ID: 904081029

View in Genome Browser
Species Human (GRCh38)
Location 1:27872683-27872705
Sequence CACCAAGGGAGTGCTCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904081029_904081045 19 Left 904081029 1:27872683-27872705 CCCCTCCGAGCACTCCCTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 904081045 1:27872725-27872747 CGGAGAAGACGTTAGCAATCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
904081029_904081042 -1 Left 904081029 1:27872683-27872705 CCCCTCCGAGCACTCCCTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 904081042 1:27872705-27872727 GTGGGGCGGGGGCAGAGACCCGG 0: 1
1: 0
2: 6
3: 80
4: 858
904081029_904081046 20 Left 904081029 1:27872683-27872705 CCCCTCCGAGCACTCCCTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 904081046 1:27872726-27872748 GGAGAAGACGTTAGCAATCCGGG 0: 1
1: 0
2: 0
3: 8
4: 83
904081029_904081047 21 Left 904081029 1:27872683-27872705 CCCCTCCGAGCACTCCCTTGGTG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 904081047 1:27872727-27872749 GAGAAGACGTTAGCAATCCGGGG 0: 1
1: 0
2: 2
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904081029 Original CRISPR CACCAAGGGAGTGCTCGGAG GGG (reversed) Intronic
904081029 1:27872683-27872705 CACCAAGGGAGTGCTCGGAGGGG - Intronic
904253049 1:29237994-29238016 CACCAAGGGAGTGTCCCGGGAGG - Intronic
905502920 1:38453731-38453753 CACCAAGGAAGTGCTGTGATGGG + Intergenic
906183183 1:43839038-43839060 CACCAGAGGAGTGCTAGGGGTGG + Intronic
913202672 1:116508514-116508536 CAGCAAGGCAGTGCTGGGACAGG + Intergenic
914902417 1:151717901-151717923 CACTGAGGGCGTGCTCTGAGTGG - Intronic
915059134 1:153165598-153165620 GACCAAAGGAGTTCTGGGAGAGG - Intergenic
916993974 1:170275711-170275733 AACCAAGGGACTGCTCATAGTGG - Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
924567536 1:245211032-245211054 CACCAAGGGAATGCTTGTATAGG + Intronic
1063071989 10:2675958-2675980 CACAAAGGGAGAGCCAGGAGTGG - Intergenic
1069740342 10:70683213-70683235 CACGAAGGGAGTGCTGAGGGCGG - Intronic
1070835029 10:79442709-79442731 CACCAAGGGGCTGGTCGGAGAGG - Intronic
1071329639 10:84546790-84546812 CTCCCAGGCAGTGCTCGAAGGGG - Intergenic
1071911886 10:90245749-90245771 AACCAAGGGAGGGCTGGAAGTGG + Intergenic
1073075624 10:100824566-100824588 CACCAGGGTACTGCACGGAGAGG - Intronic
1074590600 10:114809383-114809405 CACCAAGGCATGGCTTGGAGTGG - Intergenic
1075654774 10:124153482-124153504 CACAAAGGGTGTGGTGGGAGAGG + Intergenic
1077760237 11:5087283-5087305 CACCAAGGGTGAGGTTGGAGCGG + Intergenic
1079186809 11:18245590-18245612 TTCCAAGGGAGGGCTCAGAGAGG + Intronic
1079190033 11:18269620-18269642 TTCCAAGGGAGGGCTCAGAGAGG - Intronic
1080175977 11:29363740-29363762 CACCAAGGGAGTTCTCTTACAGG - Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1088670767 11:112138165-112138187 CAAGAAGGGGGTGCTCTGAGAGG - Intronic
1091545769 12:1500514-1500536 CACAAAGGCTGTGCTCGGGGAGG - Intergenic
1092148551 12:6231583-6231605 CACCAAAGGAATGCCCAGAGGGG - Intronic
1096812036 12:54176903-54176925 GACCAAGGGTGTGCTTGGGGTGG - Intronic
1103302178 12:119936392-119936414 GACAAAGGGAGTGCACGGAGGGG + Intergenic
1106400795 13:29428429-29428451 CGCCAGGGGAGGGCTGGGAGCGG + Intronic
1110654190 13:77977181-77977203 TACCAAGGGATTGGTGGGAGGGG - Intergenic
1112693368 13:101919568-101919590 AACGAAGGGAGGGCTCTGAGAGG - Intronic
1117508357 14:56424629-56424651 CACCCAGGTGGTGCTCGCAGGGG - Intergenic
1121570954 14:94946205-94946227 AACAAAGGGGGTGCTGGGAGAGG + Intergenic
1121822954 14:96986289-96986311 CAGGAAGGGAGGGCTTGGAGAGG - Intergenic
1124646083 15:31438243-31438265 CACCAAAGGAGTGCTACTAGTGG + Intergenic
1127966531 15:63926782-63926804 CATCAAGGGAGTGCTTGGAATGG - Intronic
1128139458 15:65288044-65288066 CAGGAAGGGAGAGCTTGGAGTGG + Intronic
1131387440 15:92018901-92018923 CACCAGGGGAGTGATGGTAGCGG - Intronic
1132502653 16:291458-291480 CACCAAGGCAGGCCTAGGAGGGG - Intronic
1135892323 16:26368391-26368413 CCCCAAGGCAGTGCCGGGAGAGG + Intergenic
1140880906 16:79197313-79197335 CACCAAGGGACTGCTAGAACTGG + Intronic
1142608538 17:1095632-1095654 CACCACTCGAGTTCTCGGAGAGG + Intronic
1143407521 17:6687253-6687275 CACCAGGGGAGTCCTTGGAAGGG - Intronic
1154001094 18:10482997-10483019 CACCAAGTGGGTGCACTGAGTGG + Intronic
1157294989 18:46435823-46435845 CAGCAAGGCAGTGCTGGGTGGGG + Intronic
1157310911 18:46552577-46552599 CCCCAAGGGAGAGCTCTGTGTGG - Intronic
1159502124 18:69286787-69286809 CAACATGGCAGTGCTGGGAGGGG - Intergenic
1160429995 18:78804534-78804556 CACCAAGTGAGTGCTGGGCCTGG - Intergenic
1161946358 19:7439859-7439881 GACCAAGGGAGAGCCTGGAGGGG + Exonic
1164906898 19:31975137-31975159 GACCAAGGGAAGGCCCGGAGTGG - Intergenic
1165665230 19:37622219-37622241 CACCAATGGAAAGCACGGAGGGG - Intronic
1167390317 19:49190455-49190477 CACTAAGGGAGTGCTGTGGGAGG + Intronic
926483525 2:13428051-13428073 CACCCAGGAAGTGCAAGGAGCGG - Intergenic
928244150 2:29612708-29612730 CATGAAGGGGGTGCTGGGAGTGG + Intronic
929127702 2:38536156-38536178 CGCCCCGGGAGTGCGCGGAGCGG + Intergenic
930187597 2:48425925-48425947 CACCAAGGAAGTGCTGGATGGGG + Intergenic
933843825 2:86309160-86309182 CACCCAGGGAGTGACAGGAGCGG - Intronic
935126367 2:100227179-100227201 AACCAAAGGAGTGCTCTGAAAGG + Intergenic
942140584 2:172973555-172973577 CACCAAGGGAGTGACCGGACAGG + Intronic
943650880 2:190456507-190456529 CAGCCAGGGAGTTCCCGGAGTGG - Intronic
944563189 2:200962246-200962268 CACCAAGGCAGTGCCTTGAGGGG - Intronic
947320471 2:228911984-228912006 CACCAAGGATGTGCTCACAGAGG + Intronic
1175185667 20:57178376-57178398 CTGCAAGGGGGTGCTCAGAGTGG + Intronic
1176118763 20:63444870-63444892 CTCCAAGGGGGTGCGGGGAGCGG - Intronic
1179723926 21:43331333-43331355 CACCAAGCCAATCCTCGGAGTGG + Intergenic
1181023897 22:20116996-20117018 CACAAGGGAAGTGCTCAGAGGGG + Exonic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
1185299150 22:50070451-50070473 CACCAAGGGAGGGCTAGGCCAGG + Intronic
950502823 3:13375464-13375486 CACCAAAGGAATGCACGCAGAGG + Intronic
957475858 3:80722864-80722886 CACCAAGGGGGTTCTGGGTGTGG - Intergenic
959668253 3:108945055-108945077 CTCCTAGGGAGTGCACAGAGTGG - Intronic
961685120 3:128624686-128624708 CACCAAGGGTGTGCTTCTAGTGG - Intronic
962382082 3:134906031-134906053 CACCATGGGAGCGCTCAGAAGGG - Intronic
967816999 3:193808127-193808149 CACCAAGTGAGAGCCCAGAGTGG + Intergenic
968581188 4:1396131-1396153 CACTAAGGGGGTGCTGGGGGTGG + Intergenic
970726572 4:19052386-19052408 CGCCAAGTGAGTACTTGGAGAGG + Intergenic
972336262 4:38109498-38109520 CACCAAGGGCTTCCTCTGAGGGG - Intronic
974463136 4:62216204-62216226 CACCAAGGATGTGCTAGGAGGGG + Intergenic
979853965 4:125609305-125609327 CACCAAGGGAGTCCTCTAAGGGG - Intergenic
986669098 5:10127322-10127344 CACAAAGGGAGTGCAGGGAGAGG + Intergenic
997877489 5:137562456-137562478 CTCCAAGTGAGTGCTGGGATGGG - Intronic
1000245764 5:159447246-159447268 CACCAAGGTAGTGATGAGAGTGG + Intergenic
1007612439 6:43159143-43159165 CACCAAGGGTGTGCACTGGGTGG - Intronic
1018928611 6:168224321-168224343 CCCCCAGGGAGTGCTTGGAGTGG + Intergenic
1023224083 7:37950901-37950923 AACCAAGGGAGTGCAGGGACAGG - Exonic
1023244682 7:38188531-38188553 CACCATGGGAGTGCTCAGAAGGG + Intronic
1024048393 7:45600798-45600820 CACCAAGGGTGTGCGCACAGAGG - Intronic
1024776937 7:52798643-52798665 CACACAGGGAGTGCTTGGGGTGG + Intergenic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1032074954 7:128831846-128831868 CGCCAAGGGTGGGCTTGGAGTGG + Intronic
1032338530 7:131049051-131049073 CACCAAGGGAGTGAGAAGAGTGG - Intergenic
1033066896 7:138164634-138164656 CACCAAGGGTGAGGTTGGAGTGG + Intergenic
1034418885 7:150978687-150978709 TACCAAGCCAGTGCTCGGCGTGG - Intergenic
1037492479 8:19409178-19409200 CCCCAAGGGAGTCCTGTGAGTGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039408273 8:37330978-37331000 CACAAAGGGAGAGGGCGGAGGGG + Intergenic
1043031950 8:75146281-75146303 CACCAAGAGAGGTCACGGAGTGG - Intergenic
1045604805 8:103760480-103760502 CACCATGGCAGTGCTGGGTGAGG + Intronic
1047780830 8:128109606-128109628 CACACAGCGAGTGCTCAGAGAGG - Intergenic
1052385417 9:27818037-27818059 AACCAAAGGAGTGCTTGGAAGGG + Intergenic
1061429282 9:130520990-130521012 CCCCATGGGAGGGCTGGGAGCGG + Intergenic
1061480474 9:130895580-130895602 CAGGGAGGGAGTGCCCGGAGAGG - Intergenic
1062340553 9:136092175-136092197 GACCAAGGGCGTGCCCAGAGAGG + Intronic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1191766798 X:64706312-64706334 CACCTGGGAAGTGCACGGAGTGG - Intergenic