ID: 904110967

View in Genome Browser
Species Human (GRCh38)
Location 1:28125760-28125782
Sequence GAGGACAGTTCTAGACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904110967_904110974 3 Left 904110967 1:28125760-28125782 CCCTCTTGTCTAGAACTGTCCTC No data
Right 904110974 1:28125786-28125808 GTATGGGCAGAATAGTATAGGGG No data
904110967_904110973 2 Left 904110967 1:28125760-28125782 CCCTCTTGTCTAGAACTGTCCTC No data
Right 904110973 1:28125785-28125807 AGTATGGGCAGAATAGTATAGGG No data
904110967_904110972 1 Left 904110967 1:28125760-28125782 CCCTCTTGTCTAGAACTGTCCTC No data
Right 904110972 1:28125784-28125806 GAGTATGGGCAGAATAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904110967 Original CRISPR GAGGACAGTTCTAGACAAGA GGG (reversed) Intergenic