ID: 904070757

View in Genome Browser
Species Human (GRCh38)
Location 1:27795093-27795115
Sequence CCCACGACAGGGAAGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904070757_904070761 -5 Left 904070757 1:27795093-27795115 CCTTTCAACTTCCCTGTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 904070761 1:27795111-27795133 GTGGGTTGTTTTTCAAAGTATGG 0: 1
1: 0
2: 0
3: 20
4: 199
904070757_904070762 -4 Left 904070757 1:27795093-27795115 CCTTTCAACTTCCCTGTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 904070762 1:27795112-27795134 TGGGTTGTTTTTCAAAGTATGGG 0: 1
1: 0
2: 1
3: 16
4: 294
904070757_904070763 2 Left 904070757 1:27795093-27795115 CCTTTCAACTTCCCTGTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 904070763 1:27795118-27795140 GTTTTTCAAAGTATGGGTTGTGG 0: 1
1: 0
2: 4
3: 39
4: 361
904070757_904070764 9 Left 904070757 1:27795093-27795115 CCTTTCAACTTCCCTGTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 904070764 1:27795125-27795147 AAAGTATGGGTTGTGGCTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904070757 Original CRISPR CCCACGACAGGGAAGTTGAA AGG (reversed) Intronic
901166532 1:7225507-7225529 CCCAGGAAAGGGAAGTTCCAAGG - Intronic
902148644 1:14424635-14424657 CCCACGAAAGGGACCTTGTAAGG + Intergenic
903203009 1:21758672-21758694 CCCAGGACACGGAGGTTGCAGGG + Intronic
903400002 1:23036215-23036237 ACCACCACAGGGAAGATGATAGG + Intronic
904070757 1:27795093-27795115 CCCACGACAGGGAAGTTGAAAGG - Intronic
910958770 1:92738008-92738030 CCCAAGAAAGAAAAGTTGAATGG + Intronic
914856469 1:151355375-151355397 CTCTTGACAGGGAAGTTGTAAGG - Intergenic
915616320 1:157042283-157042305 CCCAAGACAGAAAAGTAGAAGGG + Intronic
916170854 1:162000603-162000625 CCCACAACAGGTAAGTGGTAAGG + Intronic
920212722 1:204340152-204340174 CCCAGGACAGGGAAAGGGAAGGG + Intronic
923431674 1:233928076-233928098 CCAAGAACAGGGAAGTTGGAAGG - Intronic
1063803939 10:9615657-9615679 CAAAAGAGAGGGAAGTTGAAGGG + Intergenic
1071752748 10:88499584-88499606 CCCAAGACAGGGGAGGTGAGAGG - Intronic
1074542523 10:114376998-114377020 CCCAACACAGGGAAGGTGAAGGG + Intronic
1076675908 10:132147654-132147676 CCCTGGACAGGGATGTGGAAGGG - Intronic
1078414680 11:11155765-11155787 CCCAGGACAAGGAAGTGGCAAGG + Intergenic
1079340144 11:19605000-19605022 CCCAAGACAGGGAAGAAAAATGG - Intronic
1081655836 11:44856929-44856951 CCCAGGACAGGTAAGTTTTATGG - Intronic
1083448779 11:62728434-62728456 CCCCCGACCTGGAAGTAGAAGGG - Intronic
1084468636 11:69342260-69342282 GCCACGACAGGGGAGTGGAAGGG + Intronic
1086062726 11:82717162-82717184 CCCAGCTCAGGGAAGTTGAGTGG - Intergenic
1087480564 11:98694381-98694403 CCTAGGAGAGGCAAGTTGAAAGG - Intergenic
1087492649 11:98847734-98847756 TACAAGACAGGGATGTTGAAGGG - Intergenic
1088057146 11:105597791-105597813 CAGAGGACAGGGAAGTTGAGTGG + Intergenic
1090985531 11:131762600-131762622 CCCACGCCAAGGAAGGGGAAGGG - Intronic
1091289158 11:134427667-134427689 CCCACGAAAGGGAAGGTGCCTGG - Intergenic
