGGATGGCGCAGGTGGAGCACGG - Intergenic
1063448184 10:6133479-6133501 GTGAGGAAACAGGTGGAGGAAGG + Intergenic
1064451121 10:15442828-15442850 TTTTTAAAACAGGTGGAGCATGG - Intergenic
1068800914 10:61138812-61138834 TTGTTGGAAAAGTTAGAGCAAGG - Intergenic
1069536578 10:69257964-69257986 GGATTGGAACAGGTGGAGATGGG + Intronic
1070392107 10:75980321-75980343 GTGCTGGAGAAGGGGGAGCAGGG - Intronic
1070650011 10:78228579-78228601 GTCTGGGAGCAGGTGGAGCAGGG - Intergenic
1070680495 10:78445714-78445736 GTGCTGGAGCAGGTGGGGAAGGG - Intergenic
1071693254 10:87844586-87844608 GTGGAGGAACAGGTGGAGAGTGG - Intergenic
1071910335 10:90224579-90224601 GTATGGGAAGAGGTGGAGCGGGG + Intergenic
1072154275 10:92709767-92709789 GTTTTGGAACAGGCCGGGCATGG - Intergenic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1076751361 10:132545123-132545145 GTTGTGGGGCAGGTGGAGCAGGG + Intronic
1077371096 11:2181994-2182016 GAGATGGAGCAGGTGGGGCAGGG + Intergenic
1077441592 11:2571546-2571568 GTGCTGGGATGGGTGGAGCAGGG + Intronic
1077457580 11:2690106-2690128 GGGTTAGAACTGGGGGAGCAGGG + Intronic
1081735919 11:45404232-45404254 GTATTAGAAGAGGTGGAGGAAGG - Intergenic
1082861259 11:57858672-57858694 GTGTTGGCTCAGGCGGGGCACGG - Intergenic
1083738005 11:64692729-64692751 GTGTCAGGACAGGTGGAGGAGGG + Intronic
1083811194 11:65107920-65107942 GTGTTGGTACTGCTGCAGCACGG - Exonic
1084042088 11:66548043-66548065 GTGTTGGCACACGCTGAGCAGGG - Intronic
1084176191 11:67423637-67423659 GTGGTGCAACAGGTGCAGCTGGG - Exonic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1087002394 11:93434109-93434131 GTGGTGCAACAGGTTGACCATGG - Intronic
1087713005 11:101576037-101576059 GGGCTGGAACACGTGGACCATGG - Intronic
1091343316 11:134836689-134836711 GTCATGGAGCAGGTGGAGCCAGG - Intergenic
1092887549 12:12938281-12938303 GTGTTGGAACAGGTTGGGCGCGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1101520740 12:105479762-105479784 TTGTTGTAACAGAGGGAGCAGGG + Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102454877 12:113065185-113065207 GAGCTGGAGCAGGTGGGGCAGGG + Intronic
1102570212 12:113822878-113822900 GGGTGGGGACAGGGGGAGCAGGG + Intronic
1103757220 12:123218094-123218116 GTGGTGGTACAGGTGGTACATGG - Intronic
1104362180 12:128144334-128144356 ATGTTGGCACAGATGGATCAGGG + Intergenic
1104675743 12:130710825-130710847 GTGGAGGAGCAGGTAGAGCAGGG - Intronic
1104971891 12:132534533-132534555 GTGTGGGCACATGTGGGGCAGGG - Intronic
1107495737 13:40924041-40924063 GTGTTCTAAGAGATGGAGCAGGG + Intergenic
1110622457 13:77612509-77612531 GTTTTGGAAGAAGGGGAGCAAGG + Intronic
1115073808 14:29361043-29361065 GTGTTGTAACAGCTAGACCAGGG + Intergenic
1116737151 14:48706448-48706470 TTGTTGGTAATGGTGGAGCAAGG + Intergenic
1117202777 14:53409667-53409689 GTGTTGGACCTGGTGGGGCCTGG + Intergenic
1119400592 14:74359725-74359747 GTGTGGGACCAGGTGGGGCAAGG + Exonic
1121327118 14:93027581-93027603 GTGTTGGAACATCTGGAGTGTGG - Intronic
