ID: 904087990

View in Genome Browser
Species Human (GRCh38)
Location 1:27923452-27923474
Sequence GGGCACTGTCACTTCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904087990_904087993 5 Left 904087990 1:27923452-27923474 CCTACAAAGAAGTGACAGTGCCC No data
Right 904087993 1:27923480-27923502 AAATGTCATGCTAAGAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904087990 Original CRISPR GGGCACTGTCACTTCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr