ID: 904058398

View in Genome Browser
Species Human (GRCh38)
Location 1:27687133-27687155
Sequence GTTCTTGGTTACCACCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904058394_904058398 8 Left 904058394 1:27687102-27687124 CCTTGTCTGGGGCTTTGGTCACC 0: 1
1: 0
2: 1
3: 24
4: 164
Right 904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 132
904058389_904058398 22 Left 904058389 1:27687088-27687110 CCGTGGTGTTCAGGCCTTGTCTG 0: 1
1: 0
2: 0
3: 19
4: 215
Right 904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904058398 Original CRISPR GTTCTTGGTTACCACCTTCA TGG Intergenic
900635347 1:3662130-3662152 GTGCCTGGTCTCCACCTTCAGGG - Intronic
904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG + Intergenic
908182926 1:61624013-61624035 GTACCTGGTTAACACCTTCATGG + Intergenic
913615134 1:120551462-120551484 AGACTTGATTACCACCTTCAAGG + Intergenic
914824276 1:151130459-151130481 TTTGTTTGTGACCACCTTCAAGG + Intergenic
916468519 1:165096957-165096979 CTTTTTGGTTTCCATCTTCATGG - Intergenic
920070187 1:203297030-203297052 GTGTTTGGTTGCCACCTCCAAGG + Intergenic
921716681 1:218424161-218424183 CTTCTTAGTTACCTCCTTCCTGG - Intronic
921934026 1:220779478-220779500 GTTAGTGGTTCCCACGTTCAAGG + Intronic
922859834 1:228806933-228806955 GTACTTGGTTTCCATTTTCAGGG - Intergenic
923791865 1:237118459-237118481 TTTCATGGTTACTACCTTCAAGG + Intronic
924689582 1:246333204-246333226 GAACTTGGTTCCAACCTTCATGG + Intronic
1063601906 10:7489769-7489791 TTTCTTGTTTACCACCTATAAGG - Intergenic
1064837136 10:19545709-19545731 TTGCTTGGTTATCTCCTTCAAGG + Intronic
1068515432 10:58020089-58020111 GTTCTTCATTATTACCTTCAAGG + Intergenic
1069515098 10:69070975-69070997 GTTCTTAATTACCACGTTCCAGG + Intergenic
1069886429 10:71626789-71626811 GATCCCAGTTACCACCTTCATGG - Intronic
1074357415 10:112798667-112798689 GTTCTTGGTGCCCATCCTCAAGG + Intronic
1075203185 10:120423323-120423345 GTTCTTGGATAACACCTCCTTGG + Intergenic
1076403808 10:130199703-130199725 GTTCCTGCTTTCCGCCTTCAGGG - Intergenic
1081393045 11:42552394-42552416 GTTCTTAGTCACCACCATAAAGG + Intergenic
1084036369 11:66513774-66513796 GTTCTTGGGTACCCCCTTTCTGG + Intronic
1088351850 11:108898416-108898438 GCTCTTGGTTTCCACCCTCTAGG - Intronic
1089851534 11:121501385-121501407 GTTAGTGGTTACCAGCATCAGGG - Intronic
1090654475 11:128832509-128832531 GATCCTGGCTACCACCTTCCAGG + Intergenic
1094450336 12:30577085-30577107 GTTTTAGGCTACCATCTTCAAGG - Intergenic
1095604728 12:44053015-44053037 GTTCTTGATCACCTCCTTTAAGG + Intronic
1097065835 12:56319852-56319874 GGTCTTGGTTACCTCATTAAGGG + Exonic
1097342257 12:58452696-58452718 CTTCTTGGTTACCACTCGCAAGG + Intergenic
1099123323 12:78720058-78720080 GGTCTCGGTTCCTACCTTCATGG - Intergenic
1099834065 12:87885004-87885026 GTTTTTGCTTACCAACTGCATGG - Intergenic
1101128103 12:101660463-101660485 TTTCTTGGTTAACATTTTCAAGG + Intronic
1102246351 12:111358802-111358824 GTTCTGGGTAACCAACTGCAGGG - Intergenic
1102725138 12:115056662-115056684 TTTTTTGGTTACCACTTACATGG + Intergenic
1106213853 13:27676525-27676547 GTTCTGGGGTACTCCCTTCAGGG - Intergenic
1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG + Intergenic
1107515891 13:41128984-41129006 GTTCTTGATTATCAGCTTGAAGG - Exonic
1109134413 13:58628275-58628297 ATTTTTGGTTTCCACTTTCATGG - Intergenic
1111858541 13:93671512-93671534 TTGCTTGGTTACCAACTACATGG + Intronic
1113820606 13:113209746-113209768 GTTCTTGATGACCAGCTTCTTGG - Exonic
1122926721 14:104906557-104906579 GCTCTCGGTTCCCACCTGCAGGG - Intergenic
1122926783 14:104906820-104906842 GCTCTCGGTTCCCACCTGCAGGG - Intergenic