1122716326 14:103698847-103698869 GTGTAGGAACAGGAGGAGGGGGG + Exonic
1124204269 15:27703871-27703893 GTAGTGGAACAGGTGGATGAGGG + Intergenic
1125701565 15:41690104-41690126 GTGTTGGATTGGGTGGAGCTGGG - Intronic
1128614652 15:69099654-69099676 GTGGTGGAGCTGGTGGAGCTGGG + Intergenic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1129690600 15:77711145-77711167 GTGGTGGCAAAGGAGGAGCAAGG - Intronic
1130192134 15:81747498-81747520 ATGTTGCAGCAGGTGGAGCCTGG + Intergenic
1132670407 16:1100162-1100184 GTGTGTGAGCAGGTGGGGCAGGG - Intergenic
1132743171 16:1426086-1426108 GGGGTAGAACAGGTGGGGCAGGG - Intergenic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1136398820 16:30006929-30006951 CAGTTGGAGCAGGCGGAGCAGGG - Exonic
1137771454 16:51019124-51019146 GTGTTAAAACAGGAGGTGCATGG + Intergenic
1138637922 16:58357755-58357777 TTGGTGGAACAGGTGGAGTTTGG + Intronic
1138750909 16:59420099-59420121 GAATTGGAAAAGGTGGAGCAAGG - Intergenic
1141252233 16:82369266-82369288 GTGATGGAGGAGGAGGAGCATGG - Intergenic
1141694159 16:85612075-85612097 GTGTTGGAAGAGGATGAGGAGGG + Intronic
1142957844 17:3533289-3533311 GTGTTGGAGGAGGTGGAAAAAGG - Intronic
1143282442 17:5764918-5764940 GTGTTGGAACTGTGGGAGAAGGG + Intergenic
1144144836 17:12387472-12387494 GTCTGGGCACAGGTGGAGCCTGG + Intergenic
1147034742 17:37671592-37671614 GTGTTTGCAGAGGAGGAGCAGGG - Intergenic
1147813286 17:43189154-43189176 GTGTTGGCACAGGTGGAATGTGG + Intronic
1148187232 17:45653505-45653527 GCATTGTAACAGGTGGAGGATGG - Intergenic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1151182000 17:72336075-72336097 ATGTTGGAACTGGTGGAAGAGGG - Intergenic
1153032147 18:724593-724615 GTATTAGAACAAGTGGAGCGAGG - Exonic
1153612212 18:6897818-6897840 GTGTTGGAACTTGTGGTGCTGGG + Intronic
1153761306 18:8334879-8334901 AAGTGGGAACAGGAGGAGCAAGG - Intronic
1156475804 18:37404607-37404629 GTGCTGGAGCAGGTCGAGCCAGG - Intronic
1158566235 18:58556560-58556582 GTGGTGGAGCTGGTGGAGGAAGG + Intronic
1158650501 18:59280292-59280314 GTGGTAGAACAGGTGCAGGAGGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160514728 18:79472064-79472086 GTGTTGGTACAGAGGGAGCCGGG + Intronic
1162131673 19:8529923-8529945 GTGATGGAACAGATGGATCTAGG + Intronic
1162131688 19:8530000-8530022 GTGATGGAACAGATGGATCTAGG + Intronic
1162131706 19:8530077-8530099 GTGATGGAACAGATGGATCTAGG + Intronic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1164456789 19:28414502-28414524 GTAGTGGGACAGGTGGGGCAGGG - Intergenic
1164980134 19:32607601-32607623 GTGTTGGGGGTGGTGGAGCAGGG - Intronic
1165610613 19:37149069-37149091 TTGTTGGAGCAAGTGGATCATGG - Exonic
1165861186 19:38910447-38910469 GTGATGGATCTGGTGGTGCAGGG + Intronic
1166988550 19:46677204-46677226 TTCATGGAGCAGGTGGAGCAGGG - Intronic
1167824695 19:51961522-51961544 GTGTCAGAACAGGGAGAGCAAGG + Intergenic
925032276 2:660187-660209 GGGAGGGAGCAGGTGGAGCAGGG + Intergenic
