ID: 904047095

View in Genome Browser
Species Human (GRCh38)
Location 1:27615400-27615422
Sequence GAGCCTGGTCGGGCGGGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904047095_904047106 21 Left 904047095 1:27615400-27615422 CCGAATCCCGCCCGACCAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 904047106 1:27615444-27615466 GAACTCGGTCACGATGTAGATGG 0: 1
1: 0
2: 0
3: 5
4: 28
904047095_904047107 22 Left 904047095 1:27615400-27615422 CCGAATCCCGCCCGACCAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 904047107 1:27615445-27615467 AACTCGGTCACGATGTAGATGGG 0: 1
1: 0
2: 1
3: 6
4: 25
904047095_904047104 6 Left 904047095 1:27615400-27615422 CCGAATCCCGCCCGACCAGGCTC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 904047104 1:27615429-27615451 CTGACCGTGACACATGAACTCGG 0: 1
1: 0
2: 1
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904047095 Original CRISPR GAGCCTGGTCGGGCGGGATT CGG (reversed) Intronic
901696671 1:11012864-11012886 GAGCCCGCTCGGGCAGGACTAGG - Intronic
904047095 1:27615400-27615422 GAGCCTGGTCGGGCGGGATTCGG - Intronic
904171551 1:28594988-28595010 GGGCCTGGTCGGGGGGGCATTGG - Exonic
905031156 1:34885423-34885445 GACCCTGGTCGGTCGGGGCTGGG - Intronic
910597152 1:88992638-88992660 GGGCCCGGCTGGGCGGGATTCGG + Exonic
914667170 1:149841350-149841372 GAGGCGGGGTGGGCGGGATTAGG - Intergenic
914668597 1:149852440-149852462 GAGGCGGGGTGGGCGGGATTAGG + Intronic
915245970 1:154556659-154556681 GAGTCTGGTCAGGCTGCATTTGG - Intronic
921457395 1:215388961-215388983 GAGCCTGGTGGGAGGTGATTGGG - Intergenic
922695333 1:227728478-227728500 GAGCCAGGTGGGGCGGGGCTGGG - Intergenic
1067243070 10:44512824-44512846 GAGCCTAATGGGGCTGGATTTGG + Intergenic
1068296064 10:55073863-55073885 AAGCCTGGTCGGGGGAGATGGGG - Intronic
1070195287 10:74151164-74151186 GAGTCTGGAGGGGCGGGATTTGG + Intronic
1074400907 10:113140709-113140731 GAGGCTGGCTGGGTGGGATTTGG + Intronic
1076453654 10:130574652-130574674 GAGCCTGGACGGGGGAGATCTGG - Intergenic
1077241445 11:1512746-1512768 GGGCCTGGTGGGGGGTGATTAGG + Intergenic
1077241498 11:1512866-1512888 GGGCCTGGTGGGGGGTGATTAGG + Intergenic
1077241551 11:1512986-1513008 GGGCCTGGTGGGGGGTGATTAGG + Intergenic
1084208751 11:67611270-67611292 GAGCCTGGGCGGGAGGGCTCAGG + Intronic
1096870136 12:54587946-54587968 GAGCCTGGAAGGGTGGGAGTTGG - Intronic
1105407775 13:20145868-20145890 GAGCCTGCTGGAGCGGGATGGGG - Intronic
1106483290 13:30152842-30152864 GAGTCAGGTCAGGAGGGATTGGG - Intergenic
1108575089 13:51783670-51783692 GAGGCTGCAGGGGCGGGATTAGG - Intronic