1123105657 14:105840001-105840023 GTTCAGGGTGACCACATTCACGG + Intergenic
1128432128 15:67606608-67606630 GATCTCAGTTACCACCTCCAAGG - Intronic
1130557780 15:84935073-84935095 GATGTTGGCGACCACCTTCACGG - Exonic
1132239196 15:100244650-100244672 GGTCCTGTTTACCACCTGCAGGG - Intronic
1134066909 16:11234135-11234157 ATTCTTGGGTACCACCATCTCGG + Intergenic
1139379817 16:66523400-66523422 TGTCTTGGTTCCCACCTGCAGGG - Intronic
1140904383 16:79397949-79397971 GTTTTTAGTGACTACCTTCATGG - Intergenic
1144779496 17:17800708-17800730 GTTCCTGGTTCCGACCTTCCCGG - Intronic
1145085563 17:19936274-19936296 GTTCTGGGTTACCTTCTCCATGG + Exonic
1146274017 17:31503451-31503473 GGTCTTGGGAACCTCCTTCAAGG + Intronic
1146775657 17:35612744-35612766 ATTGCTGGTTACTACCTTCATGG + Intronic
1150886708 17:69094990-69095012 TTTCTTGGCTATCACCTCCAAGG + Intronic
1159000794 18:62973367-62973389 GTTTATTCTTACCACCTTCATGG + Intronic
1161240140 19:3218411-3218433 GCTCATGTTTTCCACCTTCATGG - Intergenic
1162934109 19:13972653-13972675 GTGGTTGGTAACCACCGTCATGG + Intronic
1168472821 19:56653211-56653233 GTTCTTGATTTCCACTTGCATGG + Intronic
925269400 2:2591608-2591630 GGACTTGGTTCTCACCTTCAAGG - Intergenic
925822894 2:7817959-7817981 ATTCTTGGTTGCCTCCTTAAAGG + Intergenic
932292319 2:70592957-70592979 GTGCCTGGTCACCAGCTTCATGG - Intergenic
936003794 2:108863782-108863804 GTTCTTGGTCAGCCACTTCAGGG + Intronic
936697255 2:114965594-114965616 GTGATTGGTTAAGACCTTCAAGG + Intronic
938786192 2:134632153-134632175 TTCCTTGCTTCCCACCTTCATGG - Intronic
944906753 2:204269555-204269577 ATTCTGGGTTGCCACCTTCCTGG - Intergenic
945880218 2:215317134-215317156 GTTCGTGGTTACGACTTTCTAGG + Intronic
948340682 2:237248897-237248919 ATACTTTGTTCCCACCTTCAGGG + Intergenic
948355121 2:237371831-237371853 GTTCTCGGTGAGCACCTTCCGGG - Exonic
1170618279 20:17972177-17972199 CTTCTTGGGTGCCACCTTCTTGG - Intronic
1175545229 20:59773630-59773652 GATCTTGGTTCCCACATTCTGGG + Intronic
1176693227 21:9943615-9943637 GTTCTTGGTTGCCCCCTTAACGG + Intergenic
1177917611 21:27109830-27109852 CTCCATGGTTACCTCCTTCAAGG - Intergenic
1184037361 22:41925130-41925152 GAGCTGGGCTACCACCTTCAAGG + Exonic
1185334989 22:50267460-50267482 GTACTTGGTGACCACCCTGATGG - Exonic
950045172 3:9944764-9944786 GCTCATGGTATCCACCTTCAGGG - Exonic
953662971 3:44904442-44904464 GTTATGGGTTACCAACTTCTGGG + Intronic
954332397 3:49898001-49898023 CTGCTTGGTTTCCCCCTTCAGGG + Intronic
957849942 3:85794725-85794747 GATCTTGTTTACCATCTACAAGG - Intronic
959117665 3:102196732-102196754 GTCCTTGGTTTCCACCTGCACGG - Intronic
960060610 3:113317064-113317086 GTGTTTGGTTACCCCGTTCAGGG - Intronic
961191881 3:124969007-124969029 GTTCTTGCTTAAAACCATCAGGG + Exonic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962686177 3:137850017-137850039 GAACATGGTTCCCACCTTCAAGG + Intergenic
967071778 3:185968663-185968685 CTTCTTGGTGACCAACTTCTGGG + Intergenic
969304401 4:6317558-6317580 CTTCTTGCTTCCCATCTTCAAGG + Intergenic
969921285 4:10542707-10542729 TTTCCTGCCTACCACCTTCATGG + Intronic
971666417 4:29492278-29492300 GTTCTTCGTTACCAGGTTTATGG + Intergenic
972559094 4:40210574-40210596 TTTCCTGTTTCCCACCTTCACGG - Intronic
975770456 4:77715661-77715683 GCTCTTCCTTACCACCTTCCTGG + Exonic
980365836 4:131803835-131803857 GTTCTTGGTTGCCCCCTTAATGG + Intergenic
981100763 4:140826701-140826723 ATTCTTGGTTACCACCTAACTGG - Intergenic
982383029 4:154770328-154770350 AGTCTTGGTTACCTCCTTCTTGG + Intergenic
982902189 4:161021083-161021105 TTTTTTGTTTACCATCTTCATGG - Intergenic