925032597 2:662205-662227 GTGTGGGTGCAGGTGCAGCATGG + Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926411236 2:12604793-12604815 GTGTGGGAAGAGGGGGTGCAGGG + Intergenic
931237478 2:60423670-60423692 ATGTTGGAATAGGATGAGCAAGG + Intergenic
932485872 2:72083994-72084016 GTGATGGTAGAGGTGGTGCAGGG + Intergenic
935903865 2:107822315-107822337 ATGTTGGAAATGGTGGAGAATGG + Intergenic
937296818 2:120814499-120814521 GTGTTGGGTGGGGTGGAGCAGGG + Intronic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
939673684 2:145045401-145045423 TTATTGAAACAGGTGGAGGAGGG - Intergenic
940442781 2:153738315-153738337 ATGTTGGGACATGGGGAGCACGG - Intergenic
940583298 2:155609189-155609211 GTGTTGGTGTTGGTGGAGCAGGG - Intergenic
942314978 2:174689822-174689844 GGCCTGGAACAGGTGGAGAATGG + Intergenic
943938804 2:193963099-193963121 ATCTTGAAACAGGTGCAGCAAGG - Intergenic
943993045 2:194721710-194721732 CACTTGTAACAGGTGGAGCAGGG + Intergenic
946989908 2:225316868-225316890 GTTTGGGAAGAGGTGGAGGAGGG + Intergenic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
1172775208 20:37403188-37403210 GTGCTGGACCAGGTGGAGCGGGG + Exonic
1173289900 20:41705483-41705505 GAGGTGGAAGAGGTGGAGAAGGG - Intergenic
1173623995 20:44457799-44457821 GTGGTGGTGGAGGTGGAGCAAGG + Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1175309556 20:58002292-58002314 GTGTTGGGCCAGCTGGTGCAGGG - Intergenic
1175440819 20:58989912-58989934 GTGCTGGCCCAGGAGGAGCAGGG + Exonic
1175592464 20:60203946-60203968 GTGTTGGAAGAAGTAGAGCTTGG - Intergenic
1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG + Exonic
1179227637 21:39469167-39469189 GTGTGGGAACAGGGGGTACATGG - Intronic
1179248852 21:39656394-39656416 GTGATGTAACAGGTGGAACCAGG - Intronic
1179358625 21:40684510-40684532 GGGCTGGAGCAGGTGGAGGAAGG - Intronic
1180820191 22:18821767-18821789 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1181206414 22:21256239-21256261 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1181695707 22:24591915-24591937 GAGTTGGAGGAGGTGGAGAAGGG + Intronic
1181840016 22:25649044-25649066 ATACTGGAACAGGTGGAGCGAGG + Intronic
1184350889 22:43943494-43943516 GTGATGAAACAGGCAGAGCACGG - Intronic
1184425029 22:44404185-44404207 TTGTTGGAACAGGGGCAGGAAGG + Intergenic
1185297450 22:50061334-50061356 GTGTCGTAACAGCAGGAGCATGG - Exonic
1203220506 22_KI270731v1_random:39184-39206 GTGTTGTCACAGGTGTAGAAAGG - Intergenic
1203270318 22_KI270734v1_random:47638-47660 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
954122056 3:48505140-48505162 GTGTTAGAACAGGGAGAGGAAGG + Intergenic
954553799 3:51503128-51503150 GGGGTGGAACAGGCAGAGCAAGG - Intergenic
954612001 3:51949473-51949495 GTGATGGACCAGGAGGGGCAAGG - Intergenic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
957524886 3:81367341-81367363 GTATGGGAACAGGTGAAGAATGG - Intergenic
