ID: 904096024

View in Genome Browser
Species Human (GRCh38)
Location 1:27978069-27978091
Sequence CTGTCTTTGAAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2298
Summary {0: 2, 1: 44, 2: 309, 3: 684, 4: 1259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904096021_904096024 12 Left 904096021 1:27978034-27978056 CCTTTTTGCAGTCAAGTCTGATG 0: 1
1: 0
2: 1
3: 15
4: 145
Right 904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG 0: 2
1: 44
2: 309
3: 684
4: 1259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904096024 Original CRISPR CTGTCTTTGAAGATGGAAGA TGG Intronic
Too many off-targets to display for this crispr