ID: 904117802

View in Genome Browser
Species Human (GRCh38)
Location 1:28175331-28175353
Sequence CCCTTAGATGACTGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904117802_904117808 -5 Left 904117802 1:28175331-28175353 CCCAGGACCCAGTCATCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 904117808 1:28175349-28175371 AAGGGGCTGAACTCTTTCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 149
904117802_904117809 -2 Left 904117802 1:28175331-28175353 CCCAGGACCCAGTCATCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 904117809 1:28175352-28175374 GGGCTGAACTCTTTCTCCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
904117802_904117811 22 Left 904117802 1:28175331-28175353 CCCAGGACCCAGTCATCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 904117811 1:28175376-28175398 TTGTCAGCACCTAAAGATAGTGG 0: 1
1: 0
2: 0
3: 9
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904117802 Original CRISPR CCCTTAGATGACTGGGTCCT GGG (reversed) Intronic
900393327 1:2443289-2443311 CCATTTGAGGACTGGGGCCTGGG - Intronic
902727769 1:18348592-18348614 CCCTTAAATCACTGGGCCCGAGG - Intronic
903276673 1:22226294-22226316 GTCTTTGATGCCTGGGTCCTGGG + Intergenic
904117802 1:28175331-28175353 CCCTTAGATGACTGGGTCCTGGG - Intronic
912269736 1:108196984-108197006 CCCTTATACTACTGAGTCCTAGG + Intronic
912331605 1:108825156-108825178 CCCTCAGATGACGGCATCCTTGG + Intronic
915139470 1:153758290-153758312 CCCCCATTTGACTGGGTCCTTGG + Intronic
916946763 1:169736932-169736954 CACTGAGATAACTGTGTCCTGGG + Intronic
917521274 1:175750175-175750197 CCAATAGTTGCCTGGGTCCTGGG + Intergenic
923783363 1:237044512-237044534 ACCTTTGATAAGTGGGTCCTGGG + Intronic
924071617 1:240285946-240285968 CCCATAGATGATTTGATCCTTGG + Intronic
924074513 1:240319374-240319396 CCCTTAGAACACTGGTTCCTTGG + Intronic
1063230094 10:4057286-4057308 CCCTGAGCTGAGTGTGTCCTGGG - Intergenic
1063235880 10:4115849-4115871 ACCCTAGAAGACTGGGTCCCTGG + Intergenic
1066187641 10:33025707-33025729 CCCTTAGATGAAAGGAACCTGGG - Intergenic
1067218956 10:44327795-44327817 CCCAAAGAAGCCTGGGTCCTGGG + Intergenic
1068588879 10:58833038-58833060 TCCTTAGATGACTGTTTCCAAGG + Intergenic
1068954252 10:62806968-62806990 CCCTAAAATGACTGAGCCCTGGG + Exonic
1069617263 10:69814027-69814049 CCCTCAGATGTCAGGGTCCCGGG - Intronic
1075123725 10:119682918-119682940 CCCAGAGATGACTGGGGTCTGGG - Intergenic
1076062967 10:127427845-127427867 CCCTCAGATGAGAGGGTCCCAGG + Intronic
1076514994 10:131040092-131040114 CCTGGAGATGACTGGATCCTGGG + Intergenic
1079410261 11:20180867-20180889 CCCTTAATTGACTGTGACCTTGG + Intergenic
1081372757 11:42324105-42324127 CCTTCAGATGACTATGTCCTTGG + Intergenic
1082130572 11:48484169-48484191 ATCTTAGATGACTGGGATCTAGG - Intergenic
1082564079 11:54655073-54655095 ATCTTAGATGACTGGGATCTAGG - Intergenic
1083764076 11:64833804-64833826 TCCTGAGATGCCAGGGTCCTTGG + Exonic
1089395814 11:118135928-118135950 CCTTTGGATGAGGGGGTCCTTGG - Exonic
1090313904 11:125768158-125768180 CTCTTAGATGATTGTTTCCTGGG + Intergenic
1090459046 11:126873775-126873797 CACTTGGCTGACTGGGTGCTTGG + Intronic
1091277512 11:134362503-134362525 CCCTGGGATGACTGGGCCGTGGG + Intronic
1092988469 12:13870570-13870592 TCCTTAGAAAACTGAGTCCTGGG + Intronic
1101374356 12:104157928-104157950 CCTTCAGATGACTGCATCCTCGG - Intergenic
1103688194 12:122749594-122749616 CCCTCATATGAGGGGGTCCTTGG + Intergenic
1104965682 12:132507919-132507941 CCCTTCGATGGCTGAGCCCTGGG + Intronic
1105428343 13:20315057-20315079 CCTGTAGATGACTGTGTTCTTGG - Intergenic
1111197030 13:84888362-84888384 CCCTTATATGTGTGGGTCATTGG + Intergenic
1111755818 13:92394163-92394185 CCCTTAGATGATTGAATCTTTGG - Intronic
1119937566 14:78606715-78606737 CCCTGAGTTGACTGTCTCCTGGG - Intronic
1129045291 15:72728781-72728803 CCCTTGGATACCTGGGCCCTGGG - Intronic
1133903107 16:9995632-9995654 TTATTAGATGACTGGGACCTTGG - Intronic
1137624596 16:49899851-49899873 CCCTGGGAGCACTGGGTCCTTGG + Intergenic
1137911061 16:52379003-52379025 ACCTGAGTTAACTGGGTCCTAGG - Intergenic
1140715533 16:77722602-77722624 CCTTTACCTGACTGGCTCCTCGG - Exonic
1142140649 16:88471330-88471352 CTCTGAGATGACTGTGTCCGTGG + Intronic
1142482926 17:229688-229710 GCCATGGATGAGTGGGTCCTGGG + Intronic
1143637113 17:8171576-8171598 CCCTGAGTTGACTGGGTCTTGGG - Intergenic
1148973957 17:51510439-51510461 CTCTTAGGTGCTTGGGTCCTGGG + Intergenic
1151872880 17:76848508-76848530 CCCTTTGATGTCTGGAACCTGGG - Intergenic
1153026306 18:675984-676006 TCCTTAGATGTCTTGGTTCTTGG - Intronic
1155767760 18:29656710-29656732 CACTTAGACTACTGGGTCCTGGG - Intergenic
1157405850 18:47422300-47422322 GCAGTAGAGGACTGGGTCCTAGG - Intergenic
1160043416 18:75365730-75365752 CCCTGAGATGGCTGAATCCTGGG + Intergenic
1160946836 19:1647638-1647660 CCCTTGGAGGTCTGGGTCCAGGG - Intronic
1163731038 19:18949285-18949307 CCCTGAGAGGCCTGGGTCCTGGG - Intergenic
1166367879 19:42286404-42286426 CCCGTAGAGGTCTGGGGCCTTGG + Intronic
925316990 2:2934121-2934143 CACTTTGATGACTGGCTCCCTGG + Intergenic
926726490 2:16002412-16002434 CCCTTAGATGATTTTGTTCTGGG - Intergenic
929826698 2:45314414-45314436 CCCTTACATTGCTGGGTCCAGGG - Intergenic
933719673 2:85389991-85390013 GCCTTAGATGTCAGGCTCCTGGG + Intronic
935439541 2:103076144-103076166 CCCTTGGATGTCTGGCTGCTAGG - Intergenic
936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG + Intergenic
938587154 2:132702319-132702341 CCCTTAAATTTCTGGGTCATTGG - Intronic
941910872 2:170763479-170763501 ACCTTAGCTCACTGGGTTCTCGG + Intergenic
944930078 2:204508405-204508427 TCCTCAGATGACTGGAGCCTTGG - Intergenic
947476082 2:230448862-230448884 CCCCTGGATGACAGGGGCCTTGG - Intronic
948124850 2:235557068-235557090 GACTTAGGGGACTGGGTCCTGGG + Intronic
948909207 2:240994561-240994583 CCCTCAGGTGCCTGGGTCCGGGG + Intergenic
1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG + Intergenic
1179452903 21:41477820-41477842 CCCTTTGATGCCTGAGTTCTTGG - Intronic
1180996631 22:19969134-19969156 CCCCTAGCTGGCTGGGTTCTGGG + Exonic
1181870629 22:25896043-25896065 CCCTTTGATAACAGGGTCGTGGG + Intronic
1184592855 22:45496796-45496818 CCCTTTGATCCCTGGGTCCTGGG - Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185423374 22:50748218-50748240 CCCTTAGATGTCTAGGTCCCTGG - Intergenic
951896549 3:27614907-27614929 CCCTAATATGACTGAGTCCAGGG + Intergenic
953698772 3:45180170-45180192 CCTTTAGATGACTGCATCCCTGG - Intergenic
953805718 3:46065775-46065797 CACTTAGAGGACTGAGCCCTGGG + Intergenic
954941695 3:54378774-54378796 CCCTGAGCTGCCTTGGTCCTTGG + Intronic
959933329 3:112005475-112005497 CCCTTTGATGACTGGGAGTTAGG + Intronic
960764652 3:121112134-121112156 GCCTAAGATGACTGAGTCCTGGG - Intronic
961409435 3:126707943-126707965 CTCTATGATGACAGGGTCCTCGG - Intronic
962019684 3:131485586-131485608 CCCTGAAATCACTGGTTCCTTGG - Intronic
962580084 3:136790274-136790296 CCTGTAAATGACTGGATCCTTGG - Intergenic
967303553 3:188039527-188039549 CGCATGGATGACTGGATCCTTGG + Intergenic
968320036 3:197758377-197758399 CCCTAAACTGATTGGGTCCTAGG + Intronic
969447341 4:7252903-7252925 CCCTTAGCTGGCTGGGTACGTGG + Intronic
976321948 4:83726330-83726352 CAATTAGATGACTGGCTCCTGGG + Intergenic
983525236 4:168753800-168753822 CCTTTAGCTGACTGCGGCCTTGG + Intronic
988700777 5:33672514-33672536 CCCTTAGCTCACAGGGTCCCTGG + Intronic
993515510 5:88828985-88829007 CCCTTAGAAGAGTGAGTCTTGGG - Intronic
994047039 5:95321758-95321780 CCCTCAGCTGTCTGTGTCCTTGG - Intergenic
998026177 5:138818752-138818774 GACTTAGCTGACTGGGTCCCTGG + Intronic
1001432785 5:171676364-171676386 CCTTTAGATGACTGAAGCCTTGG - Intergenic
1005328649 6:24727031-24727053 CCTTCAGATGACTGGTGCCTTGG - Intergenic
1007393150 6:41562020-41562042 TCTTTAGCTGACTGGGTCCCAGG + Intronic
1009035084 6:58107147-58107169 CCCATAGGTGACCTGGTCCTGGG + Intergenic
1015926778 6:138318338-138318360 TCCTTAGATGACAGGCTCCTAGG - Intronic
1018685663 6:166302462-166302484 GCCCTTGATGACTGTGTCCTAGG - Intergenic
1021220402 7:17969451-17969473 CCCTCAGAGGACTGGGCCATGGG + Intergenic
1023307014 7:38841342-38841364 ACCTTGGATGATTGGTTCCTTGG - Intronic
1024409218 7:49019968-49019990 CCGTGAGATAACTGGGTCTTTGG + Intergenic
1024523103 7:50324875-50324897 CCCTTAGATGCATGGGGCCCTGG - Intronic
1026239069 7:68556107-68556129 TCCTGAGATCCCTGGGTCCTTGG + Intergenic
1026311679 7:69191247-69191269 CCCTCACATGACTGGGGCCTTGG + Intergenic
1029632406 7:101761221-101761243 CCCTTAAATGACTGGGTTGAGGG - Intergenic
1030676913 7:112393954-112393976 CCCTCAGATTACTGAATCCTAGG + Intergenic
1032025930 7:128442548-128442570 CCCTTAGATGACAAGGCTCTGGG - Intergenic
1034984377 7:155498317-155498339 CCCTAAGATGAAAGGGTCTTGGG - Intronic
1035888692 8:3321268-3321290 TCCTTAGAAGACTGGGACCAGGG - Intronic
1035917929 8:3645172-3645194 CCCTTACTTCACTGAGTCCTGGG + Intronic
1036409242 8:8483583-8483605 CACTGAGATGACTGGAACCTTGG - Intergenic
1037316676 8:17605853-17605875 CTCTTTGATGGCTGGCTCCTCGG + Intronic
1046669340 8:117040983-117041005 CCCTTGGGTGACTGGTTCTTTGG - Intronic
1048182285 8:132206508-132206530 CTCGTATATGACTGTGTCCTTGG - Intronic
1056794115 9:89645440-89645462 CCTTTAGTTGACTGTGTTCTTGG + Intergenic
1058456410 9:105141912-105141934 CCCTGAGATGACTGCAGCCTGGG + Intergenic
1059791739 9:117647958-117647980 CCCTTAGATGACTATGGCCCAGG - Intergenic
1061139230 9:128754131-128754153 CCTTTAGATTCCTGGTTCCTGGG - Intronic
1187997676 X:24946223-24946245 CACTCAGCTGACTGGATCCTGGG + Intronic
1188199792 X:27283964-27283986 CCCTGAGATGGCTGGATCCACGG + Intergenic
1190054965 X:47175988-47176010 CCCATGGATGGCTGGGTCCTGGG - Intronic