ID: 904105533

View in Genome Browser
Species Human (GRCh38)
Location 1:28078840-28078862
Sequence CCAACCTGGTATTCGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904105530_904105533 2 Left 904105530 1:28078815-28078837 CCAATGCTATACACATAGTAAGT 0: 1
1: 0
2: 5
3: 30
4: 291
Right 904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
904105528_904105533 4 Left 904105528 1:28078813-28078835 CCCCAATGCTATACACATAGTAA 0: 1
1: 0
2: 1
3: 31
4: 299
Right 904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
904105529_904105533 3 Left 904105529 1:28078814-28078836 CCCAATGCTATACACATAGTAAG 0: 1
1: 0
2: 2
3: 28
4: 308
Right 904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904105533 Original CRISPR CCAACCTGGTATTCGAGCCC AGG Intronic
900636771 1:3669769-3669791 CCAGCCTGGGAGTCCAGCCCTGG - Intronic
903229053 1:21910954-21910976 CCAAGCTGGGAGTCAAGCCCAGG + Intronic
903278426 1:22236319-22236341 CCAGGCTGGTACTGGAGCCCAGG - Intergenic
903787826 1:25873237-25873259 CCAACCTGGGAGCCCAGCCCTGG + Intergenic
903876540 1:26478301-26478323 CCAGCCTGGTATTCAACTCCTGG + Intergenic
904105533 1:28078840-28078862 CCAACCTGGTATTCGAGCCCAGG + Intronic
907786047 1:57613831-57613853 CCCACCTGGAATTTGAACCCAGG - Intronic
907799771 1:57753025-57753047 CCAACATGCTGTTCCAGCCCCGG - Intronic
911779794 1:101861727-101861749 CAAACCTGGCATTCCAACCCAGG - Intronic
916912199 1:169363028-169363050 CCAGCCTGGTCTTGGACCCCTGG - Intronic
919904759 1:202070563-202070585 CCAACCTAGAATTTCAGCCCAGG - Intergenic
1066220922 10:33335734-33335756 CCAACCTTGTCTGGGAGCCCAGG + Intronic
1066663788 10:37762426-37762448 CAGACCTGGGATTTGAGCCCAGG + Intergenic
1067029973 10:42873345-42873367 CCAAGGTGGTATTGGAGCCAGGG + Intergenic
1070511119 10:77161452-77161474 CCAAGCTGGTCTTCAACCCCTGG + Intronic
1073101216 10:101007604-101007626 CAAACCTGGGAACCGAGCCCAGG - Exonic
1073376431 10:103039430-103039452 TCAACCTAGTATTAGAGGCCAGG - Intronic
1073947150 10:108764320-108764342 TCAACCTGGTATTCAAACTCAGG - Intergenic
1075252057 10:120888361-120888383 TCAAGCTGGGATTCAAGCCCAGG + Intronic
1075730530 10:124632890-124632912 CCGAGCTGGGATTCCAGCCCAGG - Intronic
1077535576 11:3122474-3122496 CCAACCTGGGCTCCTAGCCCTGG - Intronic
1078656894 11:13249551-13249573 CAAAGCTGGGATTTGAGCCCAGG + Intergenic
1079387054 11:19989813-19989835 CCAAGCTGGGATTCAAACCCAGG + Intronic
1082818918 11:57530421-57530443 CGAGCCTGGAAATCGAGCCCCGG + Intronic
1084174547 11:67416463-67416485 GCAAACTGGGATTCGAGCCCAGG + Intronic
1085791692 11:79502225-79502247 CCAAACTGGGATTCAAACCCAGG - Intergenic
1090355613 11:126138649-126138671 CCAAGCTGGTATTCCACCCAAGG + Intergenic
1090551275 11:127822506-127822528 CCAATCTGGAATTTGAACCCAGG - Intergenic
1092261383 12:6955073-6955095 CCAGCCTTGAATTCAAGCCCAGG - Intronic
1098170212 12:67739203-67739225 CCAGACATGTATTCGAGCCCAGG - Intergenic
1101873931 12:108586634-108586656 CGAAGCTGGGATTCGAACCCAGG - Intergenic
1102600798 12:114028816-114028838 CCAAGCTGGGATTTGAACCCAGG + Intergenic
1102733713 12:115138372-115138394 CCAGCCTGGTGTCCCAGCCCTGG - Intergenic
1103405469 12:120671855-120671877 CCAACCTGGTCTTGAACCCCTGG - Intergenic
1104586589 12:130052834-130052856 CCAAGCTGGGATTCAAACCCAGG + Intergenic
1110145556 13:72186368-72186390 CAAACCTGGGATTTGAGCTCAGG + Intergenic
1122788918 14:104176299-104176321 CCAACCTGGGGTCCGTGCCCTGG + Exonic
1122798736 14:104219440-104219462 CAAAGCTGGAATTCGGGCCCAGG + Intergenic
1125421891 15:39512220-39512242 CAGAACTGGAATTCGAGCCCTGG - Intergenic
1133661457 16:7921986-7922008 CCAACCTGGGATTGTTGCCCGGG + Intergenic
1135783000 16:25322797-25322819 CAAAGCTGGGATTCGAACCCAGG + Intergenic
1137675327 16:50301192-50301214 CCTACCTGGTCATCGACCCCCGG + Exonic
1138094815 16:54203258-54203280 CCAATCTGTTACTCAAGCCCTGG - Intergenic
1140981922 16:80118665-80118687 CCTTCCTAGTATTCGTGCCCTGG + Intergenic
1143085800 17:4415266-4415288 CCAACCTGGCATCCCATCCCAGG + Intergenic
1143106750 17:4534027-4534049 CCAACCCTGTTTTCCAGCCCTGG - Intronic
1148832319 17:50441551-50441573 CCAACCTGGGATTCAAACCCAGG - Intronic
1152448282 17:80359314-80359336 CCAAGCTGGTCTTCAACCCCTGG - Intronic
1157572162 18:48720413-48720435 CCATCCTGTCATCCGAGCCCAGG + Intronic
1157738639 18:50072891-50072913 CCAGCCTGGAATGTGAGCCCTGG - Intronic
1160665499 19:326175-326197 CCAACCTGGCATCCCAGCCGTGG - Intronic
1160966105 19:1747613-1747635 CCAGCCTGGCATTCAAGGCCTGG + Intergenic
1162738592 19:12760682-12760704 CCAACCAGGTCTTCAAGCTCTGG + Intergenic
1167457624 19:49605738-49605760 CCAACCTGGGATTGGAGCCAGGG + Intronic
925051796 2:821295-821317 ACAGCCTGAGATTCGAGCCCAGG - Intergenic
931665959 2:64609581-64609603 CCACCCTGGGATCTGAGCCCGGG + Intergenic
933426929 2:82125799-82125821 CCAACCTGGTTTTCAGGCCTTGG - Intergenic
933632603 2:84674270-84674292 CAAAACTGGGATTAGAGCCCAGG + Intronic
934059590 2:88281804-88281826 CCAAGCTGGGATTCGAACCCAGG - Intergenic
934772288 2:96914677-96914699 CCAGCCTGGTCTTAGACCCCTGG - Intronic
945251889 2:207770946-207770968 CAACCCTGGGATTCGAACCCAGG + Intergenic
946002727 2:216496375-216496397 CCAATCTGTTATTCCAGCTCTGG - Intergenic
946919142 2:224559870-224559892 CCAACCTGGTCTTGAAACCCTGG - Intronic
946930957 2:224670694-224670716 CCATCCTGGAGTTCAAGCCCCGG - Intergenic
1174140015 20:48406117-48406139 CCCGCCTGGTTTTCCAGCCCTGG - Intergenic
1174729411 20:52900817-52900839 CTAACCTGGAATTTGAACCCAGG - Intergenic
1176143781 20:63556529-63556551 CCACGCTGGTGTACGAGCCCTGG + Exonic
1178942343 21:36916579-36916601 CCAACCTGGTCTTCAACACCTGG + Intronic
1182329460 22:29540509-29540531 CCAAGCTGGGATTTGAACCCAGG + Intronic
1182611664 22:31553050-31553072 CCAAGCTGGTCTTGGACCCCTGG + Intronic
1182795998 22:32992081-32992103 ACAACCTGGTTTTCTGGCCCAGG - Intronic
1184604444 22:45564105-45564127 CACAGCTGGTATCCGAGCCCTGG + Intronic
951061778 3:18216929-18216951 CCAAAATGGTATTCAAGCCAGGG - Intronic
952818701 3:37467548-37467570 CCAAACTGGCATTGGAACCCTGG - Intronic
955983787 3:64552486-64552508 CCAACAGGGTATTCAATCCCTGG - Intronic
957412588 3:79860372-79860394 CCACCCTGGTTTTCGAGCTGAGG + Intergenic
965367277 3:167816239-167816261 CCAAGCTGGTATCCGACTCCTGG + Intronic
967739326 3:192987604-192987626 CAAACCTGGCATTAGACCCCAGG - Intergenic
970563024 4:17301574-17301596 CAAAGCTGGGATTCAAGCCCAGG - Intergenic
970811862 4:20103786-20103808 CCATCTTGGGATTCCAGCCCAGG - Intergenic
984591571 4:181623166-181623188 CAAAACTGCCATTCGAGCCCAGG - Intergenic
985621908 5:960274-960296 CCCACCTGGTATGAGCGCCCAGG + Intergenic
989094428 5:37768537-37768559 CCAACCTGGAATTTGAACCCAGG - Intergenic
989603652 5:43223243-43223265 CCCAGCTGGGATTCAAGCCCAGG - Intronic
994227343 5:97268101-97268123 CCTATCTGGTATTCCAGCTCTGG + Intergenic
997640046 5:135443032-135443054 CCTCCATGGTATTCTAGCCCTGG + Intergenic
999562866 5:152824249-152824271 TCAAGCTGGAATTAGAGCCCAGG - Intergenic
1002535671 5:179874172-179874194 CCAGCCTGGCCTTCAAGCCCCGG - Intronic
1006957475 6:37886783-37886805 CCAACCTGGTCTTGAACCCCTGG - Intronic
1014160877 6:118166843-118166865 CCAACCTGGTACGCAAGCCAAGG + Intronic
1015374346 6:132492629-132492651 CAAAGCTGGTATTTGAGCCCAGG - Intronic
1016394122 6:143604484-143604506 CCTAACTGAAATTCGAGCCCAGG - Intronic
1017846057 6:158259600-158259622 CCAAGCTGGTGTTAGAGCACTGG - Intronic
1024578699 7:50784497-50784519 ACAACCTGTTGTTCTAGCCCAGG - Intronic
1030765511 7:113404524-113404546 CCAAGCTGGTATTCATGCCCAGG - Intergenic
1033516690 7:142113709-142113731 CCAACCTGTATTTCTAGCCCAGG - Intronic
1036136289 8:6164676-6164698 CCAACCTGGCATTGGAGTCTAGG - Intergenic
1038335481 8:26642107-26642129 CCAAGCTGGAATTTGATCCCAGG - Intronic
1046180733 8:110644138-110644160 AAAACCTAGTATTCAAGCCCGGG + Intergenic
1049165397 8:141122397-141122419 CCAGACTGGTATTTGAGCCAGGG - Intronic
1052971993 9:34382194-34382216 CCAGCCAGGGATTGGAGCCCAGG + Intronic
1056710973 9:88991601-88991623 CCCATCTGGCATTCGAGCGCAGG + Exonic
1058764196 9:108165459-108165481 CCAGGCTGGTAGTCGATCCCAGG + Intergenic
1059432151 9:114256789-114256811 CCAAACTGGCATGTGAGCCCGGG + Intronic
1059442273 9:114315155-114315177 CCCACCTGGGATTGGAGACCAGG - Intergenic
1185925396 X:4140054-4140076 CCAAGCTGTTATTGGAGTCCAGG + Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1193853286 X:86566898-86566920 CAAAGCTGGAATTAGAGCCCAGG + Intronic
1196048226 X:111278450-111278472 CAAAGCTGGCATTTGAGCCCAGG - Intergenic
1197774096 X:130109151-130109173 CCAACCTGGCACTCGGGCCAGGG + Intronic
1199558110 X:149131465-149131487 CCAACCTGGAATTCAACCCAGGG - Intergenic
1201221017 Y:11770396-11770418 CCAGCCTGGAAGTCTAGCCCTGG - Intergenic