959878868 3:111419475-111419497 GTGGTGGTACAGGTGGTGCAAGG + Intronic
960951975 3:123005189-123005211 GGGTGGGGACAGGTGGAGGAAGG - Intronic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
968854960 4:3113114-3113136 GTGTTTGAACAGTTGTAGCGTGG + Intronic
970535703 4:17027891-17027913 TGGTTGGTGCAGGTGGAGCACGG + Intergenic
972696741 4:41453953-41453975 GTGTTGGAGGAGGCGGGGCAAGG - Intronic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
975716028 4:77206485-77206507 GAGTTGGAATAGGAGCAGCAAGG + Intronic
976201574 4:82584770-82584792 GTGTTGGCAGAGGTGGTGGAGGG - Intergenic
978348873 4:107800358-107800380 GAGTTGGAAAGGGTGGAGCAGGG + Intergenic
978751872 4:112258966-112258988 GTTTGGGGAGAGGTGGAGCATGG + Intronic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
980846907 4:138334710-138334732 CTGATGGAACAGGTGGTGTAAGG - Intergenic
981922499 4:150100403-150100425 GTGTAGAAACAGGTTGACCAAGG + Intronic
982167231 4:152625243-152625265 CTGTTGGAACTGGTGGATCCAGG + Exonic
982898981 4:160973955-160973977 TTTTTGGAACAGTTTGAGCAGGG - Intergenic
983806751 4:172002831-172002853 GTGTTATAAGAGGTGGAGAATGG + Intronic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984799951 4:183705561-183705583 GTATTGGAAGAGGTGATGCAGGG - Intronic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996658709 5:125972918-125972940 GTCTTAGAAAAGGTGGAGGAAGG - Intergenic
998093671 5:139384927-139384949 GTCCTGGAACAGGTGAAGGATGG + Intergenic
1001044887 5:168364193-168364215 GTTCTGGAAGAGGTGGAGCCTGG + Intronic
1001268141 5:170290121-170290143 CTTTTGGAAAAGGTGGAGGAGGG - Intronic
1002129077 5:177068555-177068577 TTGTTGGAACTAGTGGAGAAAGG - Intronic
1003588986 6:7421083-7421105 GTGTTGCAGAAGGTGGTGCAGGG + Intergenic
1003732382 6:8839754-8839776 GTTTTGGAAAAGGAGGAGCTAGG - Intergenic
1005822936 6:29612619-29612641 GGGAAGGAACATGTGGAGCAAGG + Intronic
1006745231 6:36336977-36336999 GGGTGGTAACAGGTGGAGGAAGG - Intergenic
1006804556 6:36779695-36779717 GTGTTGGGTCAGCTGGGGCAGGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1013007999 6:106092371-106092393 CTGTGGGAGCAGGTGAAGCAAGG + Intronic
1013596024 6:111661908-111661930 GTGCTGGAGCAGGTGGAGCGAGG - Exonic
1013662158 6:112308784-112308806 ATGTTGGAGAAGGTGAAGCATGG + Intergenic
1013663405 6:112322176-112322198 GTGTTGGAAAATATGGAACAGGG + Intergenic
1015218523 6:130777859-130777881 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1015277511 6:131399437-131399459 GTGTAGTAACTGGTAGAGCAAGG + Intergenic
1015360096 6:132330143-132330165 GTGTTGCATCAGTTAGAGCAGGG + Intronic
1015940908 6:138450989-138451011 CTATTGGAAGAGGAGGAGCAGGG - Intronic
1016473975 6:144406312-144406334 GAGATGGAGAAGGTGGAGCATGG - Intronic
1019501180 7:1365460-1365482 CGGTTGGGACAGGTGGACCAGGG - Intergenic
1019524783 7:1476069-1476091 ACGCTGGAAGAGGTGGAGCAGGG + Exonic
1020008990 7:4798442-4798464 GTGGTGGAACTGGTGGCCCAGGG - Intronic
