ID: 904095440

View in Genome Browser
Species Human (GRCh38)
Location 1:27973286-27973308
Sequence GAATTCTTGGGTCTAATACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904095437_904095440 15 Left 904095437 1:27973248-27973270 CCAAAATGTAGTTATAAGCATGT 0: 1
1: 0
2: 2
3: 17
4: 241
Right 904095440 1:27973286-27973308 GAATTCTTGGGTCTAATACCCGG 0: 1
1: 0
2: 0
3: 0
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904095440 Original CRISPR GAATTCTTGGGTCTAATACC CGG Exonic
900481852 1:2903211-2903233 GATGTCTGGGGTCTCATACCAGG - Intergenic
901113650 1:6820533-6820555 TAATTCTAGTGTCCAATACCAGG + Intronic
901768345 1:11517951-11517973 GAGTTCTTGGGTTTAAATCCAGG - Intronic
902082044 1:13827900-13827922 AAAGTCTTGCGTCCAATACCTGG - Intergenic
904095440 1:27973286-27973308 GAATTCTTGGGTCTAATACCCGG + Exonic
907385041 1:54120784-54120806 GAATTCTTGGACCTAGAACCTGG + Intergenic
912052830 1:105551674-105551696 GAACACTTGGCCCTAATACCAGG + Intergenic
919980368 1:202639141-202639163 GAATTCAAGTGTCTGATACCGGG + Intronic
923410332 1:233701826-233701848 GATTTGCTGGGTCTCATACCTGG - Intergenic
923817791 1:237399982-237400004 GATTTCTTGTGTCTTACACCAGG + Intronic
924166180 1:241285646-241285668 GACTTCTTGGGTTTGAAACCTGG - Intronic
1065981364 10:30901540-30901562 GAATTCGGGGGCCAAATACCGGG - Intronic
1066610934 10:37247914-37247936 GAATACTTAGGCTTAATACCTGG + Intronic
1068992792 10:63167064-63167086 GAAGTCTTGGTTTTAATAGCTGG - Intergenic
1074950615 10:118331128-118331150 GAATGCTTGGGTCTTGTACTTGG - Intronic
1076466462 10:130685826-130685848 AAATCCTTGGGTCTAATCCTTGG + Intergenic
1079199617 11:18364858-18364880 AGATTCTTGGGTCTCATCCCAGG + Intronic
1080323730 11:31045522-31045544 GAATTCCTGGTTCTAACAGCAGG - Intronic
1087999834 11:104864463-104864485 GAAGTACTGGGCCTAATACCTGG - Intergenic
1088620793 11:111681193-111681215 AAAATCTTAGGTTTAATACCAGG - Intronic
1092684130 12:11022308-11022330 GAATTGTTGCTTCTAATGCCTGG - Exonic
1093580836 12:20782732-20782754 GAATTCAGGGGCTTAATACCGGG - Intergenic
1097204302 12:57307257-57307279 GACTTCTAGGGTATAAAACCAGG + Intronic
1103589691 12:121982679-121982701 GGATTCTTGAGTTTAATCCCTGG + Intronic
1104276172 12:127329952-127329974 GAAGTCTGGGGTCTAAAATCTGG + Intergenic
1107415843 13:40199442-40199464 GTAATCTTGGGGCTAATACTGGG - Intergenic
1115383467 14:32767733-32767755 GGATTCATGGGACTAAAACCAGG - Intronic
1120554726 14:85915647-85915669 AAATTCTTGGGCCTTATTCCAGG + Intergenic
1120853896 14:89196378-89196400 GGATTCTTGGGTTTAAGTCCTGG + Intronic
1125742971 15:41980254-41980276 GAATTCATGGGTTTAGAACCAGG + Intergenic
1127258850 15:57313180-57313202 GAATTCTTGGGGTCAACACCTGG + Intergenic
1128869948 15:71147049-71147071 GAATTACTGGTTCTAATCCCTGG - Intronic
1130189665 15:81721627-81721649 TAATTCTTAGGTCTAATTCTAGG - Intergenic
1133534401 16:6687168-6687190 GAATTCTTGGTTTTAACATCAGG + Intronic
1142895557 17:2975568-2975590 GAATACTTTGGTGTAACACCCGG + Intronic
1146310231 17:31762954-31762976 GAATTCAGGGGTTAAATACCGGG + Intergenic
1153770968 18:8416247-8416269 GAATCCTGGGGTCTTATGCCGGG + Intergenic
1164242738 19:23404229-23404251 GAGATGTTGGCTCTAATACCTGG - Intergenic
934965229 2:98715680-98715702 TAATTAATGGGTATAATACCTGG + Intronic
944622351 2:201529425-201529447 GAATACTTGGGTTTATTACTGGG - Intronic
