ID: 904051694

View in Genome Browser
Species Human (GRCh38)
Location 1:27643675-27643697
Sequence TGGCACTAGAGCCACTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904051694_904051702 28 Left 904051694 1:27643675-27643697 CCCACTCAGTGGCTCTAGTGCCA No data
Right 904051702 1:27643726-27643748 AACAGCAGAACTCTGACCAGCGG No data
904051694_904051699 -1 Left 904051694 1:27643675-27643697 CCCACTCAGTGGCTCTAGTGCCA No data
Right 904051699 1:27643697-27643719 AGACATGACACTCATTTTTGGGG No data
904051694_904051698 -2 Left 904051694 1:27643675-27643697 CCCACTCAGTGGCTCTAGTGCCA No data
Right 904051698 1:27643696-27643718 CAGACATGACACTCATTTTTGGG No data
904051694_904051697 -3 Left 904051694 1:27643675-27643697 CCCACTCAGTGGCTCTAGTGCCA No data
Right 904051697 1:27643695-27643717 CCAGACATGACACTCATTTTTGG No data
904051694_904051703 29 Left 904051694 1:27643675-27643697 CCCACTCAGTGGCTCTAGTGCCA No data
Right 904051703 1:27643727-27643749 ACAGCAGAACTCTGACCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904051694 Original CRISPR TGGCACTAGAGCCACTGAGT GGG (reversed) Intergenic
No off target data available for this crispr