ID: 904124754

View in Genome Browser
Species Human (GRCh38)
Location 1:28230318-28230340
Sequence CTGTTTTCATAGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904124754 Original CRISPR CTGTTTTCATAGAGTGAAGA GGG (reversed) Intronic
900030314 1:366587-366609 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
900050968 1:595651-595673 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
901339732 1:8485403-8485425 CTGTTTTAATTTAATGAAGATGG - Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904255258 1:29250652-29250674 CTGTGTTGATGGAGTCAAGAAGG + Intronic
906240834 1:44241233-44241255 GTGTTTTCAGGGAGTGAAGGTGG + Intronic
907124106 1:52033876-52033898 CTGTTTCCATAGAAACAAGAGGG - Intronic
908345149 1:63225039-63225061 CTGTTTTCATAGAATGATTTGGG - Intergenic
909703828 1:78556920-78556942 CTGGTTTCATAGAATGAATTAGG - Intergenic
910584818 1:88867768-88867790 CTGTTTTTATAAAGACAAGATGG + Intronic
910685800 1:89914746-89914768 TTTTTTACATATAGTGAAGATGG + Intronic
910879262 1:91907769-91907791 ATATTTTAATAGAGTCAAGATGG - Intergenic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911351234 1:96758389-96758411 GTGGTTTCATAAAGTGAACAGGG - Intronic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
915773148 1:158451921-158451943 TTGTTTTCATAGAATGAATTAGG - Intergenic
916308695 1:163369874-163369896 CTGTATTCTTACAGTGAAGTAGG - Intergenic
917044567 1:170844024-170844046 ATGTTTTCAAAGTGTGAATATGG - Intergenic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
918882947 1:190150127-190150149 CTGTTTTCTAAAAGTGAAAATGG - Intronic
919289175 1:195606686-195606708 CTGTTTTGATAGATTAAAAATGG + Intergenic
921104846 1:211966227-211966249 CTGTTTTCAAAAAGTTAACATGG - Intronic
921148548 1:212381914-212381936 CTGTTCTCAGAGAGAGAAGGAGG + Intronic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
921844070 1:219860511-219860533 CTTCTTTCAGAGAGTGAGGAAGG + Intronic
923926946 1:238640064-238640086 CTGCTTTCAGAGAGTGGGGAAGG - Intergenic
924010402 1:239659063-239659085 CTGTTTTCACAATGTGAACATGG - Intronic
924360931 1:243241029-243241051 TTGTTTTCATAGTGTGAAAATGG - Intronic
1064907838 10:20366996-20367018 CTGTCTTCATAGAATGAATTAGG + Intergenic
1065506157 10:26432084-26432106 CTGTTTTCCTTGTGAGAAGAAGG - Intergenic
1068162745 10:53287503-53287525 CTGTTTGCATACAGTGAAAAGGG - Intergenic
1068764527 10:60748