1170038301 20:12013234-12013256 GCATTCTTGAGTCTAGTCCCTGG - Intergenic
1170279196 20:14626552-14626574 GAATTCCTGGTTCTAACACAGGG + Intronic
1173833105 20:46105373-46105395 GACTTCTTGGCTCTAAATCCTGG + Intergenic
949338064 3:2998419-2998441 AAATTCCTGGGTCTCATCCCTGG - Intronic
949969186 3:9388233-9388255 GAAAACTTGTGTCTAATATCAGG - Intergenic
950910823 3:16589729-16589751 GGAGTCTTTTGTCTAATACCAGG + Intronic
957372933 3:79319451-79319473 GAATACCTGGGTGTAATAGCAGG + Intronic
957400267 3:79702815-79702837 GAATTCTTGGTTTTAAAACATGG - Intronic
959348515 3:105230836-105230858 GATTTCTAGGGTTTAATTCCAGG - Intergenic
962493742 3:135919234-135919256 GAATTCTGAGGTCTAAACCCTGG + Intergenic
965770549 3:172177250-172177272 GGATTCCTGGGCCTAATGCCAGG + Intronic
966324064 3:178734664-178734686 GAGGACTTGGGTCTAAAACCTGG - Intronic
967701327 3:192595599-192595621 GAATTCTTGAGTCTCACCCCAGG - Intronic
972576957 4:40360628-40360650 GAATTCTTTCCTCCAATACCTGG - Intergenic
975993571 4:80286850-80286872 GAATTCTTTGTACTAATACAGGG + Exonic
977883795 4:102235874-102235896 GAATTCTGGGGCTAAATACCAGG + Intergenic
978368074 4:108003466-108003488 GAGTTCCTGGGTTTAAAACCTGG - Intronic
983469828 4:168142476-168142498 GAGGTCTTGTGTCTAGTACCTGG - Intronic
984180487 4:176476842-176476864 GACTTCCTGGGTCTAGTACTTGG - Intergenic
987446136 5:18021853-18021875 ACATTCTTGGGGCTGATACCTGG - Intergenic
994758713 5:103827063-103827085 AAATCCTTGGGTCAGATACCTGG + Intergenic
994921471 5:106049533-106049555 GAATGCCTGGGGCTAATATCTGG - Intergenic
998912552 5:146976017-146976039 GATTTCTTGGATATGATACCAGG - Intronic
1004904751 6:20226813-20226835 TAATTCTTGGGTATAATATGAGG + Intergenic
1008342396 6:50383277-50383299 GAAGTCTTGGGTCTTCCACCAGG + Intergenic
1014900487 6:126957868-126957890 AAGTGCTTGGTTCTAATACCAGG - Intergenic
1016412963 6:143802690-143802712 GAATTATTAGGCCTAAAACCTGG + Intronic
1018480425 6:164184100-164184122 GAATTCTTGGTTCTAATTTGAGG - Intergenic
1019369336 7:652767-652789 GATTTCTTGGCTCCAATAACTGG + Intronic
1020393213 7:7683309-7683331 CAATTCCTGGGCCTAATCCCAGG - Intronic
1026415080 7:70171046-70171068 GCCTTCTTGGGTCTACTGCCAGG + Intronic
1027535443 7:79394161-79394183 AGAGTCTTAGGTCTAATACCAGG - Intronic
1028001220 7:85500812-85500834 GAATTTTTTGGCTTAATACCTGG + Intergenic
1028110895 7:86939846-86939868 GATTTCTTGGGAGTAAAACCAGG + Intronic
1031543990 7:123030400-123030422 GAATACGTGTTTCTAATACCTGG + Intergenic
1031560594 7:123233266-123233288 GAATTCCTTGGTATAATACTTGG - Intergenic
1032952254 7:136928228-136928250 GAATTTTTGGATTTGATACCAGG - Intronic
1042150890 8:65782561-65782583 GAAATCTTTGGCCTAATAACTGG - Intronic
1052058095 9:23925306-23925328 GAATTCAGGGGCCAAATACCGGG - Intergenic
1053023769 9:34714233-34714255 GATTTCTTGGATCTTTTACCTGG + Intergenic
1058316545 9:103574021-103574043 TAATTAATGGGTTTAATACCTGG + Intergenic
1059737632 9:117118093-117118115 GGATTCTTGGGTCTACATCCTGG + Intronic
1060711941 9:125875614-125875636 GAATTCTTGGTTCTAGTTCTTGG + Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1191025534 X:55909038-55909060 GAAGTCGAGGCTCTAATACCTGG - Intergenic
1193233745 X:79080327-79080349 AAATTCTTGGGCCTCATTCCAGG + Intergenic
1201501590 Y:14649171-14649193 TACTTCATGGGTCTCATACCAGG - Intronic