1109969967 13:69755090-69755112 GAGCCTGGTGGGAAGTGATTGGG + Intronic
1114629825 14:24151785-24151807 GAGCCTGGTCAGGCGGCTTTTGG + Exonic
1116858122 14:49971834-49971856 GAGCCTGGTGGGGGGGGGTGGGG - Intergenic
1119875573 14:78056473-78056495 GGGCCTGGTGGGGGGGGACTGGG + Intergenic
1121678830 14:95776083-95776105 GGGCCTGGTGGGAGGGGATTGGG - Intergenic
1122782394 14:104149248-104149270 GAGCCTGCTGGGTCGGGGTTGGG + Intronic
1123084566 14:105711474-105711496 GAGCTGGGCCGGGCCGGATTGGG - Intergenic
1123930985 15:25171568-25171590 GAGCCTAGTCGGGGGTGATGTGG + Intergenic
1127876301 15:63114407-63114429 TACCCTGGTGGGGAGGGATTTGG + Intergenic
1128192353 15:65714572-65714594 CAGCATGGTGGGGCAGGATTTGG - Intronic
1130614349 15:85390444-85390466 GAGCCTGGTGTGGCTGGAATGGG + Intronic
1130743206 15:86623279-86623301 GAGCCTGGTTGGCCAGGGTTGGG + Intronic
1131156874 15:90080987-90081009 CAGCCTGGCCGGGCAGGACTGGG + Exonic
1135544309 16:23355501-23355523 GGGCCTGGCCGGGTGGGCTTGGG - Intronic
1136365161 16:29806376-29806398 GAGCCTGGCGGGGCGGGGTGGGG - Intronic
1138795883 16:59968425-59968447 GGGCCTGGTGGGGGGTGATTAGG - Intergenic
1139443144 16:66979158-66979180 GAGCCTGGGCAGGCTGGACTGGG - Intergenic
1141573463 16:84948644-84948666 GTGCCCGGCCGGGCGGGCTTTGG - Intergenic
1141978544 16:87534683-87534705 GAGCCTGGTTGGGGGGTGTTTGG + Intergenic
1144214490 17:13043328-13043350 GAGCCTGGTGGGAGGTGATTGGG - Intergenic
1144393936 17:14825021-14825043 GAGCCTGGTGGGAGGGGTTTGGG + Intergenic
1147161757 17:38572736-38572758 GAGCCCGGGCGGGTGGGAGTAGG - Intronic
1148732518 17:49846093-49846115 GTGCCTGGTGGGGGGGCATTCGG + Intronic
1151980375 17:77504814-77504836 GAGCCTGGTGGTGTGGGGTTGGG - Intergenic
1156500169 18:37552489-37552511 GAGCCTGCTGGGGCGGGAGTTGG - Intronic
1160763966 19:798824-798846 GAGTCGGGTCGGGCGGGGCTCGG + Intronic
1160818546 19:1047383-1047405 GAGCCGGGTCGGGCGTGGATGGG + Intronic
1161127872 19:2570019-2570041 GAGGCTGGGTGGGCGGCATTTGG + Intronic
1161514902 19:4691026-4691048 GAGTCTGCTCGGGTGGAATTTGG - Intronic
1162569909 19:11465788-11465810 GGGTCTGGGAGGGCGGGATTGGG - Intronic
925318061 2:2940248-2940270 CAGCCTGGGCGGGCGGCGTTGGG + Intergenic
927215875 2:20667530-20667552 GAGCCTGGCCGGGAGGGCTCCGG + Exonic
945436245 2:209821282-209821304 GGGCCTGGTCTAGTGGGATTGGG - Intronic
948788597 2:240365670-240365692 GAGCCTCGCAGGGCGGGCTTGGG + Intergenic
1172666175 20:36601837-36601859 GAACCTGATCTGGGGGGATTAGG - Intronic
1172867882 20:38113656-38113678 AAGCCTGGTGGGGCGGGGTTAGG + Intronic
1173388673 20:42611823-42611845 GAGCCTAGTGGGGCTGGATCTGG - Intronic
