ID: 904054589

View in Genome Browser
Species Human (GRCh38)
Location 1:27661829-27661851
Sequence TCTGATCTGCAGAAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904054589_904054604 29 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054604 1:27661881-27661903 TGGTAGCTGTGGGTGCTGGGAGG 0: 1
1: 0
2: 3
3: 35
4: 479
904054589_904054596 9 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054596 1:27661861-27661883 AGTTAAACCACGCTGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 76
904054589_904054598 18 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054598 1:27661870-27661892 ACGCTGTGCCCTGGTAGCTGTGG 0: 1
1: 0
2: 0
3: 19
4: 167
904054589_904054599 19 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054599 1:27661871-27661893 CGCTGTGCCCTGGTAGCTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 141
904054589_904054602 26 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054602 1:27661878-27661900 CCCTGGTAGCTGTGGGTGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 344
904054589_904054600 25 Left 904054589 1:27661829-27661851 CCCTACCCCTTCTGCAGATCAGA 0: 1
1: 0
2: 1
3: 26
4: 175
Right 904054600 1:27661877-27661899 GCCCTGGTAGCTGTGGGTGCTGG 0: 1
1: 0
2: 1
3: 35
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904054589 Original CRISPR TCTGATCTGCAGAAGGGGTA GGG (reversed) Intergenic
900620097 1:3582801-3582823 TCTGATTTGGAGACGGGTTAGGG - Intronic
901194254 1:7431674-7431696 CCTGATCTGCAGATGGGCTGGGG - Intronic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902630207 1:17700375-17700397 TGTGCTCTGGAGAAGGGGGATGG + Intergenic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904733957 1:32616041-32616063 TCTGACCTGCAGAAGGCTTGGGG - Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906668549 1:47638627-47638649 TCTAAACTGGATAAGGGGTAGGG + Intergenic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
908026464 1:59957245-59957267 TAGGATCTGCAGAAGGGAAATGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
910030248 1:82711857-82711879 ACTGATCTGCAGAAGAGATTGGG - Intergenic
914690992 1:150026822-150026844 GCCAATCTGCAGAAAGGGTAAGG - Intergenic
917105284 1:171485664-171485686 TCTGATCGAAAGAAGGGGGAGGG - Exonic
917544784 1:175952607-175952629 TCTGATCTAAAAAAGGGATAAGG + Intronic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
921241430 1:213188043-213188065 GCTGCTCAGCAGAAGAGGTATGG - Intronic
921534195 1:216325190-216325212 TCTGATCTCCAGAACTGTTAGGG + Intronic
922338907 1:224639843-224639865 TCTGATCTGCAATCGGGTTAAGG - Intronic
922968977 1:229718121-229718143 TCTGCTGTGCAGAAAAGGTAGGG + Intergenic
923141811 1:231166866-231166888 TCTGATGTGAAGATGGGATAGGG + Intronic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1067834036 10:49627117-49627139 ACTGTTCTCCAGAAGGGGAATGG - Intronic
1068087177 10:52388909-52388931 TCTCATCAACAGAAGTGGTAGGG + Intergenic
1068914176 10:62410258-62410280 TCTGATTTGGAGCAGGGCTAAGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1069831647 10:71285534-71285556 TCTCATCTGCGAAAGGGGCAGGG - Intronic
1070058015 10:72953953-72953975 TGTGAACTGCAGCAGGGGGAAGG + Intronic
1070749296 10:78954554-78954576 TCTGCTCTGCCGAGGGGGTCAGG - Intergenic
1075982033 10:126748361-126748383 TCTGGTCTGCAGGTGGGGAATGG - Intergenic
1076039087 10:127227597-127227619 TTTCAGGTGCAGAAGGGGTAGGG - Intronic
1076340123 10:129739885-129739907 TCTGATCTGACCAAGGTGTAGGG - Intronic
1077048728 11:557247-557269 TCTGATCTGTAGAATGCGTTGGG - Intronic
1077150596 11:1071369-1071391 TCTGGCCTGCAGAATGGGTGTGG + Intergenic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1087984475 11:104660059-104660081 TCAGATCTGCAGAATTGTTAGGG + Intergenic
1090383277 11:126341862-126341884 GCTCATCTGCAGAAGGTCTAAGG + Intronic
1090514398 11:127410574-127410596 ACTGATCTGGAGATGGGGTCAGG + Intergenic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1095204867 12:39428039-39428061 TCTGCTGTGCAGTATGGGTAGGG + Intronic
1095403599 12:41842749-41842771 TCTGATCTCCAGAACTGTTAAGG + Intergenic
1095947098 12:47759470-47759492 ACTGCTCTCCAGAACGGGTAGGG + Intronic
