ID: 904059512

View in Genome Browser
Species Human (GRCh38)
Location 1:27697063-27697085
Sequence ATACTTCTCCAGCTCTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904059512_904059518 23 Left 904059512 1:27697063-27697085 CCAATAGAGAGCTGGAGAAGTAT No data
Right 904059518 1:27697109-27697131 TGCCTATAATCCCAGCACTTTGG 0: 10529
1: 112818
2: 243046
3: 240273
4: 210047
904059512_904059516 -7 Left 904059512 1:27697063-27697085 CCAATAGAGAGCTGGAGAAGTAT No data
Right 904059516 1:27697079-27697101 GAAGTATTTACGGCTGGGCGCGG No data
904059512_904059521 27 Left 904059512 1:27697063-27697085 CCAATAGAGAGCTGGAGAAGTAT No data
Right 904059521 1:27697113-27697135 TATAATCCCAGCACTTTGGGAGG 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
904059512_904059519 24 Left 904059512 1:27697063-27697085 CCAATAGAGAGCTGGAGAAGTAT No data
Right 904059519 1:27697110-27697132 GCCTATAATCCCAGCACTTTGGG 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
904059512_904059517 -4 Left 904059512 1:27697063-27697085 CCAATAGAGAGCTGGAGAAGTAT No data
Right 904059517 1:27697082-27697104 GTATTTACGGCTGGGCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904059512 Original CRISPR ATACTTCTCCAGCTCTCTAT TGG (reversed) Intergenic
No off target data available for this crispr