1173821481 20:46022693-46022715 GAGCCAGCTCAGGCGGGGTTGGG + Intronic
1175956433 20:62611991-62612013 CAGCCTGGTGGGGCGGGAGCTGG - Intergenic
1176134412 20:63515114-63515136 GAGCCTGGTGGGAGGTGATTGGG - Intergenic
1179303833 21:40136828-40136850 GAGCCTGGTGGGGAGGGAGAAGG + Intronic
1180626859 22:17199367-17199389 GAGCCTGGTGGGGAGGCATGTGG - Intronic
1184682600 22:46080160-46080182 GAGGCTGGCCGGGCGGGAGAGGG - Intronic
949930157 3:9072114-9072136 GAGCCTGGCCGGTTGGGATCAGG - Intronic
960797395 3:121501740-121501762 GAGGCTGGGTGGGCGGGGTTTGG + Intronic
963469515 3:145722312-145722334 GAGCCTGGTCAGCAGGGACTTGG - Intergenic
964438007 3:156674517-156674539 GAGCCTGGGCGGCCGGAGTTCGG - Intronic
972532869 4:39976976-39976998 GGGACTGGCCGGGCGGGACTGGG - Intronic
974775372 4:66473312-66473334 GAGATTGGTGGGGCTGGATTGGG + Intergenic
990308689 5:54518139-54518161 GAGCCTGGCCCGGCGGGAGACGG + Exonic
995846491 5:116499399-116499421 GAACCTGGGCGGGCGGGGGTTGG + Intronic
999328287 5:150656788-150656810 GAGCCGGGGCGGGCGGGCTGTGG - Intronic
1010209865 6:73354270-73354292 GAGCCTCGGCCGGCGTGATTAGG - Exonic
1014539208 6:122653533-122653555 AAACCTGGTGGGGCGGGATGAGG + Intronic
1016828739 6:148412730-148412752 GGGCCTGGTCGGGGGTGTTTGGG - Intronic
1019488015 7:1298325-1298347 GAGCCTGGCCTGGCAGGGTTGGG + Intergenic
1019736435 7:2652247-2652269 GAGCCTGGGAGGCCGGGACTGGG + Intronic
1022102883 7:27179597-27179619 CAGTCTGGTGGGGCGGGAGTGGG - Intronic
1028081147 7:86578322-86578344 GAGCCTGATGGGGTGGAATTTGG + Intergenic
1034983721 7:155494737-155494759 GAGCCTGGGCGGGTGGGGTTCGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1040811712 8:51461143-51461165 GACCCTGGGAGGGTGGGATTGGG - Intronic
1043413332 8:80022651-80022673 GAGCCTGGTTTGTTGGGATTTGG - Intronic
1047128902 8:121995906-121995928 GGGCCTGGTGGGACGTGATTGGG - Intergenic
1049242441 8:141544842-141544864 GAGCCTGCTGGGTCGGGAGTGGG - Intergenic
1050915432 9:11124631-11124653 GAGCCTGATCAGGAGGTATTTGG + Intergenic
1053472201 9:38354975-38354997 GAGCCTGGTGGGAGGTGATTGGG - Intergenic
1056536214 9:87529952-87529974 AAGCTTGGGCGGGCGGCATTAGG - Intronic
1057050498 9:91919974-91919996 GAGCCTGGTGGGGCAGGTGTGGG - Intronic
1060219846 9:121758652-121758674 GAGCCTGCTCGTGCAGGATGGGG + Intronic
1061195122 9:129103263-129103285 GAGCATGGTCGGGAGGGCTCGGG + Intronic
1062615638 9:137394556-137394578 GAGGCTGGAAGGCCGGGATTAGG - Intronic
1186659509 X:11655047-11655069 GAGGCTGGTAGGGAGGGATGTGG - Intronic
1187552676 X:20321797-20321819 GAGCCTGGGAGGGAGGGATGGGG + Intergenic
1200035043 X:153321386-153321408 GAGTCTGGTGGGGCGGGGGTGGG - Intergenic