983208772 4:164937763-164937785 GATGTTGGCTGCCACCTTCAGGG - Intergenic
983210150 4:164949929-164949951 GATGTTGGCTGCCACCTTCAGGG + Intergenic
986217767 5:5736793-5736815 GTACATGGTTACCAGCTTCGTGG + Intergenic
988931825 5:36042698-36042720 TTTCTTGGTTTCCACTTTCATGG - Intronic
992402649 5:76425936-76425958 ATTCTTGGGTACTAACTTCATGG + Intronic
992957660 5:81926789-81926811 ATTCTGGATTCCCACCTTCAGGG - Intergenic
994597061 5:101852850-101852872 TTTCTTGGTTACCATTTTCATGG - Intergenic
996133273 5:119808686-119808708 GTTCTTGCATAACACCTTGATGG + Intergenic
1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG + Intergenic
1004804036 6:19182383-19182405 TTTCTTGGGTACCTCCTACATGG - Intergenic
1006730097 6:36230269-36230291 GTTCTTGGTGGCCTCCTGCATGG + Intronic
1007086083 6:39146608-39146630 GTTGTTGGTCACCAGCTTCATGG - Intergenic
1008231179 6:48986552-48986574 GTTCCAGGTTACCAGCTTCCTGG - Intergenic
1015679373 6:135787109-135787131 GTTCTTTGGTACCTCCTACATGG - Intergenic
1017318021 6:153055111-153055133 GTGCTTACTTACCACGTTCAGGG - Intronic
1017404794 6:154107651-154107673 TCTCTTGGTCTCCACCTTCAAGG - Intronic
1018438373 6:163783752-163783774 ATTTTTGGTTTCCTCCTTCAGGG - Intergenic
1024238000 7:47412713-47412735 ATTCTTGGGTTCCACATTCATGG + Intronic
1025173864 7:56786592-56786614 GTTATTGGTTACAAACTTTAGGG - Intergenic
1025698237 7:63791365-63791387 GTTATTGGTTACAAACTTTAGGG + Intergenic
1025829966 7:65039821-65039843 GTTATTGGTTACAAACTTCAGGG + Intergenic
1026328392 7:69330952-69330974 TTGTTTGGTTACCAGCTTCAAGG + Intergenic
1028631268 7:92936519-92936541 AAACTTGGTTCCCACCTTCAAGG - Intergenic
1030878311 7:114843595-114843617 GTTCTTAGATACCACCTTCTGGG + Intergenic
1031352113 7:120745956-120745978 GTTCTTGTATACTACCTTGATGG - Exonic
1031604997 7:123758007-123758029 GTTGCTTGTAACCACCTTCATGG - Intergenic
1036285306 8:7439705-7439727 CTTTTTGGTTACCACTTCCATGG + Intergenic
1036336170 8:7871824-7871846 CTTTTTGGTTACCACTTCCATGG - Intergenic
1039381592 8:37090777-37090799 ATTCTTGGTTCCTACCTTCCTGG - Intergenic
1040088850 8:43374417-43374439 TTTCTTGGCTACCAACCTCAGGG + Intergenic
1043600495 8:81931186-81931208 TTTCTTGGTTTCCATTTTCATGG - Intergenic
1046359190 8:113128170-113128192 CTGCTTAGTTCCCACCTTCATGG - Intronic
1048555403 8:135471050-135471072 TTTCTTGTTTTCCTCCTTCATGG + Intronic
1049680975 8:143918049-143918071 GTTCTTGGTGACCTCCTCGATGG + Exonic
1050391481 9:5148354-5148376 GTTCTTAGTTACCAAGTTCCTGG + Intronic
1051213935 9:14776110-14776132 GTTCCTGGTTACCACAGGCAGGG + Exonic
1051782123 9:20700881-20700903 CTTCTTGTTCACCCCCTTCAGGG - Intronic
1052036578 9:23688224-23688246 CTTCTTGGATACCACCTGGAAGG - Intergenic
1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG + Intronic
1053025589 9:34725892-34725914 GTCCCTGGTTGCCACTTTCATGG - Exonic
1053037117 9:34834954-34834976 GTCCCTGGTTGCCACTTTCATGG - Intergenic
1053076127 9:35136311-35136333 TCTTTTGGTTTCCACCTTCAGGG - Intergenic
1054933828 9:70665574-70665596 GTTCTCTGTTAACACGTTCATGG - Intronic
1189183643 X:39031085-39031107 GTTCTTCGTTTCCTCCTTCTGGG + Intergenic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1190632391 X:52400536-52400558 GATCTTGGTTACACCCTTTATGG + Intergenic
1196313931 X:114200735-114200757 GTTCTGAGTTACCACTCTCATGG - Intergenic
1197404417 X:126031833-126031855 TTTCTTGTTTACCATTTTCATGG + Intergenic
1197891382 X:131273873-131273895 CTTCTTGGTTACACTCTTCAAGG + Exonic
1198507128 X:137312215-137312237 GTTCTGGGTTAGCAGGTTCAGGG - Intergenic
1199692899 X:150322133-150322155 CTTCTTGGATACCACCTGAAGGG - Intergenic