ID: 904051977

View in Genome Browser
Species Human (GRCh38)
Location 1:27645354-27645376
Sequence TGGGGGCACCCAGGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904051977_904051989 28 Left 904051977 1:27645354-27645376 CCCCCAGGGCCTGGGTGCCCCCA No data
Right 904051989 1:27645405-27645427 GTCAGTGAGACTCTTATTCTGGG No data
904051977_904051986 6 Left 904051977 1:27645354-27645376 CCCCCAGGGCCTGGGTGCCCCCA No data
Right 904051986 1:27645383-27645405 AGTGACTGCTGCCATATTTACGG No data
904051977_904051991 30 Left 904051977 1:27645354-27645376 CCCCCAGGGCCTGGGTGCCCCCA No data
Right 904051991 1:27645407-27645429 CAGTGAGACTCTTATTCTGGGGG No data
904051977_904051990 29 Left 904051977 1:27645354-27645376 CCCCCAGGGCCTGGGTGCCCCCA No data
Right 904051990 1:27645406-27645428 TCAGTGAGACTCTTATTCTGGGG No data
904051977_904051988 27 Left 904051977 1:27645354-27645376 CCCCCAGGGCCTGGGTGCCCCCA No data
Right 904051988 1:27645404-27645426 GGTCAGTGAGACTCTTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904051977 Original CRISPR TGGGGGCACCCAGGCCCTGG GGG (reversed) Intergenic