ID: 904090368

View in Genome Browser
Species Human (GRCh38)
Location 1:27940867-27940889
Sequence CCTTGGGCCAGGAGTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904090368_904090378 8 Left 904090368 1:27940867-27940889 CCAGTCTCACTCCTGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 275
Right 904090378 1:27940898-27940920 CAGGTAACGGTATGGTGCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 31
904090368_904090377 0 Left 904090368 1:27940867-27940889 CCAGTCTCACTCCTGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 275
Right 904090377 1:27940890-27940912 GGTAATTGCAGGTAACGGTATGG 0: 1
1: 0
2: 0
3: 2
4: 42
904090368_904090379 9 Left 904090368 1:27940867-27940889 CCAGTCTCACTCCTGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 275
Right 904090379 1:27940899-27940921 AGGTAACGGTATGGTGCGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 29
904090368_904090376 -5 Left 904090368 1:27940867-27940889 CCAGTCTCACTCCTGGCCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 275
Right 904090376 1:27940885-27940907 CAAGGGGTAATTGCAGGTAACGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904090368 Original CRISPR CCTTGGGCCAGGAGTGAGAC TGG (reversed) Intronic
900552666 1:3264526-3264548 CCCCGGGCCAGGAGGGAGGCAGG + Intronic
900752459 1:4407246-4407268 CCCTAGGCCAGGAGAGAGACAGG + Intergenic
901059237 1:6464480-6464502 CCATGGGACAGGAGTGGGTCAGG + Intronic
901205942 1:7496017-7496039 CCCTGGGCCAGGATAGAGAGAGG - Intronic
901626727 1:10629157-10629179 CCAGTGGCCAGGAGAGAGACAGG - Intronic
902985205 1:20150492-20150514 GCTGGGGGCAGGAGGGAGACGGG - Intergenic
903179555 1:21598339-21598361 CCTTGGGGTAGGAGGGGGACAGG - Intronic
903832923 1:26185262-26185284 CCTTGGACCAGGAATAAGAGTGG - Intronic
904090368 1:27940867-27940889 CCTTGGGCCAGGAGTGAGACTGG - Intronic
904440780 1:30528151-30528173 CCTGGGGCCAGGAGAGTCACAGG + Intergenic
904474660 1:30757189-30757211 CCTGGGGCCTGGAGGGAGCCTGG - Intronic
909800241 1:79797150-79797172 GCTTGGGGGAGGAGTGACACTGG + Intergenic
910622608 1:89273376-89273398 CCTTGGGCCATGGATGGGACAGG + Intergenic
910629250 1:89339409-89339431 TGTAGGGGCAGGAGTGAGACTGG - Intergenic
912484658 1:110016215-110016237 CCTTGGGCAATAAATGAGACTGG + Intronic
914913795 1:151805987-151806009 TCTTGACCCAGGAATGAGACTGG + Exonic
915108790 1:153549976-153549998 CCCTGGGTCAGGAGTCAGGCTGG + Intronic
915591849 1:156875320-156875342 CATGGGGCCAGGGGTGGGACAGG + Intronic
915917408 1:159949238-159949260 CCTGTGGCCAGCAGTGAGTCTGG - Intergenic
917437497 1:175035984-175036006 CCTTGGGCAAGGGATGAGAGAGG - Intergenic
918314970 1:183316035-183316057 CCTTGGGAGAGGAGTCAGCCAGG + Intronic
920913268 1:210237018-210237040 CCTTGGGCCTGCAGGGAGATGGG - Intronic
1062971946 10:1654846-1654868 CCTTGGGCCTGGCGTGTGGCTGG - Intronic
