ID: 904093961

View in Genome Browser
Species Human (GRCh38)
Location 1:27963414-27963436
Sequence TGTCCACTCATTAGATGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904093954_904093961 13 Left 904093954 1:27963378-27963400 CCATAGCATGGATGTGAGGAGAC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 77
904093950_904093961 22 Left 904093950 1:27963369-27963391 CCGAAGGCCCCATAGCATGGATG 0: 1
1: 1
2: 0
3: 13
4: 138
Right 904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 77
904093952_904093961 15 Left 904093952 1:27963376-27963398 CCCCATAGCATGGATGTGAGGAG 0: 1
1: 1
2: 4
3: 28
4: 286
Right 904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 77
904093953_904093961 14 Left 904093953 1:27963377-27963399 CCCATAGCATGGATGTGAGGAGA 0: 1
1: 0
2: 1
3: 9
4: 118
Right 904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG 0: 1
1: 0
2: 1
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904093961 Original CRISPR TGTCCACTCATTAGATGGGT GGG Intronic
904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG + Intronic
904099521 1:28012381-28012403 TGTCCACTTATTAGACTGGTAGG + Intronic
909257579 1:73444117-73444139 TGTCCTCACATTGAATGGGTGGG + Intergenic
916186879 1:162141986-162142008 TGTCCATTCATTTGTTTGGTGGG + Intronic
922065518 1:222135694-222135716 TGTCCAGTAATGAGATGGCTGGG - Intergenic
1063078828 10:2745176-2745198 TTTCCATTGATTAGATGTGTAGG + Intergenic
1068789811 10:61015619-61015641 TGTGGCCACATTAGATGGGTAGG - Intergenic
1075917856 10:126185018-126185040 CGTGCTTTCATTAGATGGGTAGG - Intronic
1077322949 11:1950564-1950586 TGTCCACTCACAACAGGGGTGGG - Intronic
1077322965 11:1950623-1950645 TGTCCACTCACAACAGGGGTGGG - Intronic
1080119089 11:28655592-28655614 TGTACCCTCATGAGATGGATGGG - Intergenic
1086941448 11:92802360-92802382 TGTACACACATTAGATGGAATGG + Intronic
1202805967 11_KI270721v1_random:5877-5899 TGTCCACTCACAACAGGGGTGGG - Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1097493885 12:60304067-60304089 TGGTCCCTCATTAGTTGGGTTGG + Intergenic
1101596911 12:106175582-106175604 TATCCAATCAATAGATGGGGGGG + Intergenic
1103221610 12:119251048-119251070 TGTCCACTTATTAGATTGCCTGG - Intergenic
1106679870 13:31998903-31998925 TGTCCTCACATTGGAGGGGTTGG + Intergenic
1106895528 13:34296712-34296734 TGTGGACTCATAAAATGGGTTGG + Intergenic
1107229638 13:38092774-38092796 TTTCCACCCTTGAGATGGGTTGG + Intergenic
1107435501 13:40377401-40377423 TCTGCACTCCTCAGATGGGTCGG + Intergenic
1108755226 13:53492986-53493008 TATCCACTCATTACAAGTGTTGG - Intergenic
1113428427 13:110229183-110229205 TGTCCACTCATTTGAAGTGAAGG - Intronic
1116457451 14:45135708-45135730 TTTCCAATGATTAGATGGCTGGG - Intergenic
1119021581 14:71120614-71120636 TCTCCAGTAATTAGATGGCTTGG + Intergenic
1124950633 15:34316672-34316694 TGTCCACTCATTACAAAGTTGGG + Intronic
1126263020 15:46716533-46716555 TGTTCCATCATTAGTTGGGTAGG + Intergenic
1127504101 15:59581604-59581626 TATCCACCCATTTGCTGGGTTGG - Intergenic
1128652698 15:69430815-69430837 TATCCACACACTAGATAGGTAGG + Intronic
1130541224 15:84822032-84822054 TCTCCACTCCTTAACTGGGTTGG - Intronic
1132419162 15:101650783-101650805 TGCACACTCATTAGGTTGGTTGG - Intronic
1133577334 16:7105819-7105841 TATCCACTCATTTGATTGATGGG + Intronic
1139206933 16:65037916-65037938 TCTCCCCTCATCAGAGGGGTTGG - Intronic
1143341734 17:6216343-6216365 TGACCACTCTTTAGCTGGGAGGG + Intergenic
1144156047 17:12504080-12504102 TATCCACTCATCAGTTGGATGGG - Intergenic
1157390154 18:47295090-47295112 GTTGCACTCATTTGATGGGTTGG - Intergenic
1159562799 18:70013203-70013225 TGTCCCCTTATTAAATGGGAGGG + Intronic
1166801998 19:45463601-45463623 TGCCCACTCATGAGACTGGTGGG - Intronic
926443284 2:12912565-12912587 TATCCACTAATTAGCTGGTTTGG + Intergenic
927443950 2:23141459-23141481 TGTCCAATCAGGTGATGGGTAGG + Intergenic
927700617 2:25266091-25266113 TGTCCTTTAAGTAGATGGGTTGG - Intronic
931072226 2:58665598-58665620 TCTCCAATCATTATATGGTTTGG + Intergenic
935390923 2:102551917-102551939 TATCCTGGCATTAGATGGGTTGG - Intergenic
937368438 2:121281814-121281836 TGTCCTCTCTTTAGAAGGGATGG - Intronic
942327436 2:174787953-174787975 TGACCACACATCAAATGGGTGGG + Intergenic
946528812 2:220549320-220549342 TGTCCACTCATCAGATTGTCTGG + Intergenic
1173370786 20:42433042-42433064 AGTTCAGTCATGAGATGGGTGGG + Intronic
951148788 3:19262628-19262650 TGTTCATTTATTAAATGGGTGGG - Intronic
954707490 3:52488823-52488845 TGTCCTCTCACAAAATGGGTTGG + Intronic
976469992 4:85417472-85417494 TGTCCCTTCATTAGAAGGATTGG - Intergenic
991171917 5:63637412-63637434 TGTCTCCTCATTAGATGGTGAGG + Intergenic
996744390 5:126833839-126833861 TGTCCACTAATTTGAAGGATGGG + Intronic
997935804 5:138109744-138109766 TATCCAGTCATCAGATGGTTAGG + Intergenic
1014051285 6:116958373-116958395 TGTGCTCTCATTCGAAGGGTTGG - Intergenic
1016503570 6:144750535-144750557 TGTCCACTCTTTAAGTGGGGAGG - Intronic
1017455133 6:154594637-154594659 TGTCCACTCAGCTTATGGGTAGG - Intergenic
1019097057 6:169590772-169590794 TGTCCACTGGTTAGACCGGTGGG - Intronic
1020039832 7:4993537-4993559 TGTGCATTCATTAGATGGGTGGG + Intronic
1021707241 7:23380000-23380022 TGTCAACTTCTAAGATGGGTTGG + Intronic
1023370990 7:39512105-39512127 TCTCCATCCATTAGATGAGTTGG + Intergenic
1023856072 7:44185226-44185248 TGTCCACTCCTGAGAAGGGAAGG + Intronic
1024096687 7:45987786-45987808 TGTCCAGTCAGTAGAGGGGATGG - Intergenic
1025794155 7:64722451-64722473 TGACCACTCAATAGATGAGGAGG + Intergenic
1026616099 7:71906143-71906165 TGTCCATTTATTATATGGTTAGG - Intronic
1027938304 7:84637301-84637323 TGCCCACTCATGGAATGGGTGGG + Intergenic
1033555057 7:142482062-142482084 TGGCCACTCAGGAAATGGGTTGG + Intergenic
1033559663 7:142519594-142519616 TGGCCACTCAGGAAATGGGTTGG + Intergenic
1034026684 7:147712376-147712398 TGTCCAGTCATGGGATGGCTGGG - Intronic
1034275051 7:149820329-149820351 TGTCCACCCAGAGGATGGGTGGG - Intergenic
1035718994 8:1776886-1776908 TGTCCACGCAGCAGAAGGGTGGG + Intronic
1049763134 8:144339739-144339761 TGTCCACTTATTTCCTGGGTTGG - Intergenic
1050173730 9:2849146-2849168 TGTCCAGTAATGGGATGGGTGGG - Intergenic
1051675787 9:19557038-19557060 AGCCCCCTCATTTGATGGGTAGG + Intronic
1052968300 9:34359768-34359790 TGTCAATTCACTGGATGGGTGGG - Intergenic
1061840437 9:133355972-133355994 TGGCCACCCATTAGCTGGATGGG + Intronic
1062135432 9:134924756-134924778 TGTTCACTCAATAAATGGGCTGG - Intergenic
1191978622 X:66901400-66901422 TCTTTACTCATTAGCTGGGTGGG - Intergenic
1193525902 X:82588765-82588787 AGTCCACTCCTGAGATGTGTGGG + Intergenic
1200762894 Y:7056327-7056349 TGTCCACCCATTATACGGGAGGG - Intronic
1200850525 Y:7878586-7878608 TGTGCTCTCATTATTTGGGTGGG - Intergenic