1020042019 7:5011448-5011470 GTGTTGTATAAAGTGGAGCAAGG - Intronic
1023059296 7:36313182-36313204 GAGTAGGAACAGGTAGAGGAGGG + Intergenic
1023616620 7:42026273-42026295 GTGTTGGAAAAGTTGGGGCAGGG + Exonic
1025196255 7:56936595-56936617 GTGAAGGAACAAGTGAAGCAGGG + Intergenic
1025614262 7:63104749-63104771 GAGTTGGAAGAGGTGGCCCAGGG - Intergenic
1025675692 7:63640337-63640359 GTGAAGGAACAAGTGAAGCAGGG - Intergenic
1027542987 7:79491812-79491834 GAGGTGGAAAAGGTGGAGGAAGG + Intergenic
1029496645 7:100898603-100898625 GTGTTAGAAGATGTGGATCAAGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1030354262 7:108525745-108525767 GGGATGGGACAGGGGGAGCAGGG + Intronic
1032785392 7:135196174-135196196 GTGCTGGGACAGGAGGAGTACGG - Exonic
1034631171 7:152531628-152531650 CCATTGGAACAGGTGGAGCAAGG - Intergenic
1034936632 7:155204338-155204360 GTGTGGCACCAGGTGAAGCAGGG + Intergenic
1035002102 7:155620756-155620778 GAGTTGGCATAGGGGGAGCATGG + Intronic
1035236446 7:157500654-157500676 GTGTGGGAGCGGGTGGAGAAGGG - Intergenic
1036694069 8:10963340-10963362 GAGGTGGAACATTTGGAGCAGGG - Intronic
1037013408 8:13873404-13873426 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1037513748 8:19609894-19609916 GTGCTGGGACGGGAGGAGCATGG + Intronic
1037813885 8:22101995-22102017 GTGTTAGGACGTGTGGAGCAGGG - Intronic
1044363446 8:91315474-91315496 GTGTGGGCACAAGTGGAACATGG - Intronic
1044897672 8:96909956-96909978 GTGCTCGACCAGGTTGAGCACGG + Intronic
1045266581 8:100623660-100623682 GTCTGGGATCAGGTGGAGGAAGG - Intronic
1047347464 8:124042078-124042100 GTGTTGTGGCAGGTGGAGGAGGG - Intronic
1048734119 8:137479337-137479359 GTGCTGGTACAGGTGGAAAATGG + Intergenic
1049418918 8:142508276-142508298 GGAGAGGAACAGGTGGAGCAGGG - Intronic
1049445877 8:142631267-142631289 GTGTGGGGACAGGTGGAGAAGGG - Intergenic
1049566912 8:143345096-143345118 GTGCTGGCCCAGGTGGAGCCAGG - Intronic
1049613967 8:143568319-143568341 GGGTGGGAAGAGGGGGAGCAAGG + Intronic
1051593050 9:18795902-18795924 TTCTTGCAACAGGTGGAACAAGG - Intronic
1059708169 9:116842909-116842931 GTGTAGGCAGAGGTGAAGCAGGG - Intronic
1060437503 9:123606909-123606931 TTCTTGGAAGAGGTGGAGAAGGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188934488 X:36157085-36157107 GGGGTGGAACAGGTGAAGAAGGG - Intergenic
1189566724 X:42249415-42249437 GAGTGGGATCAGGGGGAGCACGG - Intergenic
1190753514 X:53381628-53381650 GTGTTGTAACCGGGTGAGCATGG - Intronic
1192362807 X:70449957-70449979 GAGTTGGAACAGGGGGAGTCAGG - Intronic
1194807256 X:98344773-98344795 GTGCTGGCAAAGGGGGAGCAGGG + Intergenic
1195501941 X:105612429-105612451 GTTGTGGAAGGGGTGGAGCAAGG + Intronic
1196586449 X:117434624-117434646 GTTGTGGAATGGGTGGAGCATGG + Intergenic
1200087226 X:153613190-153613212 GTTCTGGATCAGGAGGAGCAGGG + Intergenic
1200842917 Y:7801953-7801975 ATGTTGGAACATGAGGAGTAGGG - Intergenic
1201246646 Y:12010807-12010829 ATTTTGGAATAGGTGCAGCATGG + Intergenic