ID: 904050264

View in Genome Browser
Species Human (GRCh38)
Location 1:27634460-27634482
Sequence AGCCCGCAGGGTAACGTTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904050264_904050276 15 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050276 1:27634498-27634520 ACTTCGGCCGGCTCGGAAGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
904050264_904050279 26 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050279 1:27634509-27634531 CTCGGAAGAGGGGAACTTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 102
904050264_904050277 16 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050277 1:27634499-27634521 CTTCGGCCGGCTCGGAAGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 36
904050264_904050269 -1 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050269 1:27634482-27634504 TGTGGGCTTCACCCCGACTTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
904050264_904050270 3 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050270 1:27634486-27634508 GGCTTCACCCCGACTTCGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 49
904050264_904050275 14 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050275 1:27634497-27634519 GACTTCGGCCGGCTCGGAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
904050264_904050271 8 Left 904050264 1:27634460-27634482 CCGCTAACGTTACCCTGCGGGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 904050271 1:27634491-27634513 CACCCCGACTTCGGCCGGCTCGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904050264 Original CRISPR AGCCCGCAGGGTAACGTTAG CGG (reversed) Intronic
904050264 1:27634460-27634482 AGCCCGCAGGGTAACGTTAGCGG - Intronic
907487534 1:54787959-54787981 AGCCAGCAGGGTAAGGGCAGAGG - Intronic
1077120188 11:903851-903873 GGCCAGCAGGGTCACGTTGGCGG - Intronic
1084277622 11:68062612-68062634 AGCCCTCAGGGTATTGTTTGAGG - Intronic
1087955185 11:104277714-104277736 AGCCCAAAAGGTAAAGTTAGTGG - Intergenic
1103336682 12:120194955-120194977 AGCCCGCGGTGTAACGCTATGGG + Intergenic
1108591533 13:51917021-51917043 AGCCCACAGGTTAGCGTTAACGG - Intergenic
1113115444 13:106869954-106869976 AGCCCGCAGGGAGAGGTTAGGGG + Intergenic
1113604844 13:111597859-111597881 CTCCCGCAGGGTCACGTCAGGGG - Intronic
1123490396 15:20775662-20775684 AGCCCGCAGGGCAGCGTCACAGG + Intergenic
1123546897 15:21344749-21344771 AGCCCGCAGGGCAGCGTCACAGG + Intergenic
1130047202 15:80454490-80454512 AGCTCCCAGGGTTACCTTAGAGG - Intronic
1202955228 15_KI270727v1_random:71965-71987 AGCCCGCAGGGCAGCGTCACAGG + Intergenic
1136013813 16:27382448-27382470 AGCCCACAGTGTGACGTCAGAGG + Intergenic
1139483641 16:67244577-67244599 AGCCCCCAGGGGAACTCTAGGGG + Intronic
1161435445 19:4260029-4260051 AGCCTGGAGGGTAACCTTGGTGG - Intronic
1165050786 19:33140127-33140149 AGCCCACAGGATAACACTAGAGG + Intronic
926901188 2:17753687-17753709 CGCCCGCAGGGTGGCCTTAGCGG - Exonic
935137596 2:100321615-100321637 AGCCCGCAGGGCAGCGTCACCGG + Exonic
1183650530 22:39151106-39151128 AGCCCGCAGGGTAGCACAAGAGG - Intronic
969704563 4:8784740-8784762 AGCCAGCAGGGCAATGTCAGAGG + Intergenic
970710643 4:18858505-18858527 GGCCTGCAGGGTAGCGTTTGGGG + Intergenic
972229564 4:37055627-37055649 AGCCAGCAGGGTAAAGTGATGGG + Intergenic
988086757 5:26484070-26484092 AGCCCGAAGGGTGACGGGAGTGG - Intergenic
999026520 5:148238584-148238606 AGCCCTCATGGTACCGTCAGTGG - Intergenic
1003318848 6:5035232-5035254 ACCCCCCAGGGTAAGGGTAGTGG - Intergenic
1022337066 7:29431938-29431960 AGCCCGCAGGGTGAGATGAGAGG - Intronic
1032068258 7:128789041-128789063 CGCCAGCAGGGCCACGTTAGCGG - Intergenic
1040341961 8:46445605-46445627 AGGCCGCAGGGTACCGTGGGCGG - Intergenic
1048489200 8:134876511-134876533 TGGCCTCAGGGCAACGTTAGGGG - Intergenic
1055772291 9:79730393-79730415 ACCCCGCAGGGTGAAGTTAATGG - Intergenic
1195740919 X:108063732-108063754 TGCCCCCAGGGTGACGCTAGAGG - Intronic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic