ID: 904094842

View in Genome Browser
Species Human (GRCh38)
Location 1:27968515-27968537
Sequence TTGCTGTTCTAGGAGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904094831_904094842 28 Left 904094831 1:27968464-27968486 CCTCAGGGGATGTGGATGTGGTG 0: 1
1: 0
2: 1
3: 17
4: 277
Right 904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG 0: 1
1: 0
2: 2
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904094842 Original CRISPR TTGCTGTTCTAGGAGGTCCA TGG Intergenic
901114910 1:6835553-6835575 TTTCTGTTCCAGTAGGTCCTGGG + Intronic
902954645 1:19917187-19917209 TTGCTATTCAACGTGGTCCATGG - Intergenic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
905601329 1:39254350-39254372 TCGCTGCTTTAGGAAGTCCAGGG - Exonic
908253029 1:62280252-62280274 TCCCTGTTCTGGGAGGCCCATGG + Intronic
914949017 1:152094584-152094606 TTGGTGTTCTAAAATGTCCAAGG - Intergenic
916449040 1:164902159-164902181 TTGTTTTTCTAGGAGCTCAAAGG - Intergenic
919911726 1:202115260-202115282 TTCCTGATCTGGGAGCTCCAGGG + Intergenic
919911763 1:202115448-202115470 TTTCTGATCTAGCAGGTCTACGG + Intergenic
923025460 1:230200392-230200414 TTCATGTTCTAGGAGGTAGAGGG - Intronic
1065189287 10:23195424-23195446 TTGCTCTTGGACGAGGTCCATGG - Intergenic
1066418147 10:35240133-35240155 TTACTGTTTTAAGAGGGCCAAGG + Intergenic
1071669519 10:87595536-87595558 TGGCTATTCTAGGATGGCCATGG + Intergenic
1074135102 10:110619144-110619166 GTGATGTTCTAGGACTTCCAAGG - Intergenic
1075015593 10:118908123-118908145 TTGCTGTTCCATGAGCTCCTGGG - Intergenic
1075098580 10:119490003-119490025 ATGCTTTTCTGGGAGGTCCCGGG - Intergenic
1075970999 10:126652518-126652540 TTTCTGCTCTTGGAGGTGCATGG + Intronic
1080066375 11:28019937-28019959 TTGCTGCTATAGGAAGTACATGG - Intergenic
1081495426 11:43605210-43605232 TTTCTGTCTTAGGTGGTCCATGG + Intronic
1084037837 11:66523767-66523789 ATGCTGCTCCAGGAGGTTCATGG - Exonic
1084743411 11:71153362-71153384 TAGCTACTCTAGGAGGGCCAAGG - Intronic
1086818392 11:91402683-91402705 TTTCTGTTCTAGAAAGACCATGG + Intergenic
1091415103 12:275988-276010 TTTCTGTTTCAGGAGGTCTAGGG + Intergenic
1091836058 12:3586620-3586642 TTTCTGATTCAGGAGGTCCAGGG - Intronic
1092146399 12:6217704-6217726 TTGCTTTTCCAGGAGGACAATGG + Intronic
1102047884 12:109841074-109841096 TCCCTGTTCTAGGACCTCCATGG - Intergenic
1105509828 13:21041758-21041780 TTGCTATTCTAAGGGGTCCAGGG + Intronic
1105892241 13:24689992-24690014 CTCCTTTTCTAGGAGGCCCAGGG + Intronic
1111134486 13:84023234-84023256 TTGCTGTTTTAGGAATACCATGG - Intergenic
1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG + Intergenic
1113365163 13:109669078-109669100 CTGCTGTTCCCGGAGGTCCAAGG + Intergenic
1116989632 14:51261861-51261883 TTGCTGGTCAAGAAGGTGCAGGG + Intergenic
1119926763 14:78501968-78501990 GTTCTGTTATAGGAGATCCAGGG - Intronic
1123126542 14:105950819-105950841 TTGCTTTTCTACCATGTCCAGGG - Intergenic
1123407056 15:20026921-20026943 TTGCTTTTCTACCATGTCCAGGG - Intergenic
1123516387 15:21033577-21033599 TTGCTTTTCTACCATGTCCAGGG - Intergenic
1125825016 15:42668993-42669015 TTGCAGTTGGAGGAGGTACAAGG + Intronic
1127657451 15:61069687-61069709 TTGCTGTTTTTTGAGCTCCAAGG - Intronic
1128127793 15:65205729-65205751 ATGCTGTCCTAGGATGTGCAGGG + Intronic
1129123660 15:73419550-73419572 TTTCAGTGCTAGGAGGTACAAGG + Intergenic
1129153418 15:73703168-73703190 TTGCTGTTCTGGGAGATTGAAGG - Intronic
1129199354 15:73989670-73989692 CTACTTCTCTAGGAGGTCCAGGG - Intronic
1131683029 15:94744031-94744053 TTGGTGTTTTGGGAGGCCCATGG - Intergenic
1139651509 16:68364578-68364600 TTCCTGTTCTAGGATTTCTAGGG + Intronic
1141811959 16:86381898-86381920 TTCCTGTTCTAGGAGGTGTCAGG + Intergenic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1143130200 17:4672872-4672894 TGGCTGTGGTGGGAGGTCCAGGG + Exonic
1144771290 17:17760957-17760979 ATGCAGTTCTAGGAGGTTCTTGG - Intronic
1146572082 17:33961610-33961632 TTGCTGTTCTGGGAAGATCACGG + Intronic
1146605829 17:34256784-34256806 TTGCTTGTCCAGGTGGTCCATGG - Exonic
1152456973 17:80422249-80422271 ATCCTGCTCTTGGAGGTCCAGGG + Intronic
1156297705 18:35807985-35808007 TTGCTGTGCTGGGACCTCCAGGG - Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1157533709 18:48443103-48443125 TTGCTGTTCCAGGAGATCATGGG - Intergenic
1163498851 19:17663492-17663514 TTGATGTTCTGGGAGTTACATGG - Intronic
1165173347 19:33908694-33908716 TTGCTGCTCTAGGACGTCTGGGG + Intergenic
1168556293 19:57343872-57343894 TTGCAGTTCTAGGAATTACATGG + Intergenic
925675934 2:6360970-6360992 TTGCTGTCATGGGAGGTGCAGGG - Intergenic
928125353 2:28611786-28611808 ATGCTGTTGTAGAGGGTCCAGGG + Intronic
928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG + Intronic
928490625 2:31778923-31778945 TTGCTGTTCTAGAAGGGCCAAGG - Intergenic
928653910 2:33429524-33429546 TTGCTGGTTTAGTAGGTCTAGGG - Intergenic
932331305 2:70899989-70900011 TTGCTCTTCCAGGAGGGCCGGGG + Intergenic
937231728 2:120401760-120401782 TTGCTGTTCTAGGGCGTGGATGG + Intergenic
938305065 2:130247628-130247650 TTCCCTTTCTATGAGGTCCAGGG + Intergenic
938923391 2:136016100-136016122 ATGCTGTTCTAGGTGGTCAGAGG - Intergenic
940893473 2:159057516-159057538 TTGCTGGTCCAGGAGAGCCAGGG + Intronic
942393990 2:175526890-175526912 TGGCTGTACTAGGTGGTACAAGG - Intergenic
944462662 2:199967656-199967678 TTTCTGTTCTAGCAAGTCTAAGG + Intronic
1174812736 20:53660930-53660952 TTGTTGTTTTAGGAAGCCCATGG - Intergenic
1179310747 21:40193892-40193914 GTCCTATTCTAGGAGCTCCAAGG + Intronic
1180612739 22:17108451-17108473 CTGCTCTTCCAGCAGGTCCAGGG - Exonic
1180842450 22:18965681-18965703 TTGCTCTTGTAGGAGCTCCCTGG - Intergenic
1181059036 22:20273175-20273197 TTGCTCTTGTAGGAGCTCCCTGG + Intronic
1182256553 22:29043148-29043170 TTGCTCTTCTGGGAGCTCCAAGG + Intronic
1182522116 22:30890646-30890668 TTGCTTTTCTCGGATGTTCAGGG - Intronic
1183004333 22:34888573-34888595 TTACAGTTCTGGGAAGTCCAAGG + Intergenic
1183187009 22:36297997-36298019 TTGGTCATCTAGGAGGTCTAGGG - Intronic
1183801816 22:40172713-40172735 TTACTGTTCCAGGAGGTGTAAGG - Intronic
1184197194 22:42937773-42937795 TTGCTGTTCTCGGAGCTGCATGG - Intronic
950853361 3:16083398-16083420 TTTCTCTTCTAGGAGATCCCTGG + Intergenic
951945947 3:28136287-28136309 CTGATGTTCAAGGAGGTCCATGG - Intergenic
954604152 3:51895611-51895633 TTGCTGGTCAACAAGGTCCATGG - Intronic
961636820 3:128338510-128338532 AAGCCCTTCTAGGAGGTCCATGG + Intronic
962242355 3:133760862-133760884 ATGCTACTTTAGGAGGTCCAGGG + Intronic
962864458 3:139435804-139435826 TTTCTGATTTAGGAGATCCAAGG - Intergenic
964235362 3:154519937-154519959 TTCATGTTCTAGGAGATCCTTGG + Intergenic
967653159 3:192011586-192011608 TTTCTGTTGTAGAAGGTCAAAGG + Intergenic
969395565 4:6918416-6918438 TTGCTGTACTAGGAAGTAAAGGG + Intronic
971509778 4:27409867-27409889 TTTCTGTTTTATTAGGTCCAAGG - Intergenic
974850819 4:67403370-67403392 ATTCTGTTCTAGGAGGAACAAGG + Intergenic
974858953 4:67496450-67496472 TTGCAGTTTTAGGTGGTTCATGG - Intronic
983298977 4:165901767-165901789 GTGCTGTTCTGGGAGATCCATGG + Intronic
983585125 4:169346245-169346267 TGGCAGTTCTAGAAGCTCCAAGG + Intergenic
985819473 5:2149827-2149849 TTGCAGGTCAAGGAGGTCCATGG - Intergenic
987145187 5:14984857-14984879 TAGATGTTCTAGCAGCTCCAGGG + Intergenic
987262457 5:16216980-16217002 TTGCTCTTATAGAAGGTTCAAGG - Intergenic
988368626 5:30337056-30337078 TTGCTGATTTAGTAGGTGCAAGG + Intergenic
991567727 5:68021832-68021854 TTTCTGATCCAGTAGGTCCAGGG - Intergenic
995014638 5:107296155-107296177 TTGCTGTTTTGTGAAGTCCAGGG - Intergenic
996659157 5:125979223-125979245 GTGCTGTTCTGGGAGGACCTGGG - Intergenic
998429810 5:142061092-142061114 CTACTGTTCTGGGAAGTCCAAGG - Intergenic
1000400733 5:160824339-160824361 TTGTTGTTCCAGCAGGTACATGG + Intronic
1000420734 5:161035281-161035303 TTCTTGTTCTAACAGGTCCAAGG - Intergenic
1000670035 5:164049967-164049989 ATGCTGTTGCTGGAGGTCCAGGG + Intergenic
1001351319 5:170968686-170968708 TTGCTTTTTTAGTAGTTCCAGGG + Intronic
1002026304 5:176398037-176398059 TTTGTGTTCTAGGAGGCCAACGG - Exonic
1003365694 6:5472677-5472699 GTGATGTCCTAGGTGGTCCAAGG + Intronic
1006652540 6:35563485-35563507 TTGATGTTCTGGGAATTCCAGGG + Intergenic
1008386605 6:50898179-50898201 CTGCTGTTCTAGGAGCTGAAAGG + Intergenic
1009406684 6:63322500-63322522 TTGTTGTTCTAGAAGCTGCATGG + Intergenic
1018482656 6:164207332-164207354 GTGCTGAGCTAGGAGGTCTAGGG + Intergenic
1018735966 6:166687448-166687470 TTGCTGTTCTAGTGGGGGCAGGG + Intronic
1019913832 7:4118002-4118024 TTTCTGTTCTGGGAGTTCCTGGG - Intronic
1020040686 7:4998580-4998602 TTGCTGTTCTAGGAGGTCTGTGG + Intronic
1021763583 7:23925010-23925032 ATGCTGGTGTTGGAGGTCCATGG + Intergenic
1025637446 7:63335385-63335407 TGGCCCTTCTTGGAGGTCCAGGG + Intergenic
1025645251 7:63412714-63412736 TGGCCCTTCTTGGAGGTCCAGGG - Intergenic
1025758267 7:64366678-64366700 TTGCTGGTCTAGGACCTCAATGG - Intergenic
1025790827 7:64685471-64685493 GTGCTGCTGCAGGAGGTCCAGGG - Intronic
1027577627 7:79950148-79950170 TTTCATTTCTAGGAGGTCAATGG - Intergenic
1031310233 7:120187228-120187250 TGGATTTTCTAGGAGATCCAGGG + Intergenic
1031977389 7:128102707-128102729 TCTCTGCTCTAGGAGCTCCAGGG + Intergenic
1032100755 7:128974924-128974946 CTGCTGTTCTAGGAGCTGAAAGG + Exonic
1037024602 8:14018743-14018765 TTCCTTTTCTAGAAGGTCCTAGG - Intergenic
1037669858 8:21005199-21005221 TTGGTGTTTCAGGAGGTCCCTGG - Intergenic
1039434573 8:37551164-37551186 CTGCAGTTCAAGGAAGTCCAGGG - Intergenic
1042467847 8:69148827-69148849 TTCCTATTCTAGGAGGTGCTGGG + Intergenic
1044894056 8:96869731-96869753 TTTCTGATTTAGTAGGTCCAGGG - Intronic
1045473903 8:102537265-102537287 TTCCTGTTTCAGTAGGTCCAGGG - Intronic
1047885874 8:129249478-129249500 GAGCTGTTCTTGGAGGTGCAGGG - Intergenic
1051827011 9:21232635-21232657 TTTGTGTTCTAGGGAGTCCAAGG + Intronic
1052070270 9:24073403-24073425 TTGATGTTCTTGGAAGCCCAAGG + Intergenic
1055942154 9:81660747-81660769 TTGCTGATCTCTGAGGTCCTTGG - Intronic
1057621713 9:96642096-96642118 TTGATGTTTTATGAGATCCAAGG + Intronic
1059374998 9:113875017-113875039 TTGCTCTTCTATGAGATGCAAGG - Intergenic
1059584385 9:115590451-115590473 TAGCTATTCTAGGAGGTCTCTGG - Intergenic
1060918422 9:127404628-127404650 TTGCAGTTCGCTGAGGTCCAAGG + Intronic
1061364594 9:130165318-130165340 TTGCTCTTCCAGGAAGTCCATGG - Intergenic
1203378303 Un_KI270435v1:1687-1709 TTGGAGTGCTAGGAGGTCTATGG + Intergenic
1185659668 X:1717315-1717337 ATTCTGTTCTAGGAGGTGAACGG - Intergenic
1186306484 X:8265085-8265107 TTCCTGTAGTGGGAGGTCCAAGG - Intergenic
1189165770 X:38859389-38859411 TAGCAGTTCTAGGAGGTCCCAGG - Intergenic
1192608300 X:72542706-72542728 CTGCTGCTGTAGGAGGTCTATGG + Intronic
1192797317 X:74434645-74434667 GTGCATTTCTAAGAGGTCCAAGG + Intronic
1193021683 X:76799232-76799254 TTGCAGATCTAGAAGGTGCAGGG + Intergenic
1195975021 X:110517228-110517250 TTGGTGTTCTTGGATCTCCAAGG - Intergenic
1196324708 X:114389515-114389537 CTGCTGTTCTAGGAGCTGAAAGG - Intergenic
1198661541 X:138974097-138974119 TTTCTGTGCTGGGAAGTCCAAGG - Intronic