ID: 904110363

View in Genome Browser
Species Human (GRCh38)
Location 1:28121432-28121454
Sequence AGCAACACGGGCGGACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904110353_904110363 2 Left 904110353 1:28121407-28121429 CCCCAACGGCTCCTTCGGGTCCC No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110352_904110363 3 Left 904110352 1:28121406-28121428 CCCCCAACGGCTCCTTCGGGTCC No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110348_904110363 9 Left 904110348 1:28121400-28121422 CCAGACCCCCCAACGGCTCCTTC No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110344_904110363 16 Left 904110344 1:28121393-28121415 CCTCCGCCCAGACCCCCCAACGG No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110347_904110363 10 Left 904110347 1:28121399-28121421 CCCAGACCCCCCAACGGCTCCTT No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110346_904110363 13 Left 904110346 1:28121396-28121418 CCGCCCAGACCCCCCAACGGCTC No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110356_904110363 -9 Left 904110356 1:28121418-28121440 CCTTCGGGTCCCAGAGCAACACG No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110355_904110363 0 Left 904110355 1:28121409-28121431 CCAACGGCTCCTTCGGGTCCCAG No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110351_904110363 4 Left 904110351 1:28121405-28121427 CCCCCCAACGGCTCCTTCGGGTC No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110343_904110363 29 Left 904110343 1:28121380-28121402 CCACACGAGCAGGCCTCCGCCCA No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data
904110354_904110363 1 Left 904110354 1:28121408-28121430 CCCAACGGCTCCTTCGGGTCCCA No data
Right 904110363 1:28121432-28121454 AGCAACACGGGCGGACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904110363 Original CRISPR AGCAACACGGGCGGACCCCA GGG Intergenic