ID: 904117863

View in Genome Browser
Species Human (GRCh38)
Location 1:28175642-28175664
Sequence CCTATCAGGTCCCAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904117863_904117872 -2 Left 904117863 1:28175642-28175664 CCCAGCACCTGGGACCTGATAGG 0: 1
1: 0
2: 2
3: 21
4: 231
Right 904117872 1:28175663-28175685 GGGGCTATTGTTTGTGGGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 132
904117863_904117871 -7 Left 904117863 1:28175642-28175664 CCCAGCACCTGGGACCTGATAGG 0: 1
1: 0
2: 2
3: 21
4: 231
Right 904117871 1:28175658-28175680 TGATAGGGGCTATTGTTTGTGGG 0: 1
1: 1
2: 0
3: 8
4: 103
904117863_904117870 -8 Left 904117863 1:28175642-28175664 CCCAGCACCTGGGACCTGATAGG 0: 1
1: 0
2: 2
3: 21
4: 231
Right 904117870 1:28175657-28175679 CTGATAGGGGCTATTGTTTGTGG 0: 1
1: 0
2: 2
3: 12
4: 140
904117863_904117873 18 Left 904117863 1:28175642-28175664 CCCAGCACCTGGGACCTGATAGG 0: 1
1: 0
2: 2
3: 21
4: 231
Right 904117873 1:28175683-28175705 TGGCCCTGTGTATAAGAACCTGG 0: 1
1: 0
2: 1
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904117863 Original CRISPR CCTATCAGGTCCCAGGTGCT GGG (reversed) Intronic
900740735 1:4329272-4329294 CATCTCCGGTCCCAGGTCCTGGG - Intergenic
901371625 1:8803342-8803364 CCTGTAAGGTCCCAGCTACTCGG + Intronic
902513347 1:16977726-16977748 CCTACCACGTGCCAAGTGCTGGG - Intronic
903033711 1:20481151-20481173 CCCATCAGCTCCCAGGTGCTGGG + Intergenic
904117863 1:28175642-28175664 CCTATCAGGTCCCAGGTGCTGGG - Intronic
904356796 1:29945481-29945503 CCTATTACGTGCCAGGTTCTGGG - Intergenic
904773151 1:32892289-32892311 CCTGCCTGGTCCCAGGTTCTGGG + Intronic
906126927 1:43432534-43432556 CCTCTGGGGACCCAGGTGCTTGG - Exonic
907367289 1:53972771-53972793 CTTAACATGTACCAGGTGCTAGG + Intergenic
915239489 1:154509935-154509957 CCAAGCAAGCCCCAGGTGCTGGG - Intronic
915375770 1:155393894-155393916 TCTATTATGTACCAGGTGCTGGG + Intronic
915493229 1:156263349-156263371 CCTGTCAGGTCCCAGGGTCTTGG - Intronic
915570457 1:156742740-156742762 CCCTTCAGGTCTCAGGTCCTTGG + Intronic
916439247 1:164806768-164806790 CCTACCAGGTTCCAGGCACTGGG - Intronic
918126704 1:181590227-181590249 CCTTTAAGGTGCCAGGTACTAGG + Intronic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
920057098 1:203200806-203200828 CCTATTAGGTGCCAAGTCCTGGG + Intergenic
920162475 1:204010007-204010029 CCTATTTAGTCCCAGCTGCTTGG - Intergenic
920568082 1:206992258-206992280 CCTGTCAAGTCCCAGCTACTCGG - Intergenic
920607834 1:207407241-207407263 CATATGAGGTCCCAGCTACTGGG + Intergenic
921585911 1:216946271-216946293 CCTATGAGGTGCCTGTTGCTTGG - Intronic
921606545 1:217162420-217162442 GCTAGCTGGTCCCAGGTGATTGG + Intergenic
922422769 1:225470818-225470840 CCTACCATGTGCCAGGGGCTGGG - Intergenic
922768912 1:228171459-228171481 CCTCACAGGACCCAGGTTCTGGG - Intronic
1062938385 10:1404322-1404344 CCCATCAGGTCCCCAGTGGTAGG - Intronic
1069736124 10:70655630-70655652 CCTATAAGATCTCAGGAGCTGGG - Intergenic
1070123444 10:73600623-73600645 CCTATCAGGGGCCAGGCGCAGGG + Intronic
1070549749 10:77481799-77481821 ACTAACAGGTGCCAGGTACTAGG + Intronic
1071499757 10:86194952-86194974 CCTTTGCAGTCCCAGGTGCTGGG - Intronic
1072597908 10:96892645-96892667 CCTATCACCTCCAAGGTGATAGG - Intronic
1072637632 10:97187798-97187820 CCTACTAAGTGCCAGGTGCTGGG - Intronic
1072689902 10:97565524-97565546 CCTATATAGTCCCAGCTGCTTGG + Intronic
1073486652 10:103823494-103823516 CCTAGCAAGTTCCATGTGCTAGG + Intronic
1074750124 10:116577844-116577866 CTTACCATGTGCCAGGTGCTAGG - Intergenic
1075069878 10:119313756-119313778 TCTCTCAGGCCCCATGTGCTGGG + Intronic
1075934549 10:126328227-126328249 CCTATTATGTGCCAGGTGCTAGG - Intronic
1076560937 10:131363105-131363127 CCTATTAGGTTCTAGGTGCCAGG + Intergenic
1078114487 11:8432070-8432092 CCTACCAGGTACTAGGTGCTAGG - Intronic
1078613108 11:12839523-12839545 GTTATTATGTCCCAGGTGCTAGG + Intronic
1079247528 11:18763707-18763729 CCTACTAGGTCTCAGGTACTAGG - Intronic
1079457870 11:20652349-20652371 CCTAACTGGTCCATGGTGCTCGG + Exonic
1080499831 11:32860090-32860112 CCTATCATGTGCCAGTTTCTAGG + Intergenic
1080971779 11:37286304-37286326 CCTATTATGTCCCAGGCACTAGG + Intergenic
1083662683 11:64259079-64259101 CCCATCAGGTCCTGGGGGCTGGG - Exonic
1083718916 11:64594408-64594430 CCTACTATGTGCCAGGTGCTCGG - Intronic
1084145962 11:67265593-67265615 GTTGTCAGGTCCCAGGTTCTGGG + Intergenic
1084399684 11:68936471-68936493 CGTAGCAGGTCCCTGGGGCTTGG - Exonic
1084566414 11:69931332-69931354 CCTGCCAGGTCCCAGCCGCTGGG + Intergenic
1085475960 11:76789052-76789074 GGCATCAGGTCCCAGGTCCTGGG + Intronic
1089125475 11:116173547-116173569 CCTAACACGTGCCAGGTGTTGGG - Intergenic
1089567267 11:119378377-119378399 CCTCTCAGGCCCCAGGGCCTGGG + Intronic
1090754621 11:129779037-129779059 CAGAGCAGGTCTCAGGTGCTTGG + Intergenic
1090830887 11:130420210-130420232 CCTAAGAGGACCCATGTGCTTGG + Intronic
1091852952 12:3715119-3715141 CCTACCAGGTTCCAGGCACTGGG + Intronic
1093888660 12:24492797-24492819 CATATAAGGTCTCAGGTGTTAGG + Intergenic
1094709277 12:32945079-32945101 TTTATCAGGTGCCAGGTTCTGGG - Intergenic
1094818546 12:34208201-34208223 CCTCCCAGGTACCAGGTGGTGGG - Intergenic
1095818009 12:46445971-46445993 CCTATTATGTGCCAGGTTCTAGG + Intergenic
1098161658 12:67651119-67651141 CACATCTGGTCCCAGGGGCTGGG + Intronic
1099194798 12:79603131-79603153 CCTCCCAAGTCCCAAGTGCTTGG - Intronic
1100480032 12:94969085-94969107 CCTGTCTGGTCCCACCTGCTAGG + Intronic
1101323364 12:103693309-103693331 CCTATGTGGTCCCAGCTACTAGG + Intronic
1102595552 12:113989759-113989781 CCAATCAGGTTGCAGGTGCTGGG + Intergenic
1103253922 12:119523877-119523899 CCTGCCAGGTGCCAGGTGCTGGG + Intronic
1104652600 12:130546973-130546995 CCTATCATCTCCCCAGTGCTGGG + Intronic
1107241571 13:38241099-38241121 CCTAAGGGGTCCCAGGTGTTAGG + Intergenic
1108075103 13:46671392-46671414 CCTATCAGGTGCCAGGCACCTGG - Intronic
1109149245 13:58823827-58823849 CCCAGCAGGTGCCAAGTGCTGGG + Intergenic
1110620026 13:77584980-77585002 CCTACTAGGTGCCAGGTACTTGG - Intronic
1113607706 13:111622251-111622273 CCCCGCAGGTCCCAGGGGCTGGG - Intronic
1119513801 14:75232347-75232369 CCTATTAGCTCCCAGATACTTGG + Intergenic
1121568092 14:94925651-94925673 CTTAATAGGTACCAGGTGCTGGG - Intergenic
1121916875 14:97843516-97843538 CCTATCAGGCCCACGCTGCTTGG + Intergenic
1122175553 14:99915871-99915893 ACTGGCATGTCCCAGGTGCTAGG + Intronic
1122595488 14:102887430-102887452 CCCATCAGCTTCAAGGTGCTGGG - Intronic
1122689319 14:103524176-103524198 CCTAACAGGTGCCAGCCGCTGGG + Intergenic
1123037519 14:105477502-105477524 CCCATCAGGGCCCAGTTGGTGGG + Intronic
1126362010 15:47856396-47856418 CCTATGTAGTCCCAGCTGCTTGG + Intergenic
1127851091 15:62912490-62912512 CGTAACAGCTCCCAGGTCCTTGG - Intergenic
1129162875 15:73756790-73756812 CCTACCAGGTGCCAGGCACTGGG - Intergenic
1130765273 15:86863941-86863963 CCTACCATCCCCCAGGTGCTAGG - Intronic
1132663336 16:1071105-1071127 CCCAGGAGGGCCCAGGTGCTTGG + Intergenic
1133101324 16:3481845-3481867 CCTTTCTGCTCCCACGTGCTGGG - Intronic
1133131255 16:3677296-3677318 CCTGTCTGGTCCCATGTGGTTGG - Intronic
1133368981 16:5233833-5233855 CCTCTGTGGTCCCAGGTACTTGG + Intergenic
1134415977 16:14043748-14043770 GCTTTCAGGTACCTGGTGCTGGG - Intergenic
1135170573 16:20179797-20179819 CCTATGATGTGCCTGGTGCTGGG - Intergenic
1135183335 16:20293546-20293568 CCTAATATGTCCCAGGTGTTAGG + Intergenic
1135543751 16:23352063-23352085 CTTACCATGTGCCAGGTGCTAGG - Intronic
1137287600 16:47029304-47029326 CCTATCAAGTCACGTGTGCTGGG + Intergenic
1139594022 16:67947866-67947888 CCTGTCAGGTCCCGGGTGGGAGG + Intronic
1140396823 16:74634508-74634530 CCTCTCTGGTCCCAGCTACTTGG - Intronic
1141196547 16:81865494-81865516 GCTCCCATGTCCCAGGTGCTTGG + Intronic
1141686040 16:85570566-85570588 CCTGTCACCTCCCAGGTTCTAGG + Intergenic
1144829952 17:18125795-18125817 TCTGTCAGGTCCCAGATGGTGGG - Intronic
1146502870 17:33379474-33379496 CTTAAAAGGTCCCAGGAGCTAGG - Intronic
1147933360 17:43996588-43996610 CATATGTGGTCCCAGCTGCTTGG - Intronic
1148612842 17:48975946-48975968 TCCATCATGCCCCAGGTGCTGGG - Intergenic
1149553304 17:57555706-57555728 CCTATTATGTCCCAGGTACTGGG - Intronic
1149563695 17:57627289-57627311 GCTATCAGTTCCCAGGTGAGTGG + Exonic
1150268883 17:63849719-63849741 CCTGTAACGTTCCAGGTGCTTGG + Intergenic
1151820430 17:76493975-76493997 CCTATCCGGCCCCAGGCTCTGGG + Intronic
1151890677 17:76949021-76949043 CCTGGGAGGTCCCAGGGGCTCGG - Exonic
1151905746 17:77047519-77047541 CCTGTCAAGTCCCAGCTACTTGG - Intergenic
1151976920 17:77488425-77488447 CATGTCAGGTCCCAGGAGGTGGG - Intronic
1152153983 17:78621145-78621167 CCAGTCAGGTCCCAGCTGCTCGG - Intergenic
1152929604 17:83103125-83103147 CCTCTCAGACCCCTGGTGCTCGG - Intergenic
1157599267 18:48884224-48884246 CCTATTTGGTGCCAGGTGCCAGG + Intergenic
1160534370 18:79584383-79584405 ACTCTCAGGTCTCAGGGGCTGGG + Intergenic
1161439826 19:4284649-4284671 CCTATCACAGCCCAGGGGCTGGG - Intronic
1163695058 19:18759881-18759903 CCCATCAGGTGCCGTGTGCTTGG - Intronic
1163768731 19:19178137-19178159 CCTATCAAGTCCCTGGCCCTGGG - Intronic
1165540624 19:36490167-36490189 CCCATCAGGTCGCAGGTTCCTGG - Intergenic
1165738383 19:38191918-38191940 GCTGTCCTGTCCCAGGTGCTGGG - Intronic
1166219947 19:41357823-41357845 CCTCTGAGGTCCCTGGGGCTGGG - Intronic
1166266960 19:41690460-41690482 CCTGGCAGGACCCAGGAGCTGGG + Intronic
1167858086 19:52258883-52258905 CCTGTCAAGTCCCAGCTACTCGG - Intergenic
926125150 2:10267510-10267532 CTTATCAGGTGCCAAGTGCTGGG + Intergenic
927866341 2:26590222-26590244 TCCATCAGGTCCCTGGAGCTGGG + Intronic
927939260 2:27093483-27093505 CCTACCATGTCCCAGGCACTGGG + Intronic
927958760 2:27226255-27226277 CCCAACAATTCCCAGGTGCTGGG - Exonic
931275905 2:60743757-60743779 CCTGTCAGATCCCAGGGCCTGGG + Intergenic
933664890 2:84956870-84956892 ACTATCAGGTCTCAGTTCCTGGG + Intergenic
937352063 2:121172246-121172268 TGGATCAGGTCCCAGGGGCTTGG - Intergenic
938056625 2:128220311-128220333 CCTATAAAGTCCCAGCTGCAAGG + Intergenic
938457398 2:131475666-131475688 CCTGCCACTTCCCAGGTGCTGGG + Intronic
940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG + Intergenic
940812357 2:158259399-158259421 TCTATCAGGTGCCGGGTGGTAGG - Intronic
942082483 2:172413773-172413795 CCTATAGAGTCCCAGGTTCTGGG + Intergenic
944681948 2:202085255-202085277 CCTCTCAGGTCCCAGGGATTAGG - Intronic
945347171 2:208732085-208732107 CCTATCAGTTCACATGTCCTTGG + Intronic
946229380 2:218282167-218282189 CATTTCAGGTCCCAGCAGCTGGG - Exonic
947620784 2:231589591-231589613 CCTCTCACCTCCCAAGTGCTGGG - Intergenic
947634531 2:231673350-231673372 CCTTTCAGGGACCAGGTTCTGGG - Intergenic
948141807 2:235678802-235678824 CCTGTCAGCTGCAAGGTGCTGGG + Intronic
948480626 2:238248020-238248042 CTTATCAGGCCCCAGCTGGTGGG - Intronic
1171382621 20:24745021-24745043 GCAATCAGGGCCCAGGTGCAGGG + Intergenic
1173594439 20:44249536-44249558 CCTGTCTGGTCCCAGCCGCTGGG - Intronic
1174462546 20:50692845-50692867 CGTCTCTGGTCCCAGCTGCTTGG - Intergenic
1174576943 20:51543256-51543278 CCTACCACGTGCCAGGTGCTGGG + Intronic
1175342211 20:58240188-58240210 AGTATAAGGTCTCAGGTGCTAGG - Intergenic
1175438923 20:58977105-58977127 CCTACTAGGTGTCAGGTGCTGGG - Intergenic
1175445864 20:59018978-59019000 CCTCGCAGGTCCCAGGTCCCGGG - Intergenic
1175769956 20:61617297-61617319 CACACCAGGCCCCAGGTGCTGGG - Intronic
1176422288 21:6525821-6525843 CCTAGCTGGGTCCAGGTGCTGGG - Intergenic
1176587551 21:8603512-8603534 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1177804587 21:25861849-25861871 CCTACTATGTCCCAGGTACTGGG - Intergenic
1178624431 21:34203267-34203289 GGTTTCAGGTCCCATGTGCTGGG - Intergenic
1179697779 21:43134137-43134159 CCTAGCTGGGTCCAGGTGCTGGG - Intergenic
1179887466 21:44320320-44320342 GCTGGCAGGTCCCGGGTGCTGGG + Intronic
1179952314 21:44715634-44715656 CCTCTCTGGTCCCAGCTACTTGG - Intergenic
1180270381 22:10580510-10580532 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1180737611 22:18029707-18029729 CCTATAAGCTCTCAGATGCTTGG - Intergenic
1180786679 22:18551554-18551576 ACTAGCAGGTCCCAGATGGTAGG - Intergenic
1180977384 22:19855691-19855713 CCTATCTTGTCCCAGGATCTGGG - Intergenic
1181044421 22:20207822-20207844 GCCAGCAGGTCCCAGGAGCTGGG + Intergenic
1181243593 22:21491075-21491097 ACTAGCAGGTCCCAGATGGTAGG - Intergenic
1181323404 22:22025863-22025885 CCTGGGAGGTCCCAGCTGCTGGG - Intergenic
1182622179 22:31624200-31624222 CCTTCCTGGGCCCAGGTGCTTGG - Intronic
1183585320 22:38749982-38750004 CCTACCGGGACCCAGGTCCTTGG + Intronic
1183797400 22:40131025-40131047 CCTGTCAAGTCCCAGCTACTCGG - Intronic
1183809930 22:40246973-40246995 CCTGTCAGGTCTCAGGTGAGCGG + Intronic
1183856630 22:40638996-40639018 CCTGTCAAGTCCCAGCTACTCGG + Intergenic
1184095051 22:42311882-42311904 CCTTTCAAGTCCCAGCTTCTGGG - Intronic
949139803 3:618239-618261 CCTAGCAGGTTCCAGCTACTAGG + Intergenic
949943516 3:9172672-9172694 CCTTTCTGGCCCCAGGAGCTGGG + Intronic
950880895 3:16321963-16321985 CCTAACAGGTTCCTGGTGGTGGG - Intronic
951940978 3:28078719-28078741 CTTATCATGGGCCAGGTGCTTGG + Intergenic
952041463 3:29266767-29266789 CCTATTAAGTTCTAGGTGCTGGG + Intergenic
953162771 3:40436774-40436796 CCCATCAACTCCCAGGTTCTAGG + Intergenic
955149151 3:56349617-56349639 CCTATCAGGGGCCAGGCGCGTGG + Intronic
956311445 3:67885065-67885087 CCTTTCAGGTTCCACGTCCTCGG - Intergenic
959333394 3:105035120-105035142 CCAATAAGATCTCAGGTGCTGGG - Intergenic
961508119 3:127385024-127385046 CCTATCTGCTCCCTGGTGCTTGG + Intergenic
963232832 3:142926215-142926237 CCTATCATGTGCCAGGCACTAGG + Intergenic
964711934 3:159680149-159680171 CCTATTGTGTTCCAGGTGCTGGG - Intronic
965277519 3:166704652-166704674 CCTAGCAGGTCCCTGGTCCCTGG + Intergenic
966841942 3:184096807-184096829 CCTGTGAGGTCCCAGCTACTTGG + Intergenic
967828446 3:193897812-193897834 CCTGTCAGCTTCCAGGAGCTGGG - Intergenic
968490630 4:888988-889010 CTCAGCAGGCCCCAGGTGCTCGG + Intronic
968654039 4:1771044-1771066 CCTCTCAGGTCCCAGGGTCAGGG - Intergenic
968735712 4:2295650-2295672 CCTGTGAGGGCCGAGGTGCTGGG - Intronic
969258664 4:6020364-6020386 CCACTCAGATCCCAGGCGCTGGG + Intergenic
970487828 4:16542195-16542217 CCTACCAGGTTCCAGGCACTTGG + Intronic
971174801 4:24271831-24271853 CTTACCATGTTCCAGGTGCTAGG - Intergenic
972991046 4:44822947-44822969 CCCCCCAGGTCTCAGGTGCTGGG + Intergenic
973120372 4:46514498-46514520 ACTACCAGGTCCCAGAAGCTGGG + Intergenic
973713216 4:53649889-53649911 CTTACGAGGTTCCAGGTGCTTGG - Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
978760804 4:112355435-112355457 GCTATCAGGATCCAGGTTCTGGG + Intronic
980088479 4:128416636-128416658 CCTCTCCAGTCCCAGGTTCTGGG - Intergenic
980993870 4:139762240-139762262 CCTATTGTGTCCCAGGCGCTGGG - Intronic
982257318 4:153463609-153463631 CCTCTGTGGTCCCAGCTGCTTGG + Intergenic
984130924 4:175875164-175875186 CCTGTCAGGGCACAGCTGCTAGG - Intronic
984408219 4:179362099-179362121 CTTATCAGGTCACAGGTGATGGG - Intergenic
985612061 5:895098-895120 GCTGTCAGGAGCCAGGTGCTGGG + Intronic
985717085 5:1468771-1468793 CCTCTGGGGTCCTAGGTGCTAGG + Intronic
988656709 5:33219758-33219780 CATATGTGGTCCCAGCTGCTGGG + Intergenic
990281206 5:54252847-54252869 CCTCTATGGTCCCAGCTGCTCGG - Intronic
994977321 5:106826680-106826702 CATATCAGGTCACAGATTCTTGG - Intergenic
996302778 5:122008082-122008104 CCTGTCAGGTCCCAGGCTCCAGG - Intronic
996738546 5:126778205-126778227 CCCCTCAGGCCCCAGGTGCGGGG + Intronic
997444950 5:133933951-133933973 CCCAGCAGGTCCCAGGTGGGAGG - Intergenic
999241876 5:150132623-150132645 CATATTAGGTGCCAGGTGCTGGG - Intronic
1000447248 5:161337541-161337563 CATATCAGGGCACAGTTGCTGGG + Intronic
1004779624 6:18894112-18894134 CCTATTAGGTCACAGGTGGCAGG + Intergenic
1006131833 6:31874251-31874273 CCTACTATGTGCCAGGTGCTGGG - Intronic
1006631350 6:35432345-35432367 CCCCTCAGGACCCAGCTGCTGGG + Intergenic
1007139641 6:39558324-39558346 GCTATCAGGAACCAGGTGTTAGG + Intronic
1007965675 6:46001608-46001630 CCTACCAGGTGCCAGGCCCTGGG - Intronic
1012927754 6:105284562-105284584 CCTACCAGGACCCCAGTGCTTGG - Intronic
1015924631 6:138296578-138296600 CCTGTCACGTCCCAGGTACCGGG + Intronic
1020159366 7:5756748-5756770 TTTACCAGGTCCCAGGTACTTGG - Intronic
1021544260 7:21795534-21795556 CCTCTCATGTGTCAGGTGCTAGG - Intronic
1023166486 7:37348373-37348395 ACTATCAAATCCCAGGTGGTGGG + Intronic
1023513730 7:40979716-40979738 GATTTCAGGTTCCAGGTGCTTGG - Intergenic
1024354467 7:48400279-48400301 CCTAGCAGGTGGCAGGTGCCAGG + Intronic
1024744093 7:52387648-52387670 CATATCAGGTACCAGGAGATAGG - Intergenic
1026284042 7:68947597-68947619 CCTATCATGTACCATGTACTTGG - Intergenic
1028419642 7:90618500-90618522 CCTTTCATGACCCAGGTGCTGGG + Intronic
1031122159 7:117734115-117734137 CGTCTCAGGTCCCAGGTCCAGGG - Intronic
1031402271 7:121339457-121339479 ACTCTCAGGTCCAAGGTTCTAGG - Exonic
1031411933 7:121449535-121449557 CATATCTGGTCCCAGCTGGTAGG - Intergenic
1032011060 7:128348319-128348341 CCTATGACGTACTAGGTGCTGGG - Intergenic
1034866901 7:154649682-154649704 CCCATGAGGCCCCAGGTGCCAGG - Intronic
1036116514 8:5966020-5966042 CCTATCAGATGCCAGTTGCAAGG - Intergenic
1036660631 8:10706179-10706201 TGTTTCAGTTCCCAGGTGCTGGG - Intronic
1038958139 8:32489337-32489359 CCGATAAGGTCCCAGGAGTTGGG - Intronic
1040474513 8:47764551-47764573 CCCATCAGGTCCCTGGCGCTGGG + Intergenic
1044879085 8:96704060-96704082 CCTATTATGTCCCAGGCACTGGG + Intronic
1047480662 8:125279198-125279220 CGTCTCAGCTCCCAGGTGCACGG - Intronic
1050432239 9:5573747-5573769 CCTATCACGTACCAGGTACATGG - Intergenic
1050609455 9:7336440-7336462 CCAATGAGCTCCCAGTTGCTAGG + Intergenic
1052419272 9:28221173-28221195 CCTGTAAGGTCCCAGCTACTTGG + Intronic
1055211466 9:73799650-73799672 CCTCTGTGGTCCCAGGTGCCAGG + Intergenic
1058003416 9:99890464-99890486 CCAGTCATGTACCAGGTGCTGGG + Intergenic
1058861790 9:109123570-109123592 CCTATGCTGTGCCAGGTGCTGGG - Intergenic
1060263207 9:122093348-122093370 CCTATGAGGTCGCTGGGGCTCGG - Exonic
1060341448 9:122780267-122780289 CCTATGATGTGCCAGGTGCTTGG + Intergenic
1061382844 9:130268662-130268684 CCTGGCAGATGCCAGGTGCTGGG + Intergenic
1203617516 Un_KI270749v1:81690-81712 CCTAGCAGGTTCCAGCTACTAGG - Intergenic
1189281685 X:39823583-39823605 CCTATCTGGTGGCTGGTGCTAGG - Intergenic
1191665827 X:63701370-63701392 CCTATCAGGCCTCAGGTTCCAGG - Intronic
1192656806 X:73002172-73002194 CTTATCAGGTACTTGGTGCTGGG - Intergenic
1192665314 X:73080829-73080851 CTTATCAGGTACTTGGTGCTGGG + Intergenic
1193013685 X:76707783-76707805 TTTATCAGCTACCAGGTGCTTGG + Intergenic
1193948608 X:87768376-87768398 CCTAGCAGGTTCCAGGTGAATGG + Intergenic
1195113574 X:101672236-101672258 CCTATCAGCTTCCAGCTGATAGG + Intergenic
1197001773 X:121448490-121448512 CCTATTACGTTCCAGGTACTGGG - Intergenic
1197926038 X:131647580-131647602 CCTTTCAGGTCTCAGGTCCTTGG - Intergenic
1198119655 X:133579411-133579433 CCAATTAGGTCCCAGGCACTGGG + Intronic
1200292223 X:154885407-154885429 CCTGTCAGGTCCCAGGGGCCGGG - Exonic
1200339060 X:155381144-155381166 CCTGTCAGGTCCCAGGGGCCGGG - Intergenic
1200347409 X:155459548-155459570 CCTGTCAGGTCCCAGGGGCCGGG + Exonic
1200521182 Y:4211254-4211276 CATATCAGGTACCAGGAGATGGG - Intergenic