1065158254 10:22893314-22893336 CACTGGGTCAGGAGTGTGACTGG - Intergenic
1065468689 10:26053992-26054014 CTTTGAGGCAGGAGTGAGCCAGG + Intronic
1065945827 10:30604987-30605009 CCTTGGGCCAGCTGAGGGACAGG - Intergenic
1067167910 10:43879945-43879967 CTGTGGGGCGGGAGTGAGACTGG - Intergenic
1069044108 10:63724232-63724254 CCTTGGACCAGGAGCCAGAGAGG - Intergenic
1071384443 10:85105220-85105242 CTTTGGTCCTGGAGTGAGAAAGG - Intergenic
1071568735 10:86685014-86685036 CCTTGGGCCAGCAATGAGGCAGG - Intronic
1072562091 10:96586433-96586455 CCTGGGGCCAGGAAGGAGCCTGG - Intronic
1073527223 10:104195270-104195292 TCTTGGGCAAGGAGGGATACAGG - Intronic
1073659549 10:105459683-105459705 CATTGGGCCAGTGGTGAAACAGG + Intergenic
1073729207 10:106270113-106270135 CATAGGGGCAGGAGTGAGACTGG - Intergenic
1075551197 10:123394025-123394047 CCTTGGCACAGGACTGAAACAGG - Intergenic
1076367551 10:129931907-129931929 TCTTGGGCCAGGAGTGTGTATGG - Intronic
1076724662 10:132407745-132407767 CCTTGGGGCAGGCGTGGGGCAGG + Intronic
1076774409 10:132686488-132686510 CATTGGGCCAGGAGCGTGTCCGG - Intronic
1077431578 11:2518365-2518387 CCTTGGGACAGGAGAGACAGAGG + Intronic
1077481525 11:2817033-2817055 CCTGGGGTCAGGAGTGCCACTGG - Intronic
1078102237 11:8336783-8336805 CCTTAGCCCAGGAGGCAGACTGG - Intergenic
1079627479 11:22633753-22633775 CACTGGGTCAGGAGTGTGACTGG - Intronic
1079974536 11:27075597-27075619 CACTGGGTCAGGAGTGTGACTGG - Intronic
1080023673 11:27591474-27591496 CCTTGATCCATGAGTGAAACTGG - Intergenic
1081374759 11:42344754-42344776 CCTTGGGCCAGCACAGAGAGGGG + Intergenic
1081702837 11:45162800-45162822 CATGGTGCCAGGAGTGAGAAAGG - Intronic
1083903401 11:65654787-65654809 CCTGGGGCTAGGACTGGGACAGG + Exonic
1084113982 11:67031144-67031166 CCTTGGGCAAGTGGTGAAACCGG + Intronic
1084899894 11:72301772-72301794 CCTTGGGCCAGGATGGAGCGGGG - Intronic
1085260904 11:75204142-75204164 CCTTGGGCTCGGAGAGAGGCAGG + Intronic
1091750084 12:3016928-3016950 CCTTAGGGCAGGACTGAGGCAGG + Intronic
1092095413 12:5838213-5838235 ACTGGGACCAGGAGTGGGACTGG + Intronic
1092446904 12:8566592-8566614 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
1095777199 12:46023427-46023449 CATTGGGACAGGAGTGAGTCTGG - Intergenic
1096191443 12:49622824-49622846 CCTTGGGGCTGGAGAGTGACAGG - Intronic
1097906988 12:64930867-64930889 CACTGGGACAGGAGTGAGGCTGG - Intergenic
1098593095 12:72237913-72237935 CCTTGAGGCAGGAGTGTGCCTGG + Intronic
1098993067 12:77087417-77087439 CCTAGGGCCAGGAGTGAGGTAGG + Intergenic
1099712421 12:86244325-86244347 CATTGGGGCAGGAGACAGACAGG + Intronic
1102561126 12:113762927-113762949 CCTTGGGCCTGGCGAGAGGCTGG - Intergenic
1105563609 13:21520016-21520038 CCTGAGGCCAGGAGAGAGTCAGG - Intronic
1111639278 13:90947182-90947204 CCCTGGGCCAGAAGGGAAACTGG + Intergenic