1096598461 12:52713165-52713187 TCTCATCTGGGGTAGGGGTAGGG + Intergenic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1101795260 12:107967170-107967192 TTTTATCTGCAGATGGGCTAGGG + Intergenic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1102588551 12:113940346-113940368 GCAGCTCTGCAGAGGGGGTAAGG + Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1107783338 13:43928285-43928307 TCAAATATGAAGAAGGGGTATGG + Intergenic
1108562924 13:51664459-51664481 GCTGATCTGCAGAAAAGGTAGGG + Intronic
1108912734 13:55577144-55577166 TGTGATATGCAGAAAGGGGAAGG - Intergenic
1114437046 14:22715006-22715028 TCTAATATGCAGAAGGGGAGAGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118106887 14:62669885-62669907 TCTGATATGCAGAATGGATTGGG + Intergenic
1119707025 14:76789277-76789299 TCTGAAGAGCAGAAGGGGTTGGG + Exonic
1125340755 15:38673125-38673147 TCTGGTCTCCTGAAGGGGTGTGG + Intergenic
1127043036 15:54998058-54998080 TCAGTTTTGGAGAAGGGGTAAGG - Intergenic
1128860899 15:71071077-71071099 TCTGTTCTGCAGAAGTGATGAGG - Intergenic
1130603613 15:85295434-85295456 GCTGATCTGCAGCAGGGAGAGGG - Intergenic
1130862170 15:87900831-87900853 TCTCATCTGCATAATTGGTAGGG + Intronic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1133484827 16:6209687-6209709 TCTGATCTTCAGAAAGGGAGGGG + Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134654209 16:15935042-15935064 TCTTTTCTGCAGAAGTGGAAAGG + Intergenic
1138336787 16:56259678-56259700 AGTGGTCTGCAGAAGGGGCAGGG + Intronic
1138421685 16:56903217-56903239 TCTGAGCTGTGGCAGGGGTAGGG - Intronic
1140847393 16:78903521-78903543 TCTGCCCTGCAGAAAAGGTAAGG + Intronic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1144860850 17:18300865-18300887 CATGGTCTGCAGAAGGGGCAGGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1146624839 17:34427367-34427389 TCGGAGCTGCAGAAGGGGTGGGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146790424 17:35747737-35747759 TCTGATCTCCAGGAGGGGAGCGG - Intronic
1147019695 17:37521459-37521481 TCTGAGCTAAAGATGGGGTATGG + Intronic
1147744433 17:42686643-42686665 TCTTATCTGCAGATGGGGTCAGG - Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1150650280 17:67005669-67005691 TGTGATCAGCAGAAGGGAGACGG - Intronic
1150943741 17:69722089-69722111 TCTTATTAGCAGAAGGGGTTGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153815617 18:8787476-8787498 CCTGATCTGCAGTAGTGGGACGG + Intronic
1157289508 18:46399752-46399774 TCTGCTCTGAAGAAAGGGCAGGG - Intronic
1158972792 18:62684140-62684162 TCTGAACTCCAGAAGGGAGAGGG - Intergenic
1159307599 18:66664493-66664515 TCTGATGTGCAGTTGGAGTAGGG - Intergenic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162504971 19:11078242-11078264 TCTGATCTGGAGATGGGGGTGGG - Intergenic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925943891 2:8843088-8843110 TCAGATCTGCAGTGGGGGAAGGG - Intergenic
931635805 2:64339823-64339845 GCTGATGTACACAAGGGGTATGG + Intergenic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
932427015 2:71644347-71644369 CCTGATCTTGGGAAGGGGTAGGG - Intronic
933851736 2:86372852-86372874 TCTGCCCTGGAGAAGGGATATGG - Intergenic
937133149 2:119528383-119528405 GCTGATCTGAAGAAGGCTTAAGG + Intergenic
937968983 2:127535539-127535561 GCTGCTCTGCAGAAGGGGCCTGG + Intergenic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
943819068 2:192295702-192295724 TCATATCTGCAGAAGGAATAGGG + Intergenic
944214044 2:197236126-197236148 TTTGCCCTGCAGAAGGAGTAGGG - Intronic
947017232 2:225634402-225634424 TCTGCTCTGCAGAACGGTTCTGG + Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
947806553 2:232972615-232972637 TTTGATCTGTAAAATGGGTATGG + Intronic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
947974848 2:234357065-234357087 TCTGGTCTCCAGAAGGGCTGTGG + Intergenic
1170321267 20:15100724-15100746 TCTGATCTGCAGAAGGTTCCAGG - Intronic
1171162503 20:22941003-22941025 TCTGATCTACAGAAACTGTAAGG - Intergenic
1172206328 20:33165404-33165426 TGTTATCTGGAGAAGGGGTGGGG + Intronic
1173333636 20:42096130-42096152 TCTGAACTGCAGAAGTGGCCAGG - Intronic
1175203203 20:57292002-57292024 TCAGATCTGAAGGATGGGTAAGG + Intergenic
1177576890 21:22969146-22969168 TCTGTTCTGCTGAAGTGGGACGG - Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1179593578 21:42427569-42427591 TCAGATCTGTAAAATGGGTAGGG - Intronic
1180145131 21:45914573-45914595 CCAGATCTGCAGACTGGGTATGG - Intronic
1180742123 22:18061117-18061139 TCTGATCTGGAAAAGGGGCAGGG + Intergenic
1180934651 22:19617276-19617298 TCTGATGAGCAGAAGTGTTAAGG + Intergenic
