ID: 904099521

View in Genome Browser
Species Human (GRCh38)
Location 1:28012381-28012403
Sequence TGTCCACTTATTAGACTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904099521 Original CRISPR TGTCCACTTATTAGACTGGT AGG Intronic
902984847 1:20149090-20149112 TGTCCCCATATTAGCCTGGGGGG - Exonic
904093961 1:27963414-27963436 TGTCCACTCATTAGATGGGTGGG + Intronic
904099521 1:28012381-28012403 TGTCCACTTATTAGACTGGTAGG + Intronic
909532905 1:76700727-76700749 TCTCCACTTACTATAATGGTTGG + Intergenic
915105292 1:153531498-153531520 TGTTCACTTGTTATACTGGGTGG + Intergenic
919856838 1:201711958-201711980 TGTCCAGATATTAGCCTGGACGG - Intronic
923942043 1:238838494-238838516 TTTCAACTTATTAATCTGGTGGG + Intergenic
1066187343 10:33023091-33023113 AGTCTACTAATTAGCCTGGTTGG - Intergenic
1070155016 10:73827896-73827918 TGTCCACTTTTTAGGCTACTGGG + Intronic
1083032176 11:59603061-59603083 TGGCTGCTTATGAGACTGGTGGG - Intronic
1085570338 11:77552964-77552986 TGTCCAGTTTTTGGACAGGTAGG - Intronic
1086768707 11:90732835-90732857 TGTCCACATATTAGGCAGGATGG + Intergenic
1087855650 11:103089277-103089299 TCTCCACTTATTAGTCTAGCAGG + Exonic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092247250 12:6870572-6870594 TCTCCACTTACTATAATGGTTGG + Exonic
1095691267 12:45091926-45091948 TGTGCACTTCTTAGACATGTAGG + Intergenic
1098524905 12:71476096-71476118 TGTCCACCTATTAATCTGGCTGG - Intronic
1103221610 12:119251048-119251070 TGTCCACTTATTAGATTGCCTGG - Intergenic
1106705061 13:32271249-32271271 TGGCCACTTACTAGCCTGCTAGG + Intronic
1107677975 13:42816613-42816635 TGTCCACATATTTGGTTGGTGGG - Intergenic
1108332369 13:49401729-49401751 TGTCAACTGATTAAACTGGCTGG + Intronic
1114592762 14:23882875-23882897 TGTCCTCTTATGTTACTGGTGGG + Intergenic
1124805899 15:32882500-32882522 TGTCCACTGTCTACACTGGTAGG + Intronic
1125629376 15:41134604-41134626 TGTCCAGTTTTTGGACAGGTAGG - Intergenic
1128332879 15:66767395-66767417 TGTCTGCCTATTAGCCTGGTGGG + Intronic
1149161685 17:53701254-53701276 TGTCCTCTTAGTAGACAGGATGG + Intergenic
1151147554 17:72055002-72055024 TCTCCGCTTATTAGCCTTGTGGG - Intergenic
1151895347 17:76976727-76976749 TGTCCTCGTATTAGTCTGCTTGG + Intergenic
1154024584 18:10695578-10695600 TCTCCACATAGGAGACTGGTGGG - Intronic
1156357193 18:36351897-36351919 TGTGCTCTTCTTAGACTGGAAGG - Intronic
1156603148 18:38634411-38634433 TGGCCACTTGTCAGACTGATGGG - Intergenic
1162262361 19:9543330-9543352 TGTCCAGTTTTTGGACAGGTAGG - Intergenic
1166801998 19:45463601-45463623 TGCCCACTCATGAGACTGGTGGG - Intronic
925903478 2:8525177-8525199 TGACCACCCATGAGACTGGTTGG + Intergenic
930223863 2:48772213-48772235 TGTCCACTAATAAAACTGTTAGG - Intronic