1113556245 13:111238010-111238032 CCTTGGGCTTGGAGAGTGACGGG + Intronic
1114208565 14:20596744-20596766 GCATGGCCCAGGAGTGTGACTGG + Intronic
1115314464 14:32011547-32011569 CCTTTCTCAAGGAGTGAGACTGG + Intronic
1116899035 14:50344184-50344206 CCTGTGGCCAGGAGTGTCACAGG + Intronic
1117679391 14:58187714-58187736 CTTAGGGCCAGGAATGAGAATGG - Intronic
1118845673 14:69546276-69546298 CCTTGGGGCAGGAATGTGCCCGG + Intergenic
1119509009 14:75196612-75196634 CCCTGGGCCAGTGGTGAGAGTGG - Intergenic
1120443542 14:84566119-84566141 TATAGGGACAGGAGTGAGACTGG + Intergenic
1120720884 14:87888767-87888789 GCTTGGGCCAGCAGTGAGCATGG - Intronic
1121822045 14:96978380-96978402 CCTTGGGCTTGGAGTGAAAAGGG - Intergenic
1122135556 14:99630832-99630854 CCATAGGCCAGGAGAGAGACAGG - Intergenic
1122143804 14:99677042-99677064 CCTTGGGGCAGGCATGAGTCTGG + Exonic
1122365601 14:101193257-101193279 CCCTGGACCCTGAGTGAGACAGG + Intergenic
1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG + Intergenic
1123068520 14:105629879-105629901 CCCTGGGGCTGGACTGAGACTGG + Intergenic
1123098107 14:105775906-105775928 CCCTGGGGCTGGACTGAGACTGG + Intergenic
1123410946 15:20058558-20058580 CGTTGGGACAGGAGTGACACAGG + Intergenic
1123520276 15:21065246-21065268 CGTTGGGACAGGAGTGACACAGG + Intergenic
1124247278 15:28081715-28081737 CCCTGGGGCAGGAGTGCGAGGGG + Exonic
1124381514 15:29171510-29171532 GCTGGGGGCAGGAGGGAGACAGG - Intronic
1125747135 15:42004809-42004831 GTTAGTGCCAGGAGTGAGACTGG + Intronic
1126325526 15:47473116-47473138 CCTTTGGACAGCCGTGAGACTGG + Intronic
1130778159 15:87006906-87006928 TCATGGGTGAGGAGTGAGACAGG + Intronic
1132081192 15:98867132-98867154 CCTTGTGCCAGGAGAGAAAGGGG + Intronic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1133270335 16:4608259-4608281 ACTTGGGGCAGAAGGGAGACTGG - Intergenic
1136463406 16:30425976-30425998 CCTTAGGCGGGGAGTGAGAGTGG - Intronic
1136841423 16:33545517-33545539 GCTAGGGCCAGGAGAGGGACAGG + Intergenic
1137566855 16:49538649-49538671 CCTTGGGCCAGGAGGAAGCTGGG - Intronic
1137877078 16:52006996-52007018 GCTGGGGTCAGGAGTGAGGCAGG + Intronic
1137942947 16:52706882-52706904 TCTTGGACCAGAAGAGAGACAGG - Intergenic
1138054374 16:53816553-53816575 CCTTGGGGCAGGAGTGAGCTTGG - Intronic
1138504781 16:57472827-57472849 CTCTGGGCCTGGAGTGACACAGG - Exonic
1139170449 16:64625163-64625185 CACTGGGTCAGGAGTGTGACAGG - Intergenic
1140890014 16:79277061-79277083 CCTGGGGCACAGAGTGAGACCGG - Intergenic
1141693825 16:85611010-85611032 CCTTGGGCCAGGGGTGAAGGTGG - Intergenic
1203151588 16_KI270728v1_random:1845814-1845836 GCTAGGGCCAGGAGAGGGACAGG + Intergenic
1143501578 17:7342462-7342484 CCCTGGTCAAGGAGTGAGATGGG + Exonic
1143796623 17:9342287-9342309 CCCTGGGCCAGGACTGGTACCGG - Intronic