1183618188 22:38957514-38957536 CCTGAGCTGGAGAAGGGGTGGGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184893508 22:47393673-47393695 TCTGACCTTGGGAAGGGGTATGG - Intergenic
1185079272 22:48700775-48700797 TCTGAACTGCTGAAGTGGGACGG - Intronic
950148530 3:10668652-10668674 TTTGAAGTGCAGAAGGGGTGGGG - Intronic
951858034 3:27219642-27219664 CCTGATCTGAAGAAGTGTTAGGG - Intronic
954375091 3:50189891-50189913 TCTAATCTGCAGAAGTGGCCAGG - Intergenic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955210994 3:56940874-56940896 TCTTATCTGCAAAATAGGTATGG - Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
960126231 3:114001217-114001239 TGTGATCTCCATAAGGGTTAAGG - Intronic
961483256 3:127197280-127197302 TCTGAACTGCAGCAGGGCAAAGG - Exonic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968398025 4:261522-261544 TCTGATCTGAAGAAGTGCCATGG - Intergenic
978945890 4:114495639-114495661 TCTGATCTGCATAGGGCTTAGGG + Intergenic
979876882 4:125903507-125903529 TCTTATCTGCAGTAGGGGTGTGG + Intergenic
981739325 4:147985594-147985616 TTTGCTCTGCAGCAGGGGAAAGG - Intronic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
987114351 5:14714303-14714325 TCTGAGCTGCAGGAGGGCCATGG + Intronic
987284436 5:16441570-16441592 CCCCAACTGCAGAAGGGGTAGGG + Intergenic
987933121 5:24427945-24427967 TCTGATCTGCAGAGAAAGTAAGG - Intergenic
988783974 5:34549033-34549055 TGTGGTCTACAGAAGGGGTGGGG + Intergenic
989718956 5:44502283-44502305 TCTGATCTGCAATAGGGGAAGGG - Intergenic
994178130 5:96734343-96734365 TCCGAGCTGCAGAAGGATTAAGG + Intronic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998426705 5:142035001-142035023 TTTGAGCTTCACAAGGGGTATGG - Intergenic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1002171479 5:177377125-177377147 TCAGACCTGCGGCAGGGGTAAGG + Intergenic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003285879 6:4733581-4733603 TCTGTTCAGCACAAGGAGTAAGG - Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013119265 6:107126833-107126855 TCTGACCTGCAGATGGGATTTGG - Intergenic
1014696568 6:124628759-124628781 ACTGACCTGAAGAAGAGGTATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016851869 6:148628234-148628256 TCTGATTTGAAGAAGGGTAAAGG + Intergenic
1019081065 6:169430058-169430080 TCTGAGCTGCAGAAGGGCACAGG + Intergenic
1019642104 7:2109049-2109071 TCTGAGCTGCAGAGCGGGTGCGG - Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019840129 7:3433422-3433444 TCTTTTCTCCAGAAGAGGTAAGG + Intronic
1023817499 7:43961890-43961912 TCTGCTCTGCAGAATGGGTTTGG + Intergenic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024623932 7:51188265-51188287 TCTGTTCTCCAGCAGTGGTAGGG + Intronic
1027143797 7:75679896-75679918 TCAGATCTGCAGAGGTGGTCAGG - Intronic
1028872729 7:95786847-95786869 TCTGATCTGCTAAAGGAGTTTGG + Intronic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1036669468 8:10771731-10771753 TCTAATGTCCAGAAGGGGTGTGG + Intronic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1039608888 8:38903545-38903567 TTTGTTCTGCAGAAGTGGGAAGG + Intronic
1041927945 8:63255964-63255986 TCTGATTTGGAGAAGAGGAAAGG - Intergenic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1048851802 8:138652448-138652470 TCTGATCTGCAAATGGGGCAAGG - Intronic
1048987533 8:139742734-139742756 TCTGATCTGCAGGCTGGGTGGGG + Intronic
1050598168 9:7224794-7224816 TCTGCTCTGGAGGTGGGGTAGGG + Intergenic
1051557286 9:18398776-18398798 TCTGATATACAGTAGGAGTAAGG + Intergenic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1055088935 9:72343110-72343132 CCTGCTCTGAAGAAGGGCTAAGG - Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056342977 9:85656168-85656190 TCTAATCTGGAGAAGGGTTAAGG + Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1061576131 9:131507707-131507729 TCTTATCAGCAGTCGGGGTATGG + Intronic
1061903179 9:133683419-133683441 TCTGGTTTGCAGAAGGGGAGGGG - Intronic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1185784390 X:2877553-2877575 GCTGTTCTGCAGAAGGGATCAGG + Intronic
1187720444 X:22145260-22145282 TCTGATCTTCATATGGGGTGTGG - Intronic
1189001802 X:36956065-36956087 CCAGATCTGGATAAGGGGTAGGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1195160614 X:102167137-102167159 TATGATGTGTAGGAGGGGTAGGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic