ID: 904079242

View in Genome Browser
Species Human (GRCh38)
Location 1:27861730-27861752
Sequence CTGCATTTAGGAAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904079238_904079242 13 Left 904079238 1:27861694-27861716 CCTGGAAGTGTTGAAGCAGGAGG No data
Right 904079242 1:27861730-27861752 CTGCATTTAGGAAGAGCAGAGGG No data
904079236_904079242 24 Left 904079236 1:27861683-27861705 CCATGGGGAGTCCTGGAAGTGTT No data
Right 904079242 1:27861730-27861752 CTGCATTTAGGAAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904079242 Original CRISPR CTGCATTTAGGAAGAGCAGA GGG Intergenic
No off target data available for this crispr