1146400737 17:32498161-32498183 CCGTGGTCCAGGAGAGGGACAGG - Intronic
1146938307 17:36826146-36826168 CCCTGGGCCACAGGTGAGACCGG + Intergenic
1146972893 17:37086901-37086923 CATGGGGCCAGGAGTGAGGGGGG + Exonic
1149299116 17:55288020-55288042 CTTTGGGCCAGATGTGAGTCAGG + Intronic
1150267248 17:63839463-63839485 CCTGGGGCCCTGAGTGAGCCAGG - Intronic
1150388397 17:64777389-64777411 CCATGTGCCAGGACTGAGTCCGG - Intergenic
1150608434 17:66714043-66714065 CAATGGGCCAGGAGAGAGCCAGG - Intronic
1150791074 17:68200579-68200601 CCATGTGCCAGGACTGAGTCCGG + Intergenic
1151597922 17:75089091-75089113 CTTTGGGCAAGGAGGTAGACAGG - Exonic
1152587682 17:81196306-81196328 CCTGGGGCCGGCAGTGAGGCTGG - Intronic
1155839810 18:30631008-30631030 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
1155971660 18:32089144-32089166 CCTTGGCCCAGCTGAGAGACAGG + Intergenic
1157113832 18:44844943-44844965 CTTGGGGCCAGGAGAGAGATTGG + Intronic
1157430255 18:47619085-47619107 CCTTGGGCCTGGACTGACAAGGG - Intergenic
1159055643 18:63460575-63460597 CCTAAGACCAGGAGTGAGATTGG - Intergenic
1160351456 18:78184499-78184521 CCTTGGGTCTGCAGTGAGTCTGG + Intergenic
1160409659 18:78667145-78667167 CCTCGGGCCTGGAGTGGGGCAGG + Intergenic
1161716822 19:5880842-5880864 CCCTGGGCCAGGAGGGAGGCTGG + Intronic
1162300980 19:9844821-9844843 CCATGGGGAAGGAGGGAGACAGG - Intronic
1163171101 19:15531667-15531689 CCCTGGGCCAGGACTGAGGTGGG + Intronic
1163242331 19:16071871-16071893 CCTTGGGGCAGGGCTGAGGCAGG - Intronic
1163761575 19:19139867-19139889 CCCAGGGCCACAAGTGAGACTGG - Intergenic
1163783735 19:19263758-19263780 ACTTGGGCCTGGAGTAAGTCAGG - Intergenic
1163802187 19:19372940-19372962 CCATGTGCCAGGAGTCAGTCTGG - Intergenic
1164120618 19:22261976-22261998 CCTGGGGCCGGGAGGGAGAGAGG + Intergenic
1164570743 19:29372588-29372610 CCTGGGGCCAGGAAGGAGGCTGG - Intergenic
1164602995 19:29576154-29576176 CCTCGGGACAGGATTGTGACAGG + Intergenic
1164669764 19:30065759-30065781 CCATAGGACATGAGTGAGACTGG + Intergenic
1164730457 19:30500249-30500271 TCTAGAACCAGGAGTGAGACTGG - Intronic
1165057907 19:33190377-33190399 CCTGGGGCCAGCAGTGAAAGAGG - Intronic
1165646244 19:37440404-37440426 CCAGGGGCTAGGAGTGAGAGAGG + Intronic
1165928726 19:39342767-39342789 CCAGGGCCCAGGAGGGAGACTGG - Intronic
1167006182 19:46777765-46777787 CCTTGGGCCAAGGGACAGACTGG - Intronic
1167266475 19:48485420-48485442 TCTTGGGCCAGGAGTGGGTGAGG + Exonic
926093716 2:10066584-10066606 CCTGATGCCAGGAATGAGACAGG - Intronic
926332156 2:11834493-11834515 CCTTGGCCCAGAAGTGATTCAGG - Intergenic
928199953 2:29241469-29241491 CTTAGGGCCAGGAGGGAGATGGG + Intronic
930036890 2:47091528-47091550 CCTTGCCTCAGGAGTGGGACAGG + Intronic
932730452 2:74217762-74217784 CCTTGCTCCAGAAGTGTGACTGG - Exonic
933737156 2:85504370-85504392 CCCTGGGGCAGGAGTGGGCCTGG - Intergenic
935404816 2:102697923-102697945 GCTTGTGCCAAGAGTGAGAAGGG - Intronic
935796044 2:106642400-106642422 CCTGGGGGAAGGAGGGAGACGGG - Intergenic
936619734 2:114082926-114082948 CCCAGGGCCAAGAGTGAGGCAGG - Intergenic
937743507 2:125383890-125383912 TCTTGGGCCAGGAGAGATAGAGG + Intergenic
939305291 2:140402591-140402613 CACTGGGACAGGAGTGAGTCTGG + Intronic
940582498 2:155600244-155600266 CCTTGAGCCAGGACTGCGACAGG - Intergenic
941544970 2:166837750-166837772 CATGGGGCCAGGAATGAGATGGG + Intergenic
941752971 2:169152711-169152733 CCATGGGCCATGAGTGAGTCTGG - Intronic
942232967 2:173876990-173877012 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
943441506 2:187932858-187932880 TGTAGGGGCAGGAGTGAGACTGG + Intergenic
945252794 2:207778491-207778513 CATAGAGCCAGGAGTGAGGCTGG + Intergenic
945803205 2:214460115-214460137 CCTGAGGTCAGGAGTGAAACTGG - Intronic
947386489 2:229595712-229595734 CCCTGGGGCAGGAGAGTGACTGG - Intronic
947454152 2:230237813-230237835 CCTTTGGCCAGGAGTCATAGTGG + Intronic
948125886 2:235564627-235564649 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948125896 2:235564657-235564679 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948125915 2:235564717-235564739 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948125924 2:235564747-235564769 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948125958 2:235564867-235564889 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948126004 2:235565050-235565072 CCCAGGGCCAGGTGTGAGCCTGG + Intronic
948126041 2:235565201-235565223 CCCAGGGCCAGGTGTGAGCCAGG + Intronic
948126050 2:235565232-235565254 CCCAGGGCCAGGTGTGAGCCAGG + Intronic
948621501 2:239237965-239237987 CCCTGGGTCAGGAGAAAGACCGG + Intronic
948638987 2:239361177-239361199 CCTTGGGCCAGGGGTGCAGCAGG - Intronic
948717791 2:239876393-239876415 CCTGTGACCAGGAGTGAGGCAGG - Intergenic
1169276638 20:4237561-4237583 CCCTGGGGCAGGTGTGAGAATGG + Intronic
1169682650 20:8233019-8233041 CCTAGGACCAAGAGTGTGACAGG - Intronic
1169768669 20:9177410-9177432 CCTCGGGACTGGACTGAGACAGG + Intronic
1170639451 20:18138483-18138505 CCTTGGGCCAGGAGGGAGGCTGG - Intronic
1170651336 20:18245373-18245395 GTCTGGGCCAGGAGTGAGCCTGG + Intergenic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1171185971 20:23124490-23124512 CCTGGGCCCAGGAGTGAGAGGGG + Intergenic
1172627342 20:36355132-36355154 CCTGGGGCCAGGGGTGGGAGTGG - Intronic
1173416540 20:42861827-42861849 CCTTGAGACAGGAGAGAGCCTGG + Intronic
1173887736 20:46476230-46476252 ACCTGGGACAGGAGAGAGACTGG + Intergenic
1174244973 20:49172101-49172123 CATTGGGCCAAGTGTGAGACAGG - Intronic
1175986117 20:62764912-62764934 CTCTGGGCCAGGAGGGACACTGG - Intergenic
1176943115 21:14947829-14947851 CCTTGGGCCAGCATGGAGCCAGG - Intergenic
