ID: 904105793

View in Genome Browser
Species Human (GRCh38)
Location 1:28081669-28081691
Sequence TCTTATTTTGAAAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 440}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904105793 Original CRISPR TCTTATTTTGAAAAGGGGGA GGG Intronic
900709011 1:4099657-4099679 TCTTACTTTTATAAGAGGGAGGG - Intergenic
902417906 1:16252795-16252817 TCATATTTTCAAAGGGGAGAGGG - Intronic
902890978 1:19443423-19443445 TCTTATTTTAAAAAAAGGAATGG - Intronic
903137726 1:21320286-21320308 TCTCATTTATAAAATGGGGATGG + Intronic
903868875 1:26418228-26418250 TCTTTTTTTGATAACAGGGAAGG - Intronic
904105793 1:28081669-28081691 TCTTATTTTGAAAAGGGGGAGGG + Intronic
904346515 1:29875509-29875531 TCTAGTTTTAAAAAGGGTGAAGG + Intergenic
904693999 1:32317127-32317149 TCTTCTTTTGTAAAGTGGGCTGG + Intronic
904959122 1:34317026-34317048 TTGTATTTTGAAATGTGGGAAGG + Intergenic
905405472 1:37729550-37729572 TCTTTTTTTAAAAAGAGCGATGG - Intronic
907208908 1:52801107-52801129 TGTTTTTTTGAAAGGGAGGAAGG + Intronic
907800761 1:57763064-57763086 GCTTATTTTGCAATAGGGGAGGG - Intronic
908356582 1:63329268-63329290 TTTTATGTTAAAATGGGGGAGGG - Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908831964 1:68188283-68188305 TCTTATTTTGAAGTGTGGGAGGG + Intronic
910305736 1:85761195-85761217 TCTTATTTATAAAATGGAGATGG - Intronic
911302944 1:96198141-96198163 TCTTGTGTTGAATAGGAGGAGGG + Intergenic
911704556 1:100996361-100996383 TCTGATTTTTAAAAGGAAGAGGG + Intronic
912049843 1:105514635-105514657 TCTTATTCTAACAAGGGGCATGG - Intergenic
912108387 1:106309713-106309735 TGTTATTTTGAAAAGGTAAAAGG + Intergenic
913240675 1:116826763-116826785 TCTTATTTTAAAACAAGGGATGG + Intergenic
915374365 1:155379990-155380012 TCTTAAGTGGTAAAGGGGGAGGG - Intronic
916277320 1:163008777-163008799 TATTTTTTTAGAAAGGGGGAGGG + Intergenic
917823625 1:178792998-178793020 CCTGATTTTACAAAGGGGGAGGG - Intronic
918200683 1:182263752-182263774 TCTTATTTTGAAAAATGTGTAGG + Intergenic
918358970 1:183735417-183735439 TCTATTTTTTAAAAGGGTGATGG + Intronic
918822197 1:189269634-189269656 TTTTATTTTCAAATGGGGCAAGG + Intergenic
919025872 1:192169528-192169550 TCTTTTTGTGAAATGGGGAAAGG + Intronic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
921555431 1:216592942-216592964 TCTCATTTTAAAAATGAGGAAGG + Intronic
922242704 1:223766508-223766530 GGCTATTTTGAAAAGGGAGAAGG - Intronic
923206387 1:231762905-231762927 TCTTATTTTAAAAATGAAGAAGG + Intronic
1062847524 10:718739-718761 TGTTATTCTGGAGAGGGGGAAGG - Intergenic
1063490089 10:6456142-6456164 TCTTATTTTTTAATGGGGGCAGG + Intronic
1063651664 10:7943958-7943980 TTATACTTTGAAAAGGGGGTGGG + Intronic
1065309185 10:24397656-24397678 TGACAGTTTGAAAAGGGGGAAGG + Intronic
1065410083 10:25416488-25416510 TCTCATTTTGAGGATGGGGATGG - Intronic
1066244749 10:33571537-33571559 TCTTATTTTTAAAGGGGAAAGGG + Intergenic
1066572938 10:36792853-36792875 TCTTTTGTAGAAAAGGGGGCTGG + Intergenic
1067216604 10:44309416-44309438 TTTTATATTAAAGAGGGGGAGGG + Intergenic
1068785551 10:60968614-60968636 TCTGATTTTCAAAATGGGGAGGG + Intronic
1068841502 10:61619762-61619784 CCTTATTTGGTAAAGGGGGGTGG - Intergenic
1068847750 10:61698889-61698911 TCATATTTTGGAAACGAGGAAGG + Intronic
1069176659 10:65297873-65297895 CCTATTTTTTAAAAGGGGGAAGG + Intergenic
1071475673 10:86023191-86023213 TCTTAGTGTGGAAAGGGGCAGGG - Intronic
1071959047 10:90791073-90791095 TTTCATTTTGAAAAGGGGCAGGG + Intronic
1072639353 10:97199766-97199788 TCTTATTTTAAAATGAGGCAGGG - Intronic
1074171768 10:110946813-110946835 TTTTATTTTGAAAGATGGGATGG + Intronic
1074483078 10:113845269-113845291 TCTTAGTTTAAAGAGGGGTAGGG + Intronic
1074895724 10:117776158-117776180 TCTTGTTTTAAAAAGCTGGATGG + Intergenic
1074914542 10:117942737-117942759 TCATATTTTGCAAAGCTGGATGG + Intergenic
1078081799 11:8209459-8209481 TCTTATTTTGCAAAGAGGACTGG + Intergenic
1078295788 11:10068731-10068753 CATTATTTTGAAAGGGGTGACGG - Intronic
1078719998 11:13875617-13875639 CATAATTTTGTAAAGGGGGAAGG - Intergenic
1078985930 11:16597417-16597439 TCTAATTTTAAAAATGGGGATGG - Intronic
1079835234 11:25326025-25326047 ACTTATTTTGAAAAGGAAAAAGG - Intergenic
1080577481 11:33613398-33613420 TCTTCTTTTGAAAAGGAGACTGG + Intronic
1080887386 11:36378695-36378717 ACTTGTTTTAAAAAGGGGAAAGG + Intronic
1081561517 11:44221430-44221452 TCTCATTTTGAACAGGGGGAGGG - Intronic
1082925856 11:58546506-58546528 TCTGAGATTGAAAAAGGGGATGG - Intronic
1083957709 11:65994746-65994768 TCATTTTTTAAAAAGAGGGAGGG + Intergenic
1085225267 11:74914280-74914302 TCTAAAATTTAAAAGGGGGATGG - Intronic
1085386253 11:76159981-76160003 TCTTCATTTGAAAAACGGGATGG - Intergenic
1085425878 11:76404251-76404273 TCTTATTTATAAAATGGAGATGG - Exonic
1085431621 11:76455556-76455578 TCCTATTTTGAGTGGGGGGAGGG - Intronic
1086153439 11:83639189-83639211 TCTCACTTGGGAAAGGGGGAGGG - Intronic
1087246651 11:95846484-95846506 TCTTATTTTGTAAAGAGGCTGGG + Intronic
1087393250 11:97566540-97566562 TCTTATTTTGAAGATGGAGTAGG - Intergenic
1087492926 11:98850462-98850484 TCTTTTTTTAAAAAGGGGTTTGG - Intergenic
1087624022 11:100575005-100575027 TCTAATTTATAAAATGGGGATGG - Intergenic
1087937596 11:104053082-104053104 TCTTATTATGAAAATTGGAATGG + Intronic
1088314687 11:108496157-108496179 TTATATTTTTAAAATGGGGATGG + Intronic
1088350896 11:108886112-108886134 TTTTATTTTGAGAAGGGGAGGGG + Intronic
1088420738 11:109643224-109643246 TCTTAGATGGAAAATGGGGAAGG + Intergenic
1088904283 11:114142700-114142722 TCTTGTTTTGAATGGTGGGAAGG + Intronic
1089636444 11:119816635-119816657 TTGAATTTTTAAAAGGGGGAAGG - Intergenic
1091372185 11:135070234-135070256 ACTTATTTTGAACAGGAGGGCGG - Intergenic
1091505375 12:1062290-1062312 TCTTTTTTTGAAAATGAAGACGG + Intronic
1092585261 12:9893745-9893767 ACTAATTTTGAAAAATGGGATGG + Intronic
1092669499 12:10847194-10847216 GCTGATTTTGAAAAGGAGGTGGG + Exonic
1092738290 12:11604850-11604872 TTTTCATTTGAAAAGGGAGAGGG - Intergenic
1092918448 12:13209101-13209123 TCCTCTTCTTAAAAGGGGGAAGG - Intronic
1093258031 12:16896648-16896670 ACTTATTATGAAAATAGGGAAGG + Intergenic
1093705402 12:22269329-22269351 TGTTATTTTGAAAAGAAGCAAGG - Intronic
1094637855 12:32244315-32244337 GCTTATTTTCATAAGGGGAAAGG - Intronic
1094656313 12:32422724-32422746 TTTAATTTAGAAAAGGGGGAGGG - Intronic
1095434879 12:42176592-42176614 ACTTATTTTGAAGGTGGGGATGG - Intronic
1096057659 12:48668212-48668234 TCTTGTTTTAAAAGGTGGGAAGG - Intronic
1096101921 12:48974680-48974702 TTCTATTTTATAAAGGGGGAGGG + Intergenic
1096109214 12:49019254-49019276 TTATTTTTTAAAAAGGGGGAGGG + Exonic
1096309300 12:50505659-50505681 TCTCTTTTTGAAAGGGGGAAGGG - Intronic
1096687886 12:53300757-53300779 ACTTCTTTTGAAAAGAGGCAGGG - Intronic
1096805623 12:54139417-54139439 TCTTATTTTTAAATCTGGGATGG - Intergenic
1097463184 12:59888981-59889003 TATTACTTGGAAAAGGGAGATGG + Intergenic
1097608411 12:61784689-61784711 TTTTTTTTTGAAAAATGGGAGGG - Intronic
1097670089 12:62525739-62525761 TTTTATTTTAAAAAGGGAAATGG + Intronic
1097754175 12:63390519-63390541 CTTTATCTTGAAATGGGGGAGGG + Intergenic
1098257761 12:68635176-68635198 TTTTATTTTTAAAAGAGGGTAGG + Intronic
1098538160 12:71619408-71619430 TTCTATTTTAAAAAGAGGGAGGG + Exonic
1098869541 12:75801573-75801595 TCTTATTGAGAACAGGGAGATGG - Intergenic
1099623167 12:85030423-85030445 TATTATTCTGAGAAAGGGGAAGG - Intronic
1100459254 12:94782644-94782666 TTTTATTTTGAAAATGTGAAAGG + Intergenic
1100820889 12:98428544-98428566 TCTTATCTCTAAAACGGGGATGG - Intergenic
1101889639 12:108701663-108701685 TCTTATCTGTAAAAGGGGAAGGG - Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1102859548 12:116323489-116323511 TTTTTTTTTGAGATGGGGGATGG - Intergenic
1105519579 13:21119976-21119998 TTTTATTTATAAAACGGGGAGGG - Intergenic
1106274008 13:28186083-28186105 TTGTATTTTGAAAACGGGGAAGG + Intronic
1108288105 13:48928680-48928702 TGACACTTTGAAAAGGGGGAAGG + Intergenic
1108289335 13:48942750-48942772 ACTTGTTTTCAAAAGGGGGAGGG - Intergenic
1108289504 13:48944563-48944585 ACTTTTTTTCAAAAGGGGAAGGG + Intergenic
1109594147 13:64527194-64527216 TCTAACTTAGAAAAGGAGGAAGG - Intergenic
1110725481 13:78817783-78817805 TATTATTTTGAAAACTGTGAAGG - Intergenic
1111158347 13:84358323-84358345 TCTTTTTATTAAAACGGGGATGG + Intergenic
1111241495 13:85481327-85481349 TTGTATTTTGAAATGGGAGAGGG - Intergenic
1111786267 13:92790612-92790634 TCTTAGTTTGAAAAAGGAGATGG + Intronic
1112760478 13:102689098-102689120 TATTATTTTTAAAAGGGAGATGG + Intronic
1113016933 13:105838280-105838302 TTTCATTTTAAAAAGCGGGAGGG + Intergenic
1113153466 13:107290292-107290314 TCCTATTTTGGAAGGGAGGAGGG - Intronic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1114830363 14:26133977-26133999 TCTTATTTTGAACAGGCGTAGGG - Intergenic
1114856063 14:26445717-26445739 ACTTAGTTTGAAAAAGGGAAAGG - Intronic
1115369855 14:32600995-32601017 TCTTTTTTTGAAAAGTGGCAGGG + Intronic
1115939607 14:38593448-38593470 TCTCATTTTGAAAAAGAGGAAGG - Intergenic
1116757251 14:48963304-48963326 TCCTACTTTGATAAGGGGTAGGG - Intergenic
1117333100 14:54733896-54733918 TCTTAGTTTAAAAAGGGGAGGGG + Intronic
1117395657 14:55306925-55306947 TTTTATTGTGTAAAGGAGGAAGG + Intronic
1117838318 14:59830625-59830647 TCTTAATTTGAAAAGGCCTAAGG - Intronic
1118019971 14:61701630-61701652 TTTTATAATGGAAAGGGGGAGGG - Intronic
1118553686 14:66987856-66987878 TCTTATTTTTAAAAGGAAAAAGG + Intronic
1119587609 14:75851400-75851422 TTTCATTTTGAAAAGGTGAAAGG + Intronic
1120089001 14:80309507-80309529 TTTTATACTGACAAGGGGGAAGG + Intronic
1120347113 14:83304915-83304937 GCTTATTTTAAAAAGGGAAAAGG + Intergenic
1120800830 14:88686509-88686531 TTTTTTTTTGAAGAGGAGGAAGG - Intronic
1121865915 14:97362630-97362652 TTTTATTTTGAACAGGCAGATGG + Intergenic
1122326786 14:100885474-100885496 TTCTATTTTGAACATGGGGAAGG - Intergenic
1123009376 14:105340339-105340361 TCTCATTGTGAAAAAGAGGAAGG + Intronic
1124075971 15:26444515-26444537 TCTCTCTTTGAAGAGGGGGAAGG + Intergenic
1125301142 15:38253709-38253731 TCATAAGTTTAAAAGGGGGAGGG - Intronic
1126482192 15:49137303-49137325 TTTTCTTTTGAAAAGTGGGTGGG - Intronic
1126830312 15:52596106-52596128 TTTTATTTTTAATAGGGGTAGGG - Intronic
1127664202 15:61128959-61128981 TATTATTTTGTAAAGGGTTAAGG - Intronic
1128034818 15:64515552-64515574 TCTTCTTTTTAAAGGGGGGAGGG + Intronic
1128226352 15:66003985-66004007 TCTCATATGGAAAAGGGGGTAGG + Intronic
1128875805 15:71200269-71200291 CCTTATGTTGACTAGGGGGAGGG + Intronic
1128971877 15:72115394-72115416 TTTTATTTTGTCAAGGAGGAAGG - Intronic
1129898759 15:79129516-79129538 CCTTATCTTGAAAAGCTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130765994 15:86871719-86871741 TGTTATTTTGAAGAGCGTGAAGG - Intronic
1131505311 15:93012875-93012897 TCTCCTTTGGAATAGGGGGATGG + Intronic
1131691784 15:94835216-94835238 TCTTATTTTAAAATTGAGGACGG + Intergenic
1132016422 15:98321219-98321241 TCTCTTTTTGAAATGGTGGAAGG - Intergenic
1133017532 16:2951221-2951243 TCTAAGTTTGAAAATGGGGGTGG + Intergenic
1133502407 16:6378567-6378589 TCTTATTTAGAAATGGGGGTGGG - Intronic
1133516540 16:6514745-6514767 TCTTATTGTAATAAGGAGGAAGG + Intronic
1134209654 16:12265516-12265538 TCTGATTTTAAAAAGAGGGCAGG + Intronic
1134330671 16:13248359-13248381 TATTTTTTGGAGAAGGGGGAAGG - Intergenic
1134788433 16:16965808-16965830 TCCTCATCTGAAAAGGGGGAAGG - Intergenic
1135095347 16:19560024-19560046 ATTTTTTTTAAAAAGGGGGATGG - Intronic
1135107628 16:19664267-19664289 TCTTACTATGAATACGGGGACGG + Intronic
1135189038 16:20339765-20339787 GCTTATATTCTAAAGGGGGAGGG - Intronic
1135223901 16:20638907-20638929 TCATATTTGGACAAGGAGGAGGG - Intronic
1135250399 16:20896545-20896567 TCTAATTTTTGAAAGGGGGCGGG - Intronic
1135517942 16:23150759-23150781 TCATGTTTTAAAAAGGAGGAAGG - Intergenic
1135822469 16:25696229-25696251 CCTTTTTTTGGAAAGGGAGAGGG - Intronic
1137012479 16:35336609-35336631 TTTTATTTTGAAATTGGGAATGG - Intergenic
1137019233 16:35407101-35407123 TTTTATTTTGAGATTGGGGATGG - Intergenic
1137026318 16:35479162-35479184 TTTTATTTTGAAATTGGGGATGG - Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1138929972 16:61641499-61641521 TCTTATTTTGACAAAAGGAAAGG + Intergenic
1139830741 16:69795936-69795958 TCTTATTTTGAAGCAGGGCATGG - Intronic
1140185271 16:72763988-72764010 GCATATTTTGGAAAGGGGAAAGG - Intergenic
1141434492 16:83991950-83991972 TCTAATTTTCAAAAGTGGGCTGG - Intronic
1141521762 16:84584965-84584987 TTTTACTTTGCCAAGGGGGAAGG - Intronic
1143589485 17:7873325-7873347 TCTTTTTTTCAAAAAGGGGGTGG + Intronic
1143689225 17:8546821-8546843 TATTAATTTGAAAAGATGGAAGG - Intronic
1143790419 17:9290788-9290810 TCCTGTTTGGAAAAGGGGAAAGG + Intronic
1144527849 17:16005820-16005842 TATTACTTTGAACAGGGGTAAGG + Intronic
1145276399 17:21433923-21433945 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145314234 17:21719816-21719838 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145712687 17:26991795-26991817 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1146129473 17:30258977-30258999 TTTTTTTCTGAAAAGGGAGAGGG - Intronic
1146147521 17:30433940-30433962 TCTTATTTTATAAATGAGGAAGG + Intronic
1146195978 17:30813351-30813373 TCTCATTCTGGTAAGGGGGATGG + Intronic
1146251105 17:31345171-31345193 ACCTATTTTTAAATGGGGGAAGG + Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1147351354 17:39848190-39848212 TATTTTTTTTTAAAGGGGGAGGG - Intronic
1147770644 17:42865840-42865862 TTTTATTTGGAACAGGAGGACGG - Intergenic
1149267335 17:54941292-54941314 TTCTATATTTAAAAGGGGGAGGG + Intronic
1151206578 17:72512600-72512622 TCTTTTTTTGGTCAGGGGGACGG - Intergenic
1151365682 17:73614682-73614704 ACAAAGTTTGAAAAGGGGGAGGG + Intronic
1153098415 18:1436255-1436277 TTTGATTTTAAAAAGGGGGGCGG + Intergenic
1153253594 18:3148542-3148564 CATTATTTTGAAAATGGTGATGG + Intronic
1154199887 18:12292165-12292187 TGCGATTTTGTAAAGGGGGAAGG - Intergenic
1155523888 18:26697205-26697227 TGCAATTTTAAAAAGGGGGAGGG - Intergenic
1155618408 18:27747518-27747540 TCTTATGTCGAAGACGGGGAAGG + Intergenic
1156659750 18:39333117-39333139 ACATATAGTGAAAAGGGGGAGGG + Intergenic
1156802206 18:41129757-41129779 TCTTAATTTGAGGAGGAGGATGG + Intergenic
1157382711 18:47234554-47234576 TCCTCTTTTGAAAAAGGGGTTGG + Intronic
1157848104 18:51022654-51022676 TCTTATTTTAAAAAAAAGGACGG - Intronic
1162030306 19:7914400-7914422 TTTTGTTTTAAAAAGGGGCAGGG - Exonic
1163321961 19:16580024-16580046 CCTTATTTTGTAATGGCGGACGG - Intronic
1164772941 19:30826134-30826156 TCTGAGTTTGAAAAGGGGGCTGG - Intergenic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1166480830 19:43171970-43171992 TTTTTTTTTGAAGAGAGGGACGG - Intronic
1166727821 19:45039343-45039365 TTTTTTTTTGACAAGGGGGCGGG - Intronic
1168123326 19:54267350-54267372 TCTTTTTTTGGAGTGGGGGAGGG + Intronic
1168541355 19:57213165-57213187 AATTATTTTTAAAAGGAGGAGGG + Exonic
926390692 2:12389185-12389207 AAATATTTTGAAAAGAGGGATGG - Intergenic
927274865 2:21254199-21254221 TCTTTCTTTGAGAAGGTGGAGGG + Intergenic
927579164 2:24225824-24225846 TCTTTTTTTGAGAGGAGGGAGGG + Intronic
928187821 2:29130011-29130033 TATTCTGTTCAAAAGGGGGAAGG - Intronic
929377163 2:41301701-41301723 TCTTAATTTGAAGAGGGGAGGGG + Intergenic
929948942 2:46391453-46391475 TCATCGTTTTAAAAGGGGGAAGG + Intergenic
930326989 2:49932515-49932537 TATTAATTTGGAAAGGAGGAAGG - Intronic
930812387 2:55556756-55556778 TCTTGTTTTAAAAAGGGGTAAGG - Intronic
930953785 2:57178254-57178276 GCACATTTTTAAAAGGGGGAAGG - Intergenic
931677153 2:64708766-64708788 TTCTTTTTTGAAAATGGGGAAGG - Intronic
931925107 2:67064016-67064038 TTTTATTATGGAAAGGAGGAAGG - Intergenic
931964807 2:67521711-67521733 TCTTATTTTTCAAAGGAAGAAGG + Intergenic
932645433 2:73495545-73495567 TCTTATTTTTGAAGGGAGGAAGG + Intronic
933505768 2:83175520-83175542 TGTTGTTTTGAATAGGGGGTGGG - Intergenic
935694027 2:105755272-105755294 TCTTTTTTAAAAAAGGAGGAGGG + Intronic
935921602 2:108021750-108021772 TCTTTGTTTGACAAGGAGGATGG - Intergenic
937431883 2:121845756-121845778 TCTAATTTTGAAAATGGGCCCGG + Intergenic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937718239 2:125060082-125060104 TCTGTTTTTGAAGAGGGTGAGGG + Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939243695 2:139595249-139595271 TTTTATTTTGCAAAGTGAGAAGG + Intergenic
939480242 2:142739265-142739287 ACTTATTTTGAAAACAGGGTGGG + Intergenic
940009315 2:149038220-149038242 TCATTATTTAAAAAGGGGGAGGG + Intronic
940663234 2:156573689-156573711 TGTTACTTTGTTAAGGGGGATGG - Intronic
940709880 2:157149047-157149069 TTTTTTTTTGGAAAGGGGAAGGG - Intergenic
940774368 2:157871456-157871478 AGTTGTTTTGAAGAGGGGGATGG - Intronic
942624426 2:177884258-177884280 TCTTATTTTGAAATGTGCTAGGG - Intronic
942888508 2:180958693-180958715 TCCTATTTTTAAAAGGAGGAAGG + Intergenic
943395811 2:187331639-187331661 TCTTATTTTGAAAAGTGTGGTGG - Intergenic
943808488 2:192154063-192154085 GCTGCTTTTGAAAATGGGGAAGG + Intronic
944483018 2:200176468-200176490 TATTATTTTTAAAAGGAGAAAGG + Intergenic
944664875 2:201951570-201951592 TCTTTTTTGGGAAAGGGGTAAGG - Intergenic
945777853 2:214129595-214129617 TTTTATTTTGTATAGGAGGAAGG - Intronic
946137849 2:217662813-217662835 TCTTATTTTGTAGAGGAGGAAGG - Intronic
946898025 2:224344815-224344837 TTTTATTTTGAAATGTGAGAAGG - Intergenic
1169634796 20:7677471-7677493 TTTTATTTACAAAAGGAGGAAGG - Intergenic
1170786292 20:19470374-19470396 TTTTTCTCTGAAAAGGGGGAGGG + Intronic
1171537454 20:25907882-25907904 TATTATTGTGAAAAGTGGGGAGG + Intergenic
1171848113 20:30290148-30290170 TCTTATTTTTATAAGAGGGCCGG - Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173892701 20:46525630-46525652 ATTTATTTTGAAAAGGAGGGGGG + Intergenic
1174009186 20:47435628-47435650 TAATATTTTGAGAAGGGGGTGGG + Intergenic
1174115644 20:48224773-48224795 TCTTATTGAGACAAGGGGTATGG - Intergenic
1174617677 20:51848775-51848797 TCCTATTTTGAAAAATGGGTGGG - Intergenic
1175196227 20:57245027-57245049 TCTTATTTTGAAAGGGAGACAGG - Intronic
1175201831 20:57283376-57283398 TCTGAGATGGAAAAGGGGGAGGG + Intergenic
1179295031 21:40054158-40054180 TCTTTTTTTGGGAAAGGGGAAGG - Intronic
1180058654 21:45373805-45373827 TCTGAGTTTGAAAAGGATGATGG - Intergenic
1180507555 22:16028959-16028981 AATTATTTTGAAAAATGGGAGGG + Intergenic
1180742123 22:18061117-18061139 TCTGATCTGGAAAAGGGGCAGGG + Intergenic
1181655178 22:24291757-24291779 TCTTCATTTTAAAAGGGGGCTGG - Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183410177 22:37650363-37650385 TCTCATTTTTACAACGGGGATGG + Intronic
1185322510 22:50208473-50208495 TCTTATTTTCACAAGGGGCTGGG + Intronic
949353591 3:3152730-3152752 TCTTAGTATGAAAATGGGGTGGG + Intronic
949414464 3:3800126-3800148 TTTTTTTTTGGCAAGGGGGACGG - Intronic
950043687 3:9936056-9936078 TCTGACTTTGAAAAGCTGGAGGG - Intronic
950240052 3:11361183-11361205 TCCTATTTTGCAAAGGTAGAGGG - Intronic
950875002 3:16264124-16264146 TATAATTTTAAAACGGGGGAAGG - Intronic
951060962 3:18206840-18206862 TTTTATTTTCAAAATGGGAAAGG + Intronic
951165501 3:19481016-19481038 TGTTATTTTGAACAGCAGGAAGG - Intronic
951378536 3:21954092-21954114 TCTTATCTTCCAAATGGGGATGG - Intronic
951383429 3:22014206-22014228 CCTTTTTTTTTAAAGGGGGAAGG + Intronic
951761857 3:26156987-26157009 TTTTTTTTTGAGAAGGGGTAGGG + Intergenic
952669178 3:35945690-35945712 TTTGATTTTGAAAAGGAGGGTGG + Intergenic
954165411 3:48753219-48753241 TCTTATTTTAAAAAATGGGAGGG - Intronic
955764777 3:62331109-62331131 TCTTATTTTGATAGGGGTGGGGG - Intronic
957006704 3:74956801-74956823 TATTATTTTTAAAAGGCAGAAGG + Intergenic
957163988 3:76647045-76647067 TCTGACCTTGAAAAAGGGGAGGG + Intronic
958012261 3:87894622-87894644 TTTTATTTTGAAAATGAGGCTGG - Intergenic
958433558 3:94070682-94070704 TCTTTTTGTGAAAAGGGTGAAGG - Intronic
958634763 3:96729702-96729724 AATAATTTTTAAAAGGGGGATGG - Intergenic
958778670 3:98515292-98515314 TCTTATTTCTAATAGGGGGAAGG + Intronic
959308333 3:104697133-104697155 TCTTATTTTTAAGAGGGGTGAGG + Intergenic
960556721 3:119038125-119038147 TGACATTTTGCAAAGGGGGAGGG - Intronic
961028626 3:123583714-123583736 TCTTATTTTAAAAAGGGATAGGG + Intronic
962503333 3:136018476-136018498 TCTTCGTTTTCAAAGGGGGAAGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
962819858 3:139038129-139038151 TTTTATAGTGAAAAAGGGGAAGG + Intronic
963602379 3:147389777-147389799 TCTTATTTTTAAAAAGGTGTAGG - Intronic
964093957 3:152910105-152910127 TCTTATTTTACAAAAGAGGAAGG + Intergenic
964400660 3:156294473-156294495 TCTTAGGGTTAAAAGGGGGAGGG + Intronic
964483657 3:157165269-157165291 TTTTTTTTTTAAAGGGGGGATGG - Intergenic
964563809 3:158027092-158027114 TTTTAATTTAAAATGGGGGAGGG + Intergenic
964779153 3:160315829-160315851 TCTTTTTTTTAGAAAGGGGATGG + Intronic
965881830 3:173396569-173396591 CCTGTTTTTTAAAAGGGGGAGGG + Intronic
967402281 3:189076660-189076682 TATGAATTTAAAAAGGGGGAAGG - Intronic
968534713 4:1116512-1116534 CCTGCTTATGAAAAGGGGGAAGG - Intergenic
968811064 4:2799868-2799890 CCTGGTTTTGAAAAGGGAGAGGG + Intronic
969258563 4:6019635-6019657 TCTTATTTTTAACAGGGAGACGG - Intergenic
969283637 4:6188918-6188940 TCTTATTTTGAAAAAGGGCCTGG - Intronic
969976723 4:11110261-11110283 TTTTATTTTAAAAATGGGGATGG + Intergenic
970454380 4:16207724-16207746 TATTATTGTTGAAAGGGGGAAGG - Intronic
970653151 4:18199907-18199929 ACTTATTCAGAAAAGAGGGAAGG - Intergenic
972011729 4:34191028-34191050 TTTTATTTTGAAATGTGAGAAGG + Intergenic
972722804 4:41717608-41717630 TCTTATTTTTAAAAAGGATATGG - Intergenic
973602401 4:52555044-52555066 TCATAGTTTGGAAAGGGGGGTGG - Intergenic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
974573006 4:63679714-63679736 TCTTATTTTGAAACAGCTGAAGG + Intergenic
975997422 4:80332356-80332378 GCTTATTTTTAAAATGGGAAAGG + Intronic
976803125 4:89015337-89015359 AGTGATTTTCAAAAGGGGGAGGG - Intronic
977921736 4:102652333-102652355 TCAGACTTTGAAAAGGAGGAAGG - Intronic
978932969 4:114338845-114338867 TCATATTTTTAAAAGGTGGCTGG + Intergenic
979608664 4:122667285-122667307 TCTTTTTTTGCATGGGGGGAGGG + Intergenic
979712126 4:123791991-123792013 CCCTATTTTGAAAAGGCAGAGGG + Intergenic
979857299 4:125650488-125650510 TCTTTTTTGAAAAAGGGAGAGGG - Intergenic
979947985 4:126858725-126858747 TCCTATTTTAAAAAAGGTGAGGG + Intergenic
980505395 4:133712527-133712549 ACATAGTTTAAAAAGGGGGAGGG - Intergenic
981009097 4:139906120-139906142 ACTTATTTTGAGATGGGGGGCGG + Intronic
981028368 4:140098868-140098890 ACTTATTTTGAGGTGGGGGAGGG + Intronic
982080370 4:151783753-151783775 TCTCTTTTTGAAGAGGGGAAGGG + Intergenic
982304730 4:153918782-153918804 TGTATTTTTGAAAAGGGGAAAGG - Intergenic
982307245 4:153945322-153945344 TTTTATTTTTTAATGGGGGAAGG + Intergenic
982994164 4:162319202-162319224 TGTTATTTTAAAAATTGGGAGGG + Intergenic
983050868 4:163046044-163046066 TCGTATTTGGAAAAGGTGGAGGG - Intergenic
983091549 4:163509249-163509271 TCATCTTTTGAAATGGGGCAGGG - Intronic
983210007 4:164948577-164948599 TCTTAATGTGAAAAGGAAGATGG + Intergenic
983861643 4:172714407-172714429 TCTTATTTTGTAAATGAGGCAGG - Intronic
986408026 5:7446795-7446817 GCTTATTTTAAAAGGGGAGATGG + Intronic
987690442 5:21259589-21259611 AGTTTTTTTCAAAAGGGGGAAGG - Intergenic
987969440 5:24923154-24923176 TCTTATTTTTTAAAAGTGGAAGG + Intergenic
988477069 5:31596128-31596150 TCTTTCTTTCAAAAGGGGGGAGG - Intergenic
989115832 5:37951565-37951587 TTTTTTTTTGAGATGGGGGAGGG + Intergenic
989530266 5:42499775-42499797 TCTTTTTTTGAGAAGGAGAAAGG + Intronic
989600240 5:43193472-43193494 TCTTATTTTGAAACGGGATGAGG - Exonic
991443346 5:66674725-66674747 TCTCGTTTTCAAAAGGGGTAGGG + Intronic
991485607 5:67133186-67133208 TCTTATTGTGAAAATGGAAAGGG + Intronic
992649031 5:78839073-78839095 TCTTCTTTTGTAAATGGGGAAGG + Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993693017 5:91026040-91026062 TCTCATTTTTAAAATGGGGATGG - Intronic
994792045 5:104240983-104241005 GCATATTTTGAAAAGGAGCATGG + Intergenic
995000328 5:107120006-107120028 TCTCATTTTAAAAATGGGAATGG - Intergenic
996327433 5:122291405-122291427 AATCATTTTGAAAAGTGGGAGGG + Intergenic
997191805 5:131944966-131944988 ATTTATTTTTAAAAAGGGGAAGG - Intronic
998390566 5:141784576-141784598 CCTTATTTTAAAAAGGGGAAAGG - Intergenic
998871076 5:146552348-146552370 TCTTATTCTGAAAAGGGGCATGG + Intergenic
999502682 5:152162615-152162637 TTTTACTTTGAAATGGGGGTGGG - Intergenic
999768781 5:154758991-154759013 TCTTATACTTAAAAGGGGTATGG - Intronic
1000449582 5:161368996-161369018 TCTTATTTTTAAAAAAGAGAAGG + Intronic
1000720737 5:164703414-164703436 TATTATTTTGCAAAGGGGCGGGG + Intergenic
1002927502 6:1613621-1613643 GGTTATTTACAAAAGGGGGAGGG - Exonic
1002954319 6:1847056-1847078 TTTTATTTTAAAAAGGGGGTGGG - Intronic
1003244525 6:4372859-4372881 TCTGATTTGGAATTGGGGGACGG - Intergenic
1003261847 6:4524523-4524545 TCTTTTTTTGCAGGGGGGGATGG + Intergenic
1003343488 6:5243961-5243983 TCTTATTTTTTAAAAGGGAAAGG + Intronic
1003534410 6:6963767-6963789 TCTTATTTTTAAAAAGGGGAGGG - Intergenic
1004037200 6:11934913-11934935 TCTTATATTGAACGTGGGGAAGG - Intergenic
1004787393 6:18984453-18984475 TTTTATTTTAAAATTGGGGAAGG + Intergenic
1004848417 6:19671224-19671246 TCTTCTTTTGAAGAATGGGATGG - Intergenic
1005384941 6:25276887-25276909 CATTATTTTGAAAAGGAAGATGG - Intergenic
1006756285 6:36418481-36418503 GCTTATGTTGAAAAGGGGCTTGG - Intronic
1007186441 6:39976178-39976200 TCTGAGTTTGATAAGGTGGAAGG + Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1008979317 6:57464896-57464918 TCTTATCTGAAAAAGAGGGACGG - Intronic
1009715605 6:67390316-67390338 AATTATTTTGAAAAATGGGAGGG - Intergenic
1010084998 6:71906753-71906775 TCTTATTTGTGAAATGGGGATGG + Intronic
1010307982 6:74347222-74347244 TGTTATATTGCAAAGGGAGAGGG + Intergenic
1010360975 6:74993265-74993287 TCTGATTTTAAAAAGTGGAATGG - Intergenic
1011311410 6:85983692-85983714 TTTTATTTTGCAATGGGAGAGGG - Intergenic
1011761786 6:90575335-90575357 CCCTATCCTGAAAAGGGGGAGGG - Intronic
1011851965 6:91640080-91640102 TCTAATTTTACAAAGGGTGATGG + Intergenic
1011971948 6:93236443-93236465 TCTCATTTAGAAATGTGGGAGGG + Intergenic
1012039281 6:94184417-94184439 TTTTATTTTGAAATGTGAGAAGG - Intergenic
1012645649 6:101677089-101677111 TTTTGTTTTGAAATGAGGGAAGG + Intronic
1013301083 6:108805433-108805455 TCTCCTAATGAAAAGGGGGACGG + Intergenic
1013487648 6:110612704-110612726 TCTTATTTTAAAAAATGGAAGGG + Exonic
1014050298 6:116945000-116945022 TCTTTTTTTGGAGAGGGGGGCGG - Intergenic
1014595946 6:123338879-123338901 TCTAATTTTAAAATTGGGGAAGG + Intronic
1014939311 6:127419553-127419575 CCTTGTTTTGAAAATAGGGAAGG - Intergenic
1015993411 6:138972213-138972235 CCATGTTTTGAAAAGGGGGGCGG + Intronic
1016266730 6:142241235-142241257 ACTTTTTTTGAAAATAGGGAAGG + Intergenic
1016375990 6:143421217-143421239 TCTTGTTTTGGAGAAGGGGAAGG - Intergenic
1016475246 6:144420082-144420104 TCTGAGTTTGAAATGGAGGAGGG - Intronic
1016558324 6:145366075-145366097 TCATATCTGGAAAAGGGGGTGGG + Intergenic
1016635709 6:146287759-146287781 TCTGGTTTTGAAAAGGGAAAAGG + Intronic
1017354101 6:153481920-153481942 ATTTATTATGTAAAGGGGGAAGG - Intergenic
1017880188 6:158557444-158557466 TCATGTTATGAAAAGGGGAAAGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018071869 6:160171800-160171822 TCATATTTATAAAATGGGGAGGG + Intronic
1018712489 6:166506761-166506783 TCTCCTGCTGAAAAGGGGGAAGG + Intronic
1019294773 7:267907-267929 TCTTATTTATAAAACGGGGTTGG - Intergenic
1019914252 7:4122300-4122322 TCCTTTTTTGAAATGGGGGGAGG + Intronic
1020483578 7:8692753-8692775 TGCTATTTAGAAAAGGGTGATGG + Intronic
1020523842 7:9231792-9231814 GCTTATTTTGTAGAGAGGGATGG + Intergenic
1023238140 7:38112968-38112990 TCTTCTTTTGAAAACTGGGTGGG + Intergenic
1023651972 7:42380703-42380725 TCTTATTCTGATAAAGGTGAAGG + Intergenic
1024088898 7:45919919-45919941 TCTTAATCTGAAATGGGGGGGGG - Intronic
1024452378 7:49562953-49562975 TATTATTTTAAAAAGTAGGAAGG - Intergenic
1024877699 7:54045159-54045181 TTTTATTTTGAAAAGGATGGAGG - Intergenic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1027603858 7:80275025-80275047 TCTAATTTTTAAAAGGGGGGAGG - Intergenic
1027751157 7:82148807-82148829 TTTTATTTTTAAAAGAGGCAGGG + Intronic
1028140843 7:87273596-87273618 TTGTATTTTGAAATGTGGGAAGG - Intergenic
1029669460 7:102019195-102019217 TCTGATGTTGAAAAGTGGGGTGG - Intronic
1030551714 7:110969586-110969608 TCTTATTTTCTAGAAGGGGAAGG + Intronic
1031388022 7:121176800-121176822 TCCTATTTTGAAAAGGACCAAGG + Intronic
1031547634 7:123069135-123069157 TTTAATTTTGAAAAGCTGGAGGG - Intergenic
1031575956 7:123416214-123416236 TGATATTGTGAAAAGGGAGATGG - Intergenic
1031720006 7:125162683-125162705 AATTATTTTAAAAAGGGGGGAGG + Intergenic
1032380530 7:131475072-131475094 TCTCATGTTGAATTGGGGGAGGG - Intronic
1033422902 7:141218688-141218710 TCTAATTCTGGAAAGGGAGAGGG - Intronic
1035306001 7:157931926-157931948 ACATATTTTTAAAGGGGGGAGGG - Intronic
1035327974 7:158077029-158077051 GCTTATTTTGAAAAGCGTAATGG - Intronic
1036285280 8:7439199-7439221 TCTTTTTCTGTAAAGAGGGAGGG - Intergenic
1036336196 8:7872330-7872352 TCTTTTTCTGTAAAGAGGGAGGG + Intergenic
1036521035 8:9491864-9491886 TTTGATTTTGAAAAAGAGGATGG - Intergenic
1036593811 8:10194255-10194277 TCTTCTTTTTAAGGGGGGGAAGG - Intronic
1038867591 8:31456474-31456496 TTTTTTTTTGAAAAGGGGTCTGG - Intergenic
1039680699 8:39732071-39732093 TATTATTTTGAAATGGGCAAAGG + Intergenic
1039794492 8:40900858-40900880 TCTTATTTTCTTAAGGGGGGTGG - Intergenic
1040095757 8:43440722-43440744 TCTTCCTTTGGAAAGGGGAAGGG + Intergenic
1041264970 8:56055600-56055622 TCTCATTATGAAGAGAGGGAGGG - Intergenic
1041469624 8:58194099-58194121 AATTTTTTTTAAAAGGGGGATGG - Intronic
1043148503 8:76683346-76683368 GCTTTTTTTGGAAGGGGGGAGGG - Intronic
1043267154 8:78280410-78280432 TTTTATTTTACAAAGGTGGAGGG - Intergenic
1044647189 8:94456490-94456512 ACTTATTTTCAAAAGGTTGAGGG + Intronic
1044975609 8:97662338-97662360 TTTTTTTTTAAAAAGGGGGAGGG - Intronic
1045176724 8:99732987-99733009 TCTCACATTTAAAAGGGGGAGGG + Intronic
1045970739 8:108077192-108077214 TCTTTTTATTAAAAGGGTGAAGG + Intronic
1046022038 8:108676675-108676697 TTCTAGTTTGAGAAGGGGGAAGG - Intronic
1046066827 8:109207317-109207339 TCTATTTTAGAAAAGGGGGAGGG + Intergenic
1046437897 8:114217509-114217531 TCTTATTTTTAAAAAGGAAACGG + Intergenic
1046597749 8:116281315-116281337 TTTTATTTATAAGAGGGGGAAGG - Intergenic
1046933281 8:119862484-119862506 TATTATTTTGAAATAGGGGCTGG - Intergenic
1047267943 8:123325724-123325746 TCTTAATTTGGAACAGGGGAAGG + Intronic
1047745537 8:127842095-127842117 TCTTATTTTTAAAAGTTGTATGG + Intergenic
1048926107 8:139272977-139272999 TCTTATTTTGGAGTTGGGGAAGG + Intergenic
1049032269 8:140046725-140046747 TCTAATTTAGAAAAGGGGTATGG - Intronic
1049912298 9:280955-280977 TCTTATTTTTCAAAAGGGGTTGG + Intronic
1050182570 9:2936071-2936093 TCTTATTTGGAGTAGGGGGATGG - Intergenic
1051172071 9:14328939-14328961 GCTTTTTTTGAAAAAGTGGAAGG + Intronic
1051902900 9:22061765-22061787 TCTTCTTTACAAAAGGGGGGAGG + Intergenic
1052354990 9:27494840-27494862 TCTTATGTGGAATAGGGGGAGGG - Intronic
1052440328 9:28488580-28488602 TCTTATTTTGCAAATGAGAAAGG - Intronic
1054449820 9:65397788-65397810 TCTTATTTTTATAAGAGGGCCGG - Intergenic
1054963646 9:70997520-70997542 TCATATTTTGAAAAGGTGAAAGG - Intronic
1055037607 9:71835165-71835187 TCTGATTTTAAAAAGGGCAAAGG + Intergenic
1055280862 9:74672900-74672922 CTTTGTTTTAAAAAGGGGGATGG + Intronic
1055443906 9:76363871-76363893 ACTTAATTTGAAAAAGAGGATGG + Intergenic
1055513580 9:77017080-77017102 TCTTACTTTGAAAAGGGCTTAGG + Intergenic
1055764892 9:79652125-79652147 ATATATTTTTAAAAGGGGGAAGG - Intronic
1057214496 9:93220471-93220493 TCCTGTTTTGTGAAGGGGGATGG + Intronic
1057329706 9:94102261-94102283 TCGTATTTTTAAAAAGGGGTAGG + Intronic
1057418939 9:94892718-94892740 TATTATTTTTTAAAGAGGGAGGG + Intronic
1058521808 9:105819606-105819628 TCTTAATATGCAAAGGCGGAGGG - Intergenic
1058954993 9:109937871-109937893 TCTTATTTAAAAAATGAGGAGGG - Intronic
1059127127 9:111700366-111700388 TGTTACTTTGACCAGGGGGATGG - Intronic
1061279807 9:129591044-129591066 CCTAATTTTGAGAAGGGCGAGGG + Intergenic
1061421212 9:130473682-130473704 GCTTCTTTTGGAGAGGGGGAGGG - Intronic
1185836861 X:3352609-3352631 TTTTATTTTGAAAAGTGAGATGG - Intergenic
1185836979 X:3353736-3353758 TTTTATTTTGAAAAGTGAGATGG - Intergenic
1185976896 X:4731367-4731389 TCTCTTTTTGAAGAGGGGAAGGG - Intergenic
1186299385 X:8183034-8183056 TCTTTTTTTGTCAGGGGGGAGGG - Intergenic
1186481494 X:9899349-9899371 TCTTGTTTCAAAAAGGCGGATGG + Intronic
1186972005 X:14856771-14856793 CATAATTTTTAAAAGGGGGAAGG + Intronic
1187047355 X:15660319-15660341 TCTTTTTTTGGAAGGGAGGAGGG + Intronic
1187596949 X:20783763-20783785 TCTTATTTTGAAAAGGTCACAGG + Intergenic
1187659914 X:21532797-21532819 TATTAATTTGAAAAGTGGAAAGG - Intronic
1188058920 X:25576632-25576654 CCTTATTTGGCAAAGGGGGAAGG + Intergenic
1189059921 X:37742423-37742445 TCTGATTTTAAAAAGGGCAAAGG + Intronic
1189722905 X:43938904-43938926 TCTTGCTCTGAAAAGAGGGATGG - Intergenic
1189941484 X:46127351-46127373 TCATATTTTGTAAAGCTGGATGG - Intergenic
1191118554 X:56877426-56877448 TCTGATTTTGAAATGGGCAAAGG - Intergenic
1191214229 X:57919218-57919240 TTTTTTTTTGAGAAGGGAGAAGG - Intergenic
1191911132 X:66151446-66151468 TTTTACTTTTAAAAGGGGGGTGG - Intergenic
1192393461 X:70754354-70754376 TCTGCCTTTGGAAAGGGGGAGGG + Intronic
1192507868 X:71700776-71700798 TCTTAATTTAAAAAGGGCGGGGG + Intergenic
1192518828 X:71780776-71780798 TCTTAATTTAAAAAGGGCGGGGG - Intergenic
1194458014 X:94128521-94128543 ACTGATTTTGGAGAGGGGGAAGG + Intergenic
1195131456 X:101858088-101858110 TTTGATTTTGTAAAGAGGGAGGG - Intergenic
1195653740 X:107314185-107314207 TCTTTTTTTGAAAAGGGGTATGG + Intergenic
1196167541 X:112551994-112552016 TCTTCTTCTGGAAAGGGAGAGGG - Intergenic
1197306265 X:124845713-124845735 CCTTATCTTAAAAAGTGGGAGGG - Intronic
1198089734 X:133315989-133316011 TCTTTTTATTTAAAGGGGGAAGG - Intronic
1198868658 X:141152977-141152999 TTGAATTTTGAAAAGGGAGAAGG + Intergenic
1198894148 X:141432321-141432343 TTTTATTTTAAAAAGTGGTAAGG - Intergenic
1199840380 X:151640787-151640809 TCTACGTTTGAAAAGGGGCAGGG + Intronic
1201239586 Y:11946000-11946022 TTTTATTTTGAAAAGTGAGGTGG + Intergenic
1201239711 Y:11947126-11947148 TTTTATTTTCAAAAGTGAGATGG + Intergenic