ID: 904106745

View in Genome Browser
Species Human (GRCh38)
Location 1:28090962-28090984
Sequence TGGGCCTACCTGTAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904106745_904106751 9 Left 904106745 1:28090962-28090984 CCTCAAAACTACAGGTAGGCCCA 0: 1
1: 0
2: 0
3: 19
4: 164
Right 904106751 1:28090994-28091016 TGCTTTTTAATCCATCTGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904106745 Original CRISPR TGGGCCTACCTGTAGTTTTG AGG (reversed) Intergenic
900897465 1:5493695-5493717 TGAGCCTCCCTGGAGTTGTGTGG - Intergenic
902262717 1:15238796-15238818 TGGGCCTATGTGTATTTTTCTGG - Intergenic
903694608 1:25197597-25197619 TGGGCCCAGCCATAGTTTTGGGG - Intergenic
904106745 1:28090962-28090984 TGGGCCTACCTGTAGTTTTGAGG - Intergenic
904191093 1:28744383-28744405 TTGGCCTAGCTGGGGTTTTGTGG + Intronic
904650225 1:31999986-32000008 AGGACCTACCTGTAGTTCAGAGG - Intergenic
905466441 1:38157658-38157680 TAGGCCTATTTGGAGTTTTGAGG + Intergenic
905684038 1:39896221-39896243 TGGGCGTTTCTGAAGTTTTGGGG - Exonic
907614698 1:55912496-55912518 TGGGCATCCCTGTACTCTTGCGG + Intergenic
909576872 1:77185567-77185589 TGGGCCTAACTGGATTTTGGAGG + Intronic
910199065 1:84679484-84679506 TGTGCCTTCCTGATGTTTTGTGG + Intronic
911246687 1:95525709-95525731 TGGGGCTGCCTGGAGCTTTGGGG + Intergenic
912787557 1:112619279-112619301 TGGGGCTACCTGTTCTTTCGTGG + Exonic
913282632 1:117200599-117200621 TGGGAATACCTGAAGATTTGGGG - Intronic
913968321 1:143394906-143394928 GAGGCCTACATGTAGTGTTGAGG - Intergenic
914062699 1:144220502-144220524 GAGGCCTACATGTAGTGTTGAGG - Intergenic
914116451 1:144745852-144745874 GAGGCCTACATGTAGTGTTGAGG + Intergenic
914330568 1:146666529-146666551 TGTGCCTAGATGTGGTTTTGTGG - Intergenic
916180885 1:162082719-162082741 TTGGCCCACCTCTATTTTTGAGG + Intronic
918922114 1:190726383-190726405 TATGCCTAGATGTAGTTTTGGGG + Intergenic
919262586 1:195216883-195216905 TGTGCCTAAGTGTATTTTTGTGG - Intergenic
1067333095 10:45339926-45339948 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1067896885 10:50191883-50191905 TGGTCCTACCTGTACTGTTGTGG - Intronic
1067952086 10:50750150-50750172 TGGTCCTACCTGTACTGTTGTGG + Intronic
1069192355 10:65506661-65506683 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1071364512 10:84884816-84884838 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1071399728 10:85257393-85257415 TGGTCGTACTTGTTGTTTTGGGG - Intergenic
1071727179 10:88210920-88210942 TTGGCCTATGTGTGGTTTTGAGG + Intergenic
1073557304 10:104465609-104465631 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1074248070 10:111714254-111714276 TGGGCCTCCCTGTGCTCTTGGGG - Intergenic
1077818269 11:5709462-5709484 TGTGCCTCCCTGTCGTATTGGGG + Exonic
1078027938 11:7716439-7716461 TGCAACTACCTATAGTTTTGAGG - Intergenic
1078695918 11:13631415-13631437 TGGACCTTCCTCTAGTTATGTGG - Intergenic
1081065505 11:38535190-38535212 TGGGCCTATTTGGATTTTTGAGG - Intergenic
1083236804 11:61356377-61356399 TGGGCCTAGCTGTCATTTGGGGG - Intronic
1084223299 11:67698162-67698184 TGGGGCTACTTGGATTTTTGAGG + Intergenic
1090669024 11:128933288-128933310 TGTGCCTACCTGTCTGTTTGGGG - Intergenic
1091051691 11:132378439-132378461 TGGGCCTATTTGGATTTTTGAGG + Intergenic
1091356927 11:134944405-134944427 TCGGCCTGACTGTAGTTTAGGGG + Intergenic
1092191704 12:6526135-6526157 TGGGCCAGCCTGTAGTCCTGTGG - Exonic
1094000255 12:25686904-25686926 TGTGTCTACCTGAAGGTTTGTGG + Intergenic
1094830718 12:34298914-34298936 TGGGCCTTCTTGCAGCTTTGGGG - Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1097655254 12:62352720-62352742 TGGGCATAATTATAGTTTTGAGG + Intronic
1099759145 12:86895265-86895287 TGTACCTAGGTGTAGTTTTGTGG - Intergenic
1103680513 12:122690153-122690175 TGGGGCCTCCTGTGGTTTTGTGG + Intergenic
1104164647 12:126216104-126216126 TGGGCCTAGCTGTTGGTTTGTGG + Intergenic
1104686240 12:130786959-130786981 TGGGCGTAACGGTAGTTTTGGGG + Intergenic
1105389423 13:19960098-19960120 TGGCCCTCCCCGTTGTTTTGAGG + Intronic
1107407555 13:40128898-40128920 TGGGCCTGCCTGGAGGTTAGAGG + Intergenic
1107983617 13:45756282-45756304 TGGGCCTAACTGGATTTTGGAGG - Intergenic
1108302483 13:49092300-49092322 TGGGCCTAACTGGATTTTGGAGG - Intronic
1108862126 13:54873993-54874015 GGGACCTACCTGTTGTTTTTAGG - Intergenic
1110066845 13:71118556-71118578 TGTGCCTAACTGTGGTGTTGAGG - Intergenic
1112923220 13:104641151-104641173 TAGATCTGCCTGTAGTTTTGAGG + Intergenic
1115311730 14:31985032-31985054 TGGGGCTCCCTGTGGTCTTGAGG + Intergenic
1115443624 14:33464213-33464235 GGGGCCAACATGTAGATTTGTGG - Intronic
1116356080 14:43932855-43932877 TGGTATTACCTGTAGTTTTTTGG - Intergenic
1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG + Intergenic
1122417286 14:101556488-101556510 TGGCCCTACCTGCTGTTCTGCGG - Intergenic
1123148558 14:106158419-106158441 TGGGTCTACCTATATTTTTAGGG - Intergenic
1124359594 15:29026005-29026027 TCGGCCTTCCTGCAGTCTTGTGG + Intronic
1124466584 15:29945518-29945540 TGGGCCTCCATGTGGCTTTGGGG - Intronic
1124703971 15:31945522-31945544 TTGGGTTGCCTGTAGTTTTGAGG - Intergenic
1129321999 15:74780645-74780667 AGGGCCGACCTGTGGTTTTGGGG + Intergenic
1135625958 16:23995184-23995206 TGGGCCTACTTGGATTTTGGAGG + Intronic
1136681657 16:31969220-31969242 TGGGTCTACCTGTATTTTTAGGG + Intergenic
1136781964 16:32910722-32910744 TGGGTCTACCTGTATTTTTAGGG + Intergenic
1136887828 16:33943130-33943152 TGGGTCTACCTGTATTTTTAGGG - Intergenic
1140002986 16:71044377-71044399 TGTGCCTAGATGTGGTTTTGTGG + Intronic
1142294170 16:89209483-89209505 TGGGCCAAGCTGCAATTTTGGGG + Intergenic
1142425298 16:89999366-89999388 TGGGCCAACCTGTGGTCATGTGG + Intergenic
1203084621 16_KI270728v1_random:1174708-1174730 TGGGTCTACCTGTATTTTTAGGG + Intergenic
1146237935 17:31185634-31185656 TGGGCCTACTTGGATTTTGGAGG + Intronic
1151919520 17:77142737-77142759 TGAGCCTACCTGTCTTGTTGAGG - Exonic
1152210280 17:78999404-78999426 TGGGCCTGGCTGGGGTTTTGAGG - Intronic
1155435482 18:25808163-25808185 TTTGCCTATCTGTAGTTTTTTGG - Intergenic
1156998540 18:43497409-43497431 TGGGCCTATTTGGATTTTTGAGG + Intergenic
1158774028 18:60555312-60555334 TGGGCATACCTGCACTCTTGGGG + Intergenic
1159277104 18:66235207-66235229 TGGGCCTACTTGGATTTTGGAGG + Intergenic
1160821630 19:1061767-1061789 TGGGCATCCCTGTAGTGTTTTGG + Exonic
1161340400 19:3738805-3738827 TGGGCCTGGCTGGAGATTTGGGG - Intronic
1162473715 19:10887523-10887545 AGGGCCTTCCTGCAGCTTTGTGG + Intronic
1166447865 19:42874084-42874106 TGGGAATACCGGTGGTTTTGGGG - Intronic
1168585926 19:57591823-57591845 TGAATCTACCTGTAGTCTTGGGG + Exonic
1202702108 1_KI270712v1_random:172374-172396 GAGGCCTACATGTAGTGTTGAGG - Intergenic
926514750 2:13828757-13828779 TGGGCCTACCTGTCATTTTATGG + Intergenic
926703222 2:15818121-15818143 TGGGCCTCTCTGGAGTCTTGGGG - Intergenic
927533989 2:23837440-23837462 TGGGCCTCCCTGTGCTCTTGCGG - Intronic
930536650 2:52652580-52652602 TGGGCCTATCTGGATTTTGGAGG - Intergenic
932325075 2:70853874-70853896 TCTGCTTTCCTGTAGTTTTGTGG + Intergenic
933801286 2:85961968-85961990 TGGGCATCCCTGTACTCTTGGGG - Intergenic
934173022 2:89555820-89555842 GAGGCCTACATGTAGTGTTGAGG - Intergenic
934283336 2:91630177-91630199 GAGGCCTACATGTAGTGTTGAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934612725 2:95752983-95753005 TGGGCTTACATGGACTTTTGGGG - Intergenic
935215296 2:100971061-100971083 TGGGCGTACCTTTAGTGCTGAGG - Exonic
937242698 2:120472682-120472704 TGGGTCTAGCTCTAGTTCTGTGG + Intergenic
943261198 2:185665762-185665784 TGGGCTTAGCTGTCATTTTGGGG + Intergenic
943598482 2:189886164-189886186 TGGGGATACCAGTATTTTTGAGG + Intronic
947739933 2:232480390-232480412 TGGGCATACCTGTAGTGCTCAGG + Exonic
1171330107 20:24329965-24329987 TGGGCCTCTTTGTAGTTTGGAGG - Intergenic
1172481429 20:35274146-35274168 TGGGCACACCTGGAGGTTTGGGG - Intronic
1172941370 20:38656847-38656869 TGGGGCTACCTGCAGTTGTTGGG - Intergenic
1177477105 21:21637637-21637659 TAGTCCTATTTGTAGTTTTGTGG + Intergenic
1177940943 21:27410800-27410822 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1178350210 21:31867434-31867456 TGGGCCCATCTGTAGTTGGGAGG + Intergenic
1180783812 22:18535996-18536018 TGGCCCTGCCTGTAGTCCTGTGG + Intergenic
1181127381 22:20710045-20710067 TGGCCCTGCCTGTAGTCCTGTGG + Intronic
1181240712 22:21475348-21475370 TGGCCCTGCCTGTAGTCCTGTGG + Intergenic
1182670197 22:31989336-31989358 TGGTCCTACTTGTAGTGGTGAGG - Intergenic
1183455827 22:37922551-37922573 GGGGCCTGCCTGTGTTTTTGAGG + Intronic
1185044581 22:48522702-48522724 TGGGCCTGCCTGGGGTTTTGTGG + Intronic
1185412934 22:50695425-50695447 GGGGCTTACCTGTAGGTTTTGGG - Intergenic
949638736 3:6012198-6012220 TGGGCCTACTTGGATTTTGGAGG + Intergenic
949832457 3:8230137-8230159 TGTGCCAGCCTGGAGTTTTGGGG + Intergenic
951859937 3:27241036-27241058 TCTGCCTCCCTGTAGTTCTGGGG - Intronic
951969189 3:28424003-28424025 TTGCCCTACCTGTATTTATGGGG + Intronic
952555547 3:34525960-34525982 TGTGGCTATCAGTAGTTTTGAGG + Intergenic
959753424 3:109866159-109866181 TGTGCCTAGGTGTAGTTTTTTGG - Intergenic
964263970 3:154873529-154873551 TAGGCCTAGCTGTTGTTTTTTGG - Intergenic
966445644 3:179998240-179998262 TGGGCCTATCTGGATTTTGGAGG + Intronic
966928048 3:184658394-184658416 TGGGCCTCCCTGGATGTTTGTGG + Intronic
969521909 4:7683153-7683175 TGAGCCCACCTGTAGATCTGGGG - Intronic
974072089 4:57133081-57133103 TGTGCATACCTGTTCTTTTGCGG + Intergenic
975030836 4:69613848-69613870 TGATGCTACCTGTAGGTTTGCGG - Intronic
975745661 4:77472105-77472127 TGGGCCTACCTCTAGGTGTTTGG + Intergenic
976207443 4:82636518-82636540 TTGGCCTCTCAGTAGTTTTGTGG - Intronic
977558263 4:98506383-98506405 TGAGGCTACCTGGAGTTTTGAGG - Intronic
978256282 4:106696532-106696554 TTGGCCTATCTTTTGTTTTGTGG - Intergenic
978772202 4:112468099-112468121 TGGGCCTATTTGGATTTTTGAGG - Intergenic
978899119 4:113927136-113927158 TGGGCCTATTTGGATTTTTGAGG - Intronic
982545078 4:156724123-156724145 TGGGCCTCCCTGTGCTCTTGGGG + Intergenic
982836855 4:160129909-160129931 TGAGCCTACGTGTGGTCTTGGGG + Intergenic
983124669 4:163936037-163936059 TTGGCCTAATTTTAGTTTTGTGG + Intronic
983185018 4:164691256-164691278 TGGGCCTACTTTTATTTTGGAGG + Intergenic
988161977 5:27530281-27530303 TGTGCTTACCTGTGTTTTTGTGG + Intergenic
989307537 5:39974875-39974897 TGGGCCTACTTGGATTTTGGAGG - Intergenic
994443202 5:99836612-99836634 TGGCCCTACCTCTATTATTGGGG - Intergenic
994977011 5:106820719-106820741 TGGGCCTACCTGGAAATTTCAGG + Intergenic
1003438891 6:6121685-6121707 TGGGCTTCCCTGTGGTCTTGGGG + Intergenic
1006973956 6:38079077-38079099 TGGAACTACCTGTAATTGTGTGG + Intronic
1009770373 6:68137161-68137183 TGGGCCTATTTGTATTTTGGAGG - Intergenic
1010938288 6:81886730-81886752 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1014115832 6:117667608-117667630 TATGCCTAGGTGTAGTTTTGGGG - Intergenic
1015466895 6:133558035-133558057 TGGGCCTATTTGGATTTTTGAGG - Intergenic
1016076858 6:139805561-139805583 TGGGCATTCCTGTACTCTTGAGG - Intergenic
1016190599 6:141260770-141260792 TGAGCCTCCCTGTGGTCTTGGGG + Intergenic
1018107386 6:160502115-160502137 TGGGCCTACTTGGATTTTGGAGG - Intergenic
1021399287 7:20191293-20191315 TGGGCCTACTTGCACTTCTGAGG + Intronic
1022652104 7:32287015-32287037 TGGGCCTTCCTGTAGCCTTCTGG - Intronic
1022715436 7:32893809-32893831 ACTGCCTACCTGTAGATTTGAGG - Intronic
1024024463 7:45399315-45399337 TGGGCATCCCTGTACTCTTGGGG + Intergenic
1026180497 7:68035230-68035252 TGGTTGTAGCTGTAGTTTTGAGG + Intergenic
1027513001 7:79107125-79107147 TGGGCCCACCTGGATATTTGAGG - Intronic
1028378987 7:90176909-90176931 TGGGCATACCTGTGTTCTTGGGG - Intronic
1030504505 7:110403122-110403144 TAGGCGTCCCTGGAGTTTTGTGG + Intergenic
1031889233 7:127274712-127274734 TGACCCTTCCTGTAGTTTTGAGG - Intergenic
1033351350 7:140564945-140564967 TGGGCATACCTGTAGTAGTGGGG + Intronic
1034211275 7:149365297-149365319 TGGGCCAACCTGCTGGTTTGAGG - Intergenic
1037428795 8:18787524-18787546 TGGGCCTGCCTGGAATTTTGGGG - Intronic
1039146569 8:34453592-34453614 TAAGCCTAACTGTAGTTTTGGGG + Intergenic
1039567302 8:38560495-38560517 TGGCCCTGGCTCTAGTTTTGGGG - Intergenic
1044202346 8:89452169-89452191 TGGGCCTATCTGAATTTTGGAGG + Intergenic
1050130433 9:2406626-2406648 TGGACCTCCCTGCACTTTTGGGG + Intergenic
1052442744 9:28518764-28518786 TGGGCCTACATTTCCTTTTGAGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053008361 9:34619423-34619445 TGAGCCTACCTAAAGTTTAGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055673595 9:78632240-78632262 TGGGCCCACTTGAACTTTTGCGG - Intergenic
1058259299 9:102809984-102810006 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1186101205 X:6158440-6158462 TGAGGCTATCTGTAGATTTGAGG - Intronic
1187939506 X:24368135-24368157 TGGGCCTACCTGGATTTTCCTGG - Intergenic
1189237090 X:39495399-39495421 TGCCCCTCCCTGTAGCTTTGAGG - Intergenic
1194142108 X:90220117-90220139 TTGGGCTACCTGAAATTTTGTGG + Intergenic
1195650082 X:107274913-107274935 TGGGCCTCTCTGAAGTTTTCTGG + Intergenic
1199082861 X:143595667-143595689 TGGGCCTTTCTGAAGTTTTGGGG - Intergenic
1200270081 X:154674577-154674599 TGGGCCAACCTGCTGTTTTGTGG + Intergenic
1200487863 Y:3789216-3789238 TTGGGCTACCTGAAATTTTGTGG + Intergenic