1178294116 21:31394584-31394606 AGGTGGGCCAGGAGTGAGAGAGG + Intronic
1179939729 21:44629583-44629605 CCTTGAGGCAGGAGTGAGGGTGG + Intronic
1181162327 22:20966081-20966103 GCCTGGGCCAGGAAGGAGACTGG - Intronic
1181431112 22:22882454-22882476 CCTTGGGGCAGGGAGGAGACAGG - Intronic
1181930261 22:26395159-26395181 ACCTGGGCCAGGAGAGAGAAAGG + Intergenic
1183538195 22:38415314-38415336 CCCAGGGGCAGGAGGGAGACAGG - Intergenic
1184041373 22:41946147-41946169 CCTTGGGCCAGCACAGAGGCAGG + Intronic
1184280798 22:43436379-43436401 CAGAGGGCCAGGAGTGAGGCAGG + Intronic
953653965 3:44833267-44833289 CCTTAGACCAGGAGTGTGAGGGG + Intronic
954295065 3:49669887-49669909 CATTGAGCCAGGAGTGCGGCAGG + Exonic
955054321 3:55442419-55442441 CCTTGGCCCAGAAGTGAGCAGGG + Intergenic
955304932 3:57820843-57820865 AGTAGGGGCAGGAGTGAGACTGG - Intronic
955394420 3:58547817-58547839 CTTGTGCCCAGGAGTGAGACCGG - Intergenic
956687544 3:71844208-71844230 GCTGGGATCAGGAGTGAGACTGG - Intergenic
956872891 3:73435600-73435622 CCTTGGTCCATCAGTGAGTCTGG + Intronic
956944597 3:74205919-74205941 CTCTGGGCCAGAAGTGGGACTGG - Intergenic
958950494 3:100410861-100410883 CCCTGGGCCTGTAGTGGGACTGG - Intronic
959868506 3:111299941-111299963 CCCTGGGCCAGAAGAGAGCCAGG - Intronic
960043633 3:113175399-113175421 GCTTGGGCTAGGAGGGAGAGAGG - Intergenic
960385651 3:117018881-117018903 CCTTGTGTAAGGAGTCAGACCGG - Intronic
961436757 3:126924489-126924511 ACTTGGGCCAGGGGTGAGGGAGG + Intronic
965703524 3:171482438-171482460 CCTGGGGCTAGGAGTGGGAATGG - Intergenic
966735355 3:183182668-183182690 CCCGGGGCCTGGAGGGAGACAGG - Intronic
968480109 4:829463-829485 CCTTGGGCCAGGAAAGGGTCTGG + Intergenic
968742286 4:2337338-2337360 CCCCGGGCCTGGAGTGAGGCAGG + Intronic
969184507 4:5465391-5465413 CCTGGGGGCAGGAGGAAGACAGG - Intronic
969687003 4:8681262-8681284 CCTTGGGCCCGGAGAGCGAACGG - Intergenic
972211887 4:36848466-36848488 CCTTGGGAGAGGAGTTAGAAAGG + Intergenic
972311180 4:37885021-37885043 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
973987606 4:56370146-56370168 CTTGAGGCCAGGAGTGAGACTGG + Intronic
975028003 4:69576383-69576405 CCTTGGGCCATGGATGGGACCGG + Intergenic
976442990 4:85097930-85097952 TGTTGGGGCAGTAGTGAGACAGG - Intergenic
976663549 4:87565606-87565628 CCTGGGGCAAGGGGAGAGACAGG + Intergenic
979882640 4:125981034-125981056 GCCTGGGCAAAGAGTGAGACTGG + Intergenic
980152496 4:129063953-129063975 TCTTGGGGCAGGAGTGATGCAGG + Intronic
982119851 4:152132361-152132383 CCTTGGCCCAGGAGTGCCTCCGG + Intergenic
982592691 4:157335240-157335262 CTTTGGGACAGCAGTGACACAGG + Intronic
985124274 4:186676056-186676078 CCTTGGACCAGCAGAGAGAGAGG + Intronic
985697473 5:1348921-1348943 CCTAGGGCCCTGGGTGAGACTGG + Intergenic
986691854 5:10319780-10319802 CCCTTGGCCAGGAGGGAGTCTGG + Intergenic
987073174 5:14357449-14357471 CTTTGGGCCAGGTGGGAGCCAGG - Intronic
987998202 5:25313183-25313205 CCTTTGGCAAGGACTAAGACTGG + Intergenic
988442697 5:31250372-31250394 CCCTGGGCTCGGAGTGAGCCAGG + Intronic
988567471 5:32330690-32330712 CTCTGAGCCAGGAGAGAGACAGG - Intergenic
988638547 5:33015349-33015371 CCTTGGGGGAGGAGTGACATGGG + Intergenic
989190630 5:38666649-38666671 GCTTGGGGCAGAAGTGGGACAGG + Intergenic
989992425 5:50782939-50782961 CCTTGGGGCTGGAATGACACGGG + Intronic
992774157 5:80075379-80075401 CCTTGGGCCAGCACTGTGCCGGG - Intronic
994024866 5:95070684-95070706 ACTTTGGCCATGTGTGAGACTGG + Intronic
994245000 5:97468541-97468563 TGTAGGGGCAGGAGTGAGACAGG + Intergenic
995115461 5:108473149-108473171 CACTGGGTCAGGAGTGTGACTGG + Intergenic
997943875 5:138182325-138182347 CTTTGGGCCAGAAGTGGGACAGG + Exonic
999778686 5:154831328-154831350 CCCTGGGCTAGGAGTCAGTCAGG + Intronic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000668347 5:164027273-164027295 GCTTGGGCCAGGAATGAGGAGGG + Intergenic
1001213852 5:169837000-169837022 CCTAGGGTCAAGAGTGAGTCAGG + Intronic
1001509284 5:172307563-172307585 CCTTGGGCCTGGGGGGAGGCAGG + Intergenic
1003982595 6:11403508-11403530 CCTTGAGGCAGGAGTGAGCAAGG + Intergenic
1004843741 6:19615193-19615215 CCTTGGCTCATGAGTGAGGCAGG + Intergenic
1006391681 6:33762311-33762333 TCTGGGGACAGGAGTGACACCGG - Intergenic
1007247084 6:40470701-40470723 CCTGGGGCCTGGGGTGAGAGGGG - Intronic
1007829044 6:44624424-44624446 AGCTGGGCCAGGAGTGGGACAGG + Intergenic
1008181949 6:48342234-48342256 GTTTGGGCCAGGAGTAAGAGTGG + Intergenic
1008588525 6:52970472-52970494 CCTTGGGCAAGGACTGACCCTGG - Intergenic
1008610781 6:53182980-53183002 GCTTGGGCAAGTGGTGAGACAGG - Intergenic
1011239439 6:85255532-85255554 CCTAGGGGCAGGACTGAGTCAGG - Intergenic
1012373399 6:98532352-98532374 TCTCTGGCCAGGAGTGAGTCTGG - Intergenic
1015872552 6:137791694-137791716 CCTTGGGACTGGATAGAGACAGG + Intergenic
1020338406 7:7083213-7083235 CTGTGGGTCAGGTGTGAGACTGG - Intergenic
1020997504 7:15281515-15281537 CATTGGGTCAGGAGTGTGTCTGG + Intronic
1021620746 7:22549480-22549502 CAGTGGGCAAGGAGTGAGACTGG + Intronic
1022838614 7:34140964-34140986 CCATGGGCCAGGAGAGAGGATGG + Intronic
1023033844 7:36113277-36113299 GCTTGAGCCAGGTGTGATACTGG + Intergenic
1025216685 7:57061569-57061591 CCTGAGGCCGGGAGTGAGGCCGG + Intergenic
1026301635 7:69102905-69102927 CCATGGGCCTGGACAGAGACAGG - Intergenic
1026602299 7:71786849-71786871 CTTTGGGGCAGGGGTGAGGCAGG - Exonic
1026650667 7:72213427-72213449 CCTGGGGCTGGGAGTGAGAACGG + Intronic
1027703194 7:81494821-81494843 ACTTGGTCCAGGTGTGAGATTGG + Intergenic
1028993597 7:97076123-97076145 GGCGGGGCCAGGAGTGAGACCGG - Intergenic
1029158556 7:98534729-98534751 CCCTGGGGCAGGAGTGTGCCTGG + Intergenic
1031614353 7:123863868-123863890 CTTTGGGGAAGGAGTGAGAAGGG + Intronic
1032489291 7:132311953-132311975 CCTGGGGCCAGGAGAGAGCTTGG + Intronic
1033157034 7:138965983-138966005 CCTTGAGGCAGGAGTGTGCCTGG - Intronic
1034481001 7:151320546-151320568 CCTGGGGCAAGAAGTGAGAATGG + Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035654555 8:1295711-1295733 CCTTGGGCCCACAGAGAGACTGG - Intergenic
1036622610 8:10434818-10434840 CCAGGGGTCAGGAGGGAGACAGG - Intergenic
1037885470 8:22593928-22593950 CCCTGGCCCAGCAGTGAGGCAGG - Exonic
1038213881 8:25543967-25543989 CCTTGGGACAGGCTTCAGACTGG + Intergenic
1039099431 8:33925019-33925041 CTTGAGGCCAGGAGTGAGGCAGG - Intergenic
1039900915 8:41751992-41752014 CCCTGGGGCAGGAGTAAGAGTGG - Intronic
1043478257 8:80626186-80626208 CCTGGAACCAGGAGTGAGAAAGG - Intergenic
1043518262 8:81016826-81016848 CCTTAGGCCTGGTGTGAGAATGG - Intronic
1043528218 8:81119754-81119776 CTTTGGAGAAGGAGTGAGACTGG + Intergenic
1044166795 8:88994664-88994686 CCTTGGGGCAGGAATGTGACAGG + Intergenic
1044204315 8:89474509-89474531 CTTTGGCCCAGAAGTGATACAGG + Intergenic
1044738868 8:95305242-95305264 TCTAGGGCCAGGAGTGAGGCGGG + Intergenic
1048977532 8:139681375-139681397 CCTGGGTCAAGGTGTGAGACAGG + Intronic
1049786888 8:144455356-144455378 CCTGAGGCAGGGAGTGAGACTGG + Intronic
1051522949 9:18011352-18011374 TATTGAGCCAGGAGTGGGACAGG + Intergenic
1051839732 9:21381812-21381834 CCTGGGGCCAAGAGTGATAAGGG - Intergenic
1052192248 9:25674152-25674174 CCTGGTGCCTGGAATGAGACTGG - Intergenic
1052366682 9:27619895-27619917 GCTTGGGCCACGGGAGAGACAGG - Intergenic
1052860876 9:33437049-33437071 CCTGGGGCCACCAGGGAGACTGG - Intergenic
1055631914 9:78233314-78233336 TCTTGGGCCAGGTGTGAGCCTGG + Intergenic
1060244546 9:121933378-121933400 CCTTGGGGCAGAAGAGAGTCAGG + Intronic
1060965030 9:127707468-127707490 CCATGGGGCAGGAGTGAGGCAGG - Intronic
1061806871 9:133141690-133141712 CCTTGGGGCAGGAGAGTGAGGGG - Intronic
1062017695 9:134299478-134299500 GCTTGTGTCAGGAGTGAGGCAGG + Intergenic
1062463310 9:136670873-136670895 CCTGGGGACAGGAGGGAGCCTGG + Intronic
1062651145 9:137578501-137578523 CCTTTGGCCAGGAGGTAGGCTGG - Intronic
1186655894 X:11611703-11611725 GCAAGGGCAAGGAGTGAGACAGG - Intronic
1190942687 X:55057501-55057523 CATGGGGCCAGCAGTGAGAATGG - Intergenic
1192340169 X:70257830-70257852 CTTTGGGACAGGAATGGGACTGG - Intergenic
1193300983 X:79887894-79887916 CACTGGGACAGGAGTGAGGCTGG + Intergenic
1198518318 X:137429295-137429317 CCTGGGGCCAGGAGATTGACAGG + Intergenic
1199170317 X:144727243-144727265 CACTGGGTCAGGAGTGAGTCTGG + Intergenic
1199284890 X:146044702-146044724 CCTCAGGTCAGGAGTGAGAGAGG + Intergenic
1202091187 Y:21192593-21192615 CCTTGCCCAAGGAGTGAGATTGG - Intergenic