937211050 2:120271392-120271414 TGTCCACTTAGATGACTTGTCGG - Intronic
939138768 2:138328303-138328325 TGGCCATTTTTTAAACTGGTTGG - Intergenic
942262149 2:174177559-174177581 TCTGCACTTCTTAGACTGCTTGG + Intronic
942886826 2:180935653-180935675 TTACCAGTTATTAGATTGGTGGG - Intergenic
945858269 2:215092677-215092699 TGTCCAGTTTTTGGACAGGTAGG - Intronic
946518128 2:220435592-220435614 TAGCCACTTATTAGAATGCTTGG - Intergenic
1178378577 21:32089585-32089607 TTTCCATTTATTATAGTGGTGGG + Intergenic
1182828061 22:33282818-33282840 TGTCCATTCATTCGTCTGGTAGG - Intronic
1183636676 22:39067898-39067920 TGTCCAGTTTTTGGACAGGTAGG + Intronic
950484815 3:13266883-13266905 CGTCCACTTCATAGCCTGGTGGG - Intergenic
958947762 3:100383081-100383103 TGTGGAGTAATTAGACTGGTTGG - Intronic
964010939 3:151890859-151890881 TGTACACATATTAGTCTGGTAGG - Intergenic
970004726 4:11399726-11399748 GGTCCACTTCTTCGACTGGGAGG - Exonic
977841089 4:101705934-101705956 TTTCCACTTATCAGATTGGCAGG - Intronic
979016476 4:115441107-115441129 GGACCACTTAATACACTGGTGGG - Intergenic
980389619 4:132126040-132126062 TGTCCATTCTTTAGACTGATAGG - Intergenic
991549983 5:67825369-67825391 TGCTCACTTCTTAGAGTGGTTGG + Intergenic
1000532905 5:162445341-162445363 TAACCACTTATTATACTGATAGG - Intergenic
1000678613 5:164155244-164155266 TGTCACCTTTTTAGACTGGCAGG - Intergenic
1003847765 6:10191202-10191224 AGTCCAGTAATTAGACTGGAGGG + Intronic
1004423566 6:15492566-15492588 TGTCCTTTTGTTAGATTGGTGGG + Intronic
1004993984 6:21170306-21170328 TGTCTACTTATGAGGTTGGTTGG + Intronic
1006534228 6:34685018-34685040 TGTCCACAAAATAGACTGGAAGG + Intronic
1019097057 6:169590772-169590794 TGTCCACTGGTTAGACCGGTGGG - Intronic
1021089989 7:16472276-16472298 AGACCAATTATTAGGCTGGTGGG - Intronic
1023306454 7:38833594-38833616 TGTTGACTTTTTAGATTGGTTGG - Intronic
1023611002 7:41970853-41970875 TGTACAATTATTATACAGGTAGG + Intronic
1025109899 7:56205381-56205403 TGTCCACATATCAGGCAGGTTGG + Intergenic
1026307989 7:69159265-69159287 TGTCCACATATCAGGCAGGTTGG - Intergenic
1035083239 7:156235006-156235028 TGTCCACTATGTAGCCTGGTAGG - Intergenic
1036573376 8:10001796-10001818 TATCCACTTCATAGACTTGTTGG + Intergenic
1040852758 8:51919006-51919028 CCTCCACTTATTAAACTGGTAGG - Intergenic
1041663101 8:60417768-60417790 TGTCCACTGATTATAGTGCTAGG - Intergenic
1044313525 8:90723973-90723995 AGTCCACTGAGTAGTCTGGTGGG + Intronic
1045906444 8:107351470-107351492 TGTTCTGTTATTGGACTGGTTGG + Intronic
1054926223 9:70591300-70591322 GGTCCACTTTCTAGACTGCTGGG + Intronic
1059267708 9:113051308-113051330 AGTCCTCTTATTAGGCAGGTGGG + Intronic
1197305892 X:124841754-124841776 TGTCCACTTACTAAACAGGAAGG + Intronic