ID: 904068896

View in Genome Browser
Species Human (GRCh38)
Location 1:27777528-27777550
Sequence CAGTACAAGGGGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904068896_904068901 8 Left 904068896 1:27777528-27777550 CCTGCCTCTTTCCCCTTGTACTG 0: 1
1: 0
2: 0
3: 32
4: 317
Right 904068901 1:27777559-27777581 ATACCATATCCTATGACCCTAGG 0: 1
1: 0
2: 0
3: 1
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904068896 Original CRISPR CAGTACAAGGGGAAAGAGGC AGG (reversed) Intronic
900170253 1:1264429-1264451 CAGAGCAAGGGGAAAGATGATGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
902441881 1:16435779-16435801 CAGTATAAATGGACAGAGGCAGG - Intronic
902754033 1:18537476-18537498 CAGTGGATGGGGAAAGATGCTGG - Intergenic
902779213 1:18693634-18693656 GACCCCAAGGGGAAAGAGGCGGG + Intronic
903758912 1:25684198-25684220 CAGTATCGGGGGAGAGAGGCAGG - Intronic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904460837 1:30678949-30678971 AAGTACAAGACGGAAGAGGCAGG + Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
906156358 1:43616447-43616469 TGGGACAAGAGGAAAGAGGCAGG + Intronic
907116879 1:51976816-51976838 CAGTACAAGGGCTTAGAGGTGGG - Intronic
907133458 1:52117776-52117798 CAGTACAAGTGTAAAGGGGAAGG + Intergenic
907246741 1:53113816-53113838 CAGCAGAAGGGGTGAGAGGCAGG - Intronic
907874965 1:58476870-58476892 CAGTACATGGAGGAAGAGGACGG + Intronic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
909819747 1:80047028-80047050 CAGTTCCAGGGGAGAGAAGCAGG - Intergenic
910162056 1:84283729-84283751 CAGCACAAGGAGACAGAAGCTGG - Intergenic
910969117 1:92836689-92836711 AAGTGCATGGGGAAAGAGGATGG - Intronic
912516178 1:110217875-110217897 CAGTCCCGGGGGTAAGAGGCAGG - Intronic
913254431 1:116941057-116941079 AAGCACAAAGGGAGAGAGGCAGG - Intronic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915929642 1:160051889-160051911 CAATACAAAGGCAAAGAGGGAGG - Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917377045 1:174359934-174359956 CAGTACTTGGCCAAAGAGGCTGG - Intronic
917719256 1:177770500-177770522 CTGTACAAGGGAACAGAGGTTGG + Intergenic
919915412 1:202135795-202135817 ATGTACCTGGGGAAAGAGGCAGG + Exonic
921115757 1:212089550-212089572 CAGTACAGAGGGGAAGAGGGTGG - Intronic
922599154 1:226836543-226836565 AAGTAAAGGCGGAAAGAGGCTGG - Intergenic
923501194 1:234566191-234566213 CAGTACAAAGGGAAGGATTCTGG - Intergenic
924052440 1:240092359-240092381 CTGTCCAAGGGGAAAGGCGCCGG + Exonic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1065817276 10:29493591-29493613 CAGTAAAATGGGAGAGAGGGAGG + Intronic
1065955575 10:30690886-30690908 CAGTAAAACGGGAGAGAGGGAGG - Intergenic
1066574495 10:36810683-36810705 CAGCACAAGGGAGAAGAGGCAGG + Intergenic
1067348789 10:45457035-45457057 CACTACCAGGGCCAAGAGGCAGG - Exonic
1069154436 10:65009263-65009285 CATTTCAAGGCGAAAGAGTCAGG - Intergenic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1071479427 10:86053744-86053766 CAGGGAAAGGGGAAAGATGCAGG + Intronic
1074683312 10:115933230-115933252 CATTACAAGAGTAAAGAGACTGG - Intronic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1078004395 11:7521781-7521803 CAGTAAAGAGGGAAAGGGGCTGG + Intronic
1079939499 11:26660741-26660763 CAGTGTAATGGGAAAGAGGGTGG + Exonic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1083083530 11:60118511-60118533 CAGTAGATGGGGTAAGAGCCTGG + Intergenic
1083393719 11:62374062-62374084 AAGTACAAGGCGATCGAGGCTGG - Intronic