1096517561 12:52165561-52165583 CCCAAGGGAGGGAAGTGGAAGGG - Intergenic
1103026141 12:117575850-117575872 CCCACCACAGGGCTGTTGGAAGG - Intronic
1104277980 12:127347478-127347500 CCCACAATAGGGAAGGAGAAGGG + Intergenic
1106779135 13:33039422-33039444 CCCACAACAATAAAGTTGAATGG - Intronic
1107407889 13:40131935-40131957 CCCAGGACTGGGAGGTTGAGGGG - Intergenic
1112241123 13:97682266-97682288 GCCACTGCAGGGAAGATGAAGGG + Intergenic
1112343033 13:98568073-98568095 CCCAGGAGACGGAAGTTGCAGGG - Intronic
1125523684 15:40362220-40362242 CCCATGACAGGGTAGGTGGAGGG + Intronic
1129467109 15:75730392-75730414 CCGACTCCAGGGAAGATGAATGG + Intergenic
1129720120 15:77873327-77873349 CCGACTCCAGGGAAGATGAATGG - Intergenic
1132932642 16:2466860-2466882 CCTGCGACAGGGAAGATGACCGG + Intergenic
1141322574 16:83025708-83025730 CCCAAGAAAGGGAAGTTTTAAGG - Intronic
1143571550 17:7762238-7762260 CACACGCCAGGGCAGTTCAATGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1151662227 17:75525232-75525254 CCCACGAGAGGGATGGTGTAGGG - Intronic
1153003591 18:478134-478156 TCCACAACACAGAAGTTGAAAGG + Intronic
1153584228 18:6604756-6604778 CCCAGGACAGGAAATTTGACAGG - Intergenic
1155604948 18:27594343-27594365 GCCACGAAAGGGAAGGTGCAAGG - Intergenic
1156355880 18:36339570-36339592 CCCACCACAGGGAAGTAGGGAGG - Intronic
1163126587 19:15247491-15247513 CCCTGGACAGCGAGGTTGAAAGG + Intronic
1167373766 19:49100504-49100526 CCAAGGACAGGGAAGTTCTAAGG - Intronic
928458337 2:31445667-31445689 CTCACAACAGGCAACTTGAAGGG + Intergenic
931629683 2:64287455-64287477 CCCAAGACTGGGAAGGTGATGGG - Intergenic
937428018 2:121815919-121815941 TCCTCGACAGGGAAGGTGATGGG + Intergenic
941548646 2:166886536-166886558 CCCAGGAGAGTGAAGATGAATGG - Intergenic
941927037 2:170906141-170906163 CCCCAGACAGAGAAGCTGAAGGG + Intergenic
946273751 2:218615303-218615325 CCCAGAATAGGGAAGCTGAAAGG + Intronic
947436051 2:230073265-230073287 GCAAGGACAGGGAAATTGAAGGG + Intergenic
947805292 2:232962471-232962493 CCCAGGAGATGGAGGTTGAAGGG + Intronic
1172891451 20:38268758-38268780 CCCAGAACAGGGAGGCTGAAGGG + Intronic
1178020231 21:28399687-28399709 CCCAAGACTGGGAAGATAAAAGG - Intergenic
1178891899 21:36526908-36526930 CCCGAGACGGGGATGTTGAATGG + Intronic
1178907497 21:36648746-36648768 CCCAGGAGACGGAAGTTGCAGGG + Intergenic
1179365473 21:40755076-40755098 CCCACAACATGGAAGAGGAAGGG + Intronic
1181958519 22:26605788-26605810 CCCACGACAGGGGGCTGGAAAGG + Intronic
949316743 3:2764912-2764934 CACACAGCTGGGAAGTTGAAGGG + Intronic
949450954 3:4184378-4184400 CCCAGGAGACGGAAGTTGCAGGG + Intronic
953576682 3:44118245-44118267 TTCACAACAGGGAAGTTGGAAGG + Intergenic
958797728 3:98723937-98723959 CCCAAGACTGAGAAGTAGAATGG + Intergenic
960737983 3:120801391-120801413 CCCTGGACAGGGAAGTTGGGTGG + Intergenic
967890872 3:194363650-194363672 GCCACGTCAGGGCAGTTGCAGGG - Intronic
968239815 3:197068310-197068332 CCCACTATAGGGTAGTTGAGTGG - Intronic
968930358 4:3575670-3575692 CCCAGGCCAGGGAGGTCGAAGGG - Intergenic
970596660 4:17606412-17606434 CCCAGGACGGGGAGGTTGCAGGG - Intronic
975464237 4:74691665-74691687 CCTTCAACAGGGAAGTGGAAAGG - Intergenic
989639017 5:43565303-43565325 CCTAAGACAGGGAAGGTTAAAGG + Intergenic
990697246 5:58433875-58433897 CCCACAACAGTGATGTTGAAAGG - Intergenic
1000923920 5:167171008-167171030 CCCACGACAGAGCTGTGGAAGGG - Intergenic
1006117904 6:31785042-31785064 GCCAAGACAGGGAACATGAAGGG + Intronic
1006448551 6:34092900-34092922 CCCAGGACAGGGAAGGGGTATGG + Intronic
1007951699 6:45878343-45878365 GTCTCCACAGGGAAGTTGAAAGG - Intergenic
1010587415 6:77670611-77670633 CCAAGGAGAGGGAAGTTGAAAGG - Intergenic
1014890237 6:126835425-126835447 GCCAAGACAGCCAAGTTGAAAGG - Intergenic
1017879336 6:158548883-158548905 CCCAAGGCAGAGAAGGTGAAGGG + Intronic
1021365631 7:19773846-19773868 CCTACGACACGGAAGGTGACAGG - Intergenic
1021844645 7:24752621-24752643 ACCAAGAGAGGGAATTTGAAAGG + Intronic
1022466638 7:30656582-30656604 CCCTAGACAGGGAAGATGGATGG + Intronic
1024027449 7:45424697-45424719 CTCACGACATTGAAGTGGAAGGG - Intergenic
1026182985 7:68058521-68058543 TCCTCGACAGGGAGGTTGATAGG - Intergenic
1032179675 7:129664047-129664069 CCCAGGGCAGGGAGGTTGCAGGG + Intronic
1033133569 7:138766276-138766298 CCCAGGAGAGGGAGGTTGCAGGG - Intronic
1043950967 8:86308737-86308759 CCCAGGTCAGGGGAGTAGAATGG - Intronic
1045469964 8:102503696-102503718 CCCACAACTGGGTAGCTGAAGGG - Intergenic
1045741425 8:105364982-105365004 CCCAGGACAGAAAAGTTTAATGG - Intronic
1048934835 8:139346170-139346192 CCCAGGAAAGGGGAGATGAATGG + Intergenic
1051411276 9:16792024-16792046 CCCAGGAGACGGAAGTTGCAAGG + Intronic
1055893740 9:81151479-81151501 CCCAGGACATGGAGGTTGCAGGG + Intergenic
1057138625 9:92713386-92713408 GCCACGAGAGGGAAGGGGAAGGG + Exonic
1060944640 9:127562705-127562727 TCTTCGACAGGGAAGTTGACTGG + Intronic
1185786625 X:2896531-2896553 CCCACGAGGTGGAAGTTGCAGGG + Intergenic
1186012350 X:5148622-5148644 CCCAGGACAGGGAGGTTGCAGGG + Intergenic
1187249208 X:17581738-17581760 ACCACGAAGGGGAAGGTGAAAGG - Intronic
1191793233 X:64993277-64993299 ACCAAGACAGGGAGCTTGAAGGG - Intronic
1195328875 X:103780306-103780328 CCCACGAATGGGAAGATGAAAGG - Intronic
1199104589 X:143848902-143848924 CTCACTACAGGGAAGCTGATTGG + Intergenic
1200885634 Y:8266051-8266073 CCCACAACAGGTAAGTTCAGAGG + Intergenic
1200987184 Y:9314504-9314526 CCCACAACAGGTAAGTTCAGAGG + Intergenic
1201058861 Y:10024088-10024110 CCCACAACAGGTAAGTTCAAAGG + Intergenic
1202118405 Y:21498136-21498158 CCCACAACAGGTAAGTTCAGAGG - Intergenic
1202120857 Y:21521676-21521698 CCCACAACAGGTAAGTTCAGAGG - Intronic
1202123308 Y:21545217-21545239 CCCACAACAGGTAAGTTCAGAGG - Intronic
1202155698 Y:21884164-21884186 CCCACAACAGGTAAGTTCAGAGG + Intronic
1202158146 Y:21907705-21907727 CCCACAACAGGTAAGTTCAGAGG + Intronic
1202184599 Y:22172630-22172652 CCCACAACAGGTAAGTTCAGAGG + Intronic
1202206761 Y:22413771-22413793 CCCACAACAGGTAAGTTCAGAGG - Intronic