ID: 904111941

View in Genome Browser
Species Human (GRCh38)
Location 1:28133099-28133121
Sequence TTGTTGTTGTTGTTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904111939_904111941 27 Left 904111939 1:28133049-28133071 CCTTTGCATTTCTTTTCTCTCTC No data
Right 904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904111941 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG Intergenic
No off target data available for this crispr