1083815095 11:65128222-65128244 TAGGCCAAGTGGAAAGAGGCTGG - Exonic
1084126264 11:67101046-67101068 CAGCACAAAGGGACTGAGGCAGG - Intergenic
1085823533 11:79818572-79818594 CTCTACAAGGTGCAAGAGGCTGG + Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087054196 11:93917610-93917632 CAGTAAAGGGGGAAAAAGTCAGG + Intergenic
1088822969 11:113472297-113472319 AAGTATAAGGGGAAAGACGTGGG - Intronic
1089690564 11:120184499-120184521 CAGGACTTGGGAAAAGAGGCTGG - Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090673306 11:128966396-128966418 CATTAGAAAGGGAAAGATGCCGG + Exonic
1091177291 11:133572829-133572851 CACTACTAGGGAGAAGAGGCAGG - Intergenic
1092310671 12:7348220-7348242 CTGTGCAAGGGGAAAGAGCATGG + Intronic
1092572982 12:9745469-9745491 CTGTAAAACTGGAAAGAGGCTGG + Intergenic
1092647438 12:10591464-10591486 CAGTTCAAAGGGAAAGAGATGGG - Intergenic
1092961454 12:13600212-13600234 GAGTATGAGGGGAAAGAGGAAGG - Intronic
1093099271 12:15007875-15007897 CAGTGGAATGGGAAAGAGGTTGG + Intergenic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1096256470 12:50064987-50065009 CAGAACAAGGGGGAACATGCTGG + Intronic
1096499751 12:52057501-52057523 GAGGACAAGGGCAGAGAGGCAGG - Exonic
1097012765 12:55965221-55965243 CATTAGAAAGGGAATGAGGCCGG - Intronic
1099019252 12:77382616-77382638 CAGTACAAGAGGGAAAAGGAGGG - Intergenic
1101255248 12:102970936-102970958 CAGCACAAACGGAAAGAGACTGG - Intergenic
1101965715 12:109280614-109280636 CAATCCAGGGGGAAAGAGGCAGG + Intronic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1103200131 12:119081492-119081514 GAGAACAAGGGGAAAGGAGCAGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103522848 12:121547935-121547957 CTCTGAAAGGGGAAAGAGGCCGG - Intronic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107869400 13:44733318-44733340 CAGTAAAATAGAAAAGAGGCAGG + Intergenic
1107952154 13:45473163-45473185 CATTACAAGAGGAAACAGGCCGG - Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1112763237 13:102713793-102713815 CAGTAAAAGAGGCAAGAGGAGGG + Intergenic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1115500911 14:34049012-34049034 CACTACAGCGGGATAGAGGCAGG - Intronic
1117285114 14:54279288-54279310 AAGTATGAGGGGAAAGGGGCTGG - Intergenic
1118322466 14:64761380-64761402 CTGAACAGGGGGAAAGAGCCAGG + Intronic
1118335601 14:64851202-64851224 CAGTACAAGGATTAAGAGGCAGG + Intronic
1119216152 14:72870776-72870798 CATTAAAAGGGTAACGAGGCTGG + Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1123997206 15:25727240-25727262 CATGACAACGGGAAAAAGGCCGG - Exonic
1124869353 15:33525202-33525224 CAGTACAACAGGAGAAAGGCGGG - Intronic
1125043519 15:35220583-35220605 CTGTGAAAGGGCAAAGAGGCAGG + Intronic
1126498419 15:49318093-49318115 CAGGCCTAGGGGAAAGAGACAGG - Intronic
1127168698 15:56275615-56275637 TAGCACAAAGGGCAAGAGGCTGG - Intronic
1128568886 15:68719016-68719038 CAGTGCAAAGGCATAGAGGCAGG + Intronic
1128804282 15:70519077-70519099 CATTCTAAGGGGAAAAAGGCAGG - Intergenic
1130801900 15:87273268-87273290 CACTACAAGCTGGAAGAGGCAGG + Intergenic
1131311620 15:91295878-91295900 CACTGCAAGTGGAATGAGGCAGG - Exonic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132758978 16:1499875-1499897 CAGTTCAAAGGAATAGAGGCGGG + Intronic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1133075479 16:3277285-3277307 CTGTCCAAGGAGAAAGAGGGGGG + Intronic
1133443285 16:5838291-5838313 GTGTACATGTGGAAAGAGGCAGG - Intergenic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134850928 16:17478295-17478317 TAGGACAAGGGGAAACAGGCTGG + Intergenic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1135979366 16:27135271-27135293 CAGAACAAGGGGGAAAAGGCCGG + Intergenic
1136146162 16:28317779-28317801 CAGCCCAGGGGGAAAGAGACTGG + Intronic
1136253761 16:29024628-29024650 CAGTCCAGGGGGAAAGAAGGTGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1137575869 16:49600022-49600044 AATTAAAAGGGGCAAGAGGCCGG + Intronic
1137899762 16:52254327-52254349 AAATTGAAGGGGAAAGAGGCAGG + Intergenic
1138182991 16:54955447-54955469 CAGTACAAAGGGACTGAGGTGGG + Intergenic
1138352595 16:56353880-56353902 GTGTACAAGGGGCAAGGGGCAGG - Intronic
1139952148 16:70677700-70677722 CAGTAAAGGGGAAAAGAGGATGG - Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141872059 16:86793845-86793867 TAGCGCAAGGGGAAATAGGCTGG + Intergenic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1144241250 17:13314819-13314841 CAGTACAAGAGGAAAGACATTGG - Intergenic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1145086299 17:19944135-19944157 CAGTACACGGGTAGAGATGCAGG - Intronic
1145957094 17:28862048-28862070 CAGGGCAAGGGTTAAGAGGCAGG - Intergenic
1146195932 17:30812836-30812858 GAGGACAAGGGGAAAGAGACAGG + Intronic
1147788102 17:42994817-42994839 CAGGACAAGGGAGGAGAGGCAGG + Intergenic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149406546 17:56357507-56357529 CAGTAGAAAGGGAGAGATGCAGG - Intronic
1151295154 17:73179866-73179888 CAATTCAAGGGGAAAGACCCAGG + Intergenic
1152122055 17:78424885-78424907 GGGTTCAAGGGAAAAGAGGCTGG - Intronic
1152184260 17:78844281-78844303 CAGTACCAGGGGAGCGATGCAGG - Intergenic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153717247 18:7862612-7862634 AAGTAAAATGGGAAAGAGGAAGG + Intronic
1154139612 18:11811319-11811341 GAGGACATGGTGAAAGAGGCTGG - Intronic
1155559786 18:27063113-27063135 CAGTCCCAGGGGAAAGAAGGGGG + Intronic
1156927554 18:42600670-42600692 TACTAAAAGGGGAAAGAGGGAGG - Intergenic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158610127 18:58932175-58932197 AAGCACAAGGAGAAAGAGGGAGG - Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1162667244 19:12224341-12224363 GAGTTAAAGAGGAAAGAGGCTGG + Intergenic
1162826082 19:13253097-13253119 TAGAACTAGGGGAAAGAAGCAGG + Exonic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165685202 19:37813750-37813772 CACCACAAGGGAAAAGAGGTGGG + Intronic
1165984465 19:39755914-39755936 GAGTAGAGGGGGAAAGAGGTAGG - Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
927273449 2:21239369-21239391 CAGTACAAGAGGTAAGAAGTAGG - Intergenic
927699104 2:25256743-25256765 AAGTACAAGGGGAGTGTGGCAGG - Intronic
928221773 2:29409312-29409334 CAGTAGAAGGAGAAAAAGGAAGG - Intronic
928401678 2:30983469-30983491 CATTACCTGGGGAATGAGGCAGG - Intronic
933721052 2:85398084-85398106 CAGTTCAAGGGCAAATGGGCTGG + Exonic
934560970 2:95313140-95313162 CAGTACAAGGGCACAGTGTCTGG - Intronic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
935868030 2:107413010-107413032 CAATACTAGGAGAAAGAGACGGG + Intergenic
937151146 2:119686676-119686698 CAGTACTAGGGGGATGAGGTGGG - Intergenic
937815277 2:126244253-126244275 CAGTACAAAGGGTTGGAGGCTGG - Intergenic
937936142 2:127247112-127247134 CCTTACAAAGTGAAAGAGGCCGG + Intergenic
937981708 2:127619705-127619727 GAGTATTAGGGGAAAGATGCTGG + Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943278551 2:185900202-185900224 CATTATGAGGGGACAGAGGCTGG + Intergenic
943988117 2:194649288-194649310 CAGTACTAGGAGAGACAGGCAGG - Intergenic
945606833 2:211943652-211943674 AAGTAGAGGGGGAAAGAGGCAGG - Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946124089 2:217544476-217544498 GAGTACAAGGGAAGAGAGGCTGG + Intronic
946371569 2:219284730-219284752 CTGTCCAAGGGGCATGAGGCAGG - Exonic
946445167 2:219733291-219733313 CAGTACAAGTTGAGAAAGGCAGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
1168910652 20:1444150-1444172 GAGAACGAGGGGAAAGAGGGTGG - Intronic
1169800455 20:9507595-9507617 CTGGACCAGGGGAGAGAGGCCGG + Intergenic
1170204717 20:13785410-13785432 CAGTAGAGGCCGAAAGAGGCAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170952268 20:20947672-20947694 CAGTTCTCTGGGAAAGAGGCAGG - Intergenic
1171312009 20:24152097-24152119 GAGCACAATGGGAATGAGGCTGG + Intergenic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172752638 20:37261624-37261646 CAGTCCATGGGCAAAGAGGATGG + Intronic
1173134812 20:40430128-40430150 TAAAACAAGAGGAAAGAGGCCGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174572451 20:51511717-51511739 CAGTACCAGGGGAAAGATCAAGG - Intronic
1174696582 20:52565604-52565626 CAGTACAAGGGTGAGGTGGCTGG + Intergenic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176873693 21:14104827-14104849 CATTACAAGGTGATAGACGCAGG - Intergenic
1178318215 21:31584822-31584844 CAGCACAAGGGAAACGAGGATGG + Intergenic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178553373 21:33562031-33562053 AAATACAAGGGCAAAGAGGCAGG + Intronic
1178771587 21:35509719-35509741 CAGTACAAGGTGGCAGAGGTTGG - Intronic
1179802819 21:43819490-43819512 CAGTCCCAGGGGAGAGAGGAGGG + Intergenic
1179986384 21:44923233-44923255 CAGTACAAGAGGAGAGACGAAGG + Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183929518 22:41228010-41228032 AAGGGCAAGGGGAAAGAGACAGG - Intronic
1183947641 22:41335768-41335790 CAGTTCCAGGGGACAGAGTCAGG + Intronic
1184118919 22:42437934-42437956 CAGCACGAGGGGAAAGGGCCGGG - Intergenic
1184129200 22:42507622-42507644 CAGTACTTTGGGAAACAGGCGGG - Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
949697474 3:6715798-6715820 CAGTCCCAGGGGACTGAGGCAGG - Intergenic
950062802 3:10086275-10086297 CAAGACAAGGGGAAAGAAACAGG - Intronic
950443304 3:13022324-13022346 CAGGACCAGGGCACAGAGGCTGG - Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
953115906 3:39992254-39992276 CATTGCATGGGGAAAGAGTCCGG - Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953572363 3:44081275-44081297 CAGTGCAAGCGGAGAGAGACAGG + Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
955832833 3:63022986-63023008 CAGCACCAGTGGAAAGAAGCAGG - Intergenic
957239420 3:77639124-77639146 AAGAACTAGGGGAAAGGGGCCGG - Intronic
960023871 3:112987194-112987216 AAGTACAAGGACACAGAGGCAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
963837413 3:150071054-150071076 CTGGACAAGGGGAGAGTGGCAGG + Intergenic
964718356 3:159746695-159746717 CAGGATATAGGGAAAGAGGCTGG - Intronic
965104721 3:164341646-164341668 TATTACAAGGTGATAGAGGCGGG + Intergenic
966826343 3:183968031-183968053 CAGCAGAATAGGAAAGAGGCTGG - Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
970390202 4:15601649-15601671 AAGTACAAAGGAATAGAGGCAGG - Intergenic
972610307 4:40650183-40650205 CAGTAGAAGGGCAAAGAAGGTGG - Intergenic
973020928 4:45205772-45205794 CAGTTCCAGGAGAAAGAGACAGG - Intergenic
973189958 4:47375644-47375666 CATTACAAGGGAAAAGAGCATGG + Intronic
973795625 4:54423201-54423223 CAGTACAAGGGTAAAATGTCAGG + Intergenic
975801736 4:78067233-78067255 CATTAAAAGGGGAAAGAGTATGG - Intronic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
982807638 4:159786393-159786415 CAGTACAGGGAGAAAGATGTAGG - Intergenic
983940025 4:173528656-173528678 CAGCCCAATTGGAAAGAGGCCGG + Intronic
984189552 4:176589019-176589041 TAGTAGAAGGAGAAAGAGGAAGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985038667 4:185866882-185866904 CAGAACAAGGGAATAAAGGCAGG + Intronic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
988920624 5:35938363-35938385 CAGTGCAAGAGGAAAGAGCTTGG - Intronic
989629656 5:43468237-43468259 TATTACAAGGTGAAAGACGCGGG + Intronic
990527288 5:56640473-56640495 CAGCAGAAGAGGCAAGAGGCTGG + Intergenic
990660068 5:58003363-58003385 CACTACAAGAGGAAACAGACTGG + Intergenic
991469760 5:66955348-66955370 AAGTGCAAAGGGCAAGAGGCAGG + Intronic
992365138 5:76083275-76083297 CAGCACCAGGGGGAGGAGGCAGG + Exonic
992502697 5:77357745-77357767 CAGTACTACAGGAAAGAGGCAGG + Intronic
993150136 5:84151413-84151435 CAGTCCAAATGAAAAGAGGCAGG + Intronic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
996882595 5:128317069-128317091 CAGTGCAAGGGGCATGTGGCAGG - Intronic
997006862 5:129827412-129827434 GAATACAAGAGGGAAGAGGCAGG + Intergenic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
998301791 5:141029107-141029129 CAGTACAAGAGAACAAAGGCAGG - Intergenic
1000154252 5:158535086-158535108 CAGAACCAGGGAAAAGGGGCAGG - Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001306186 5:170575040-170575062 CAGTACAAGGCAGTAGAGGCAGG + Intronic
1003955514 6:11161870-11161892 CTGTACAGGAGGAAAGAGCCTGG + Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005627088 6:27672887-27672909 GAGTACAAAGTGAGAGAGGCAGG - Intergenic
1007309007 6:40930338-40930360 CTGCACAAGGGCAAAGAGGGAGG - Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008251443 6:49245043-49245065 CAATACACCAGGAAAGAGGCAGG + Intergenic
1009320941 6:62287062-62287084 CAGTACCTGGTGAAAGAGACTGG - Intergenic
1009395992 6:63201783-63201805 AATTAAAAGGGGCAAGAGGCTGG + Intergenic
1009751912 6:67886207-67886229 AAGTAAAAGTGAAAAGAGGCTGG + Intergenic
1009964285 6:70562485-70562507 CAGTATAATAGGAAAGAAGCTGG + Intergenic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1011101957 6:83732010-83732032 GAAAACAAGGGGAAAGAGACAGG + Intergenic
1013354137 6:109332467-109332489 CAGCTCAAGGGGAGAGAGGCTGG - Intergenic
1013463929 6:110400501-110400523 CTGTAGAAGGGGGCAGAGGCAGG - Intronic
1014416505 6:121190901-121190923 TAGTACTAGGAGAAAGTGGCGGG - Intronic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1015096700 6:129423315-129423337 CAGTACAAGGGGCAAGAAAAAGG + Intronic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015437677 6:133208410-133208432 AATTGGAAGGGGAAAGAGGCAGG - Intergenic
1015605583 6:134952057-134952079 CAGTAGAAGAGGACAGAAGCCGG + Intergenic
1015626196 6:135182450-135182472 CGGCTCAAGGGGACAGAGGCCGG + Intronic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016374037 6:143402318-143402340 CAGGACAACGGGAAAGTGGGGGG + Intergenic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1017611459 6:156190789-156190811 CAGCACAAGGTGAAGAAGGCCGG - Intergenic
1018028819 6:159826201-159826223 AAGTACCAGGGGACAGAGGAGGG - Intergenic
1018666147 6:166140393-166140415 CAGTAGCAGGGGACAGAGCCAGG - Intergenic
1019015496 6:168877015-168877037 CAGTGCAAGAGGACAGAGGGAGG + Intergenic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020539792 7:9446653-9446675 TAGTACAAGGGGATAGATCCAGG - Intergenic
1020750675 7:12137281-12137303 GAGTCCAAAGTGAAAGAGGCAGG + Intergenic
1021819272 7:24480179-24480201 CAGAGCAGGGGGAAATAGGCAGG - Intergenic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1023230528 7:38023122-38023144 CAGTCCAAGGGGGCTGAGGCAGG - Intronic
1024558784 7:50626626-50626648 AAGTACTAGGGGAAAGGGGCTGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028171230 7:87599586-87599608 CAAGACTAAGGGAAAGAGGCCGG + Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1030329927 7:108260419-108260441 AGGTACAAGGGGAGAGATGCTGG + Intronic
1032183828 7:129706071-129706093 CAGAACAAAGGCAAAGAAGCGGG + Intronic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1033476640 7:141699226-141699248 CAGTAAAGGGGGGAAGATGCTGG + Intronic
1034218800 7:149428757-149428779 CAGAACAAGGGGAGAGACGATGG + Intergenic
1035161494 7:156953527-156953549 CAATACAAGGGGGAAGGGGGTGG - Intronic
1036009890 8:4709779-4709801 AAGTCACAGGGGAAAGAGGCAGG + Intronic
1036965078 8:13288733-13288755 CAATAAAGGGGGAAAGGGGCAGG - Intronic
1037929437 8:22869088-22869110 CAGTACAAAGGCCATGAGGCAGG - Intronic
1038534337 8:28343190-28343212 CCCTAGAAGGGGCAAGAGGCGGG - Exonic
1038867681 8:31457295-31457317 CAGGACAAGTGGAAAGATACAGG - Intergenic
1039253904 8:35697526-35697548 GAGTACAATGCTAAAGAGGCTGG - Intronic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1041178431 8:55221873-55221895 CAGTTCATGAGGAAAGAGGAGGG + Intronic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1042631776 8:70825192-70825214 AAGTGCAGGGGGATAGAGGCAGG - Intergenic
1042991079 8:74640537-74640559 CAATTCAAAGAGAAAGAGGCAGG + Intronic
1044423478 8:92025243-92025265 GATTACAAGAGGAGAGAGGCAGG - Intronic
1044590818 8:93913149-93913171 CAGTCACAGGGGAAAGAGGCTGG - Intronic
1045977542 8:108146751-108146773 GAGTGCAAGGGGTAAGAGGAAGG - Intergenic
1047330980 8:123886520-123886542 AAGTACAAGGGGCATAAGGCTGG - Intronic
1047455617 8:125007455-125007477 CAGTACAAGGATAAAGAGACTGG + Exonic
1047948846 8:129910952-129910974 CAAAACAATGGGAGAGAGGCCGG - Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049340456 8:142109566-142109588 CAGAACCAGGGCAAAGAGCCTGG + Intergenic
1050000583 9:1073162-1073184 CAGTACAAGGGGACAGTAGGTGG - Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1052867200 9:33471483-33471505 CAGTACAAAGGCACAAAGGCAGG - Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG + Intergenic
1058771668 9:108240021-108240043 CATTACTAGGGGAATAAGGCTGG - Intergenic
1059181116 9:112213304-112213326 CAGTAGAAAGGGAGAGGGGCAGG + Intergenic
1060621539 9:125071719-125071741 CAGTGAAAGGGAAAAAAGGCAGG + Intronic
1060763976 9:126280056-126280078 TAGCACAAGGGGAAAAGGGCAGG + Intergenic
1061923574 9:133795203-133795225 CCGGACAAGGGGAGAGAGGGAGG + Intronic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1188770599 X:34148623-34148645 CAGTTCAGGGGGAGAGTGGCTGG + Intergenic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1192321734 X:70095418-70095440 CAATACAGGGGGTGAGAGGCTGG - Intergenic
1198073983 X:133177320-133177342 CTGTCCAAGGGGACAAAGGCAGG + Intergenic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1199910686 X:152283560-152283582 GAGTACAAAGGGGAAAAGGCTGG - Intronic
1200259125 X:154602613-154602635 CAGTGCAACGCGAAAGTGGCTGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic