ID: 904051904

View in Genome Browser
Species Human (GRCh38)
Location 1:27645055-27645077
Sequence TTGGCAAAGCACCACCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904051904_904051908 -6 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051908 1:27645072-27645094 TGCCAAACACAAAGCAGGGCAGG No data
904051904_904051907 -10 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051907 1:27645068-27645090 GCTTTGCCAAACACAAAGCAGGG No data
904051904_904051914 19 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051914 1:27645097-27645119 GGCCAACTGGCCTGTCCCAGGGG No data
904051904_904051911 6 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051911 1:27645084-27645106 AGCAGGGCAGGCAGGCCAACTGG No data
904051904_904051912 17 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051912 1:27645095-27645117 CAGGCCAACTGGCCTGTCCCAGG No data
904051904_904051910 -2 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051910 1:27645076-27645098 AAACACAAAGCAGGGCAGGCAGG No data
904051904_904051913 18 Left 904051904 1:27645055-27645077 CCCAGGGGGTGGTGCTTTGCCAA No data
Right 904051913 1:27645096-27645118 AGGCCAACTGGCCTGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904051904 Original CRISPR TTGGCAAAGCACCACCCCCT GGG (reversed) Intergenic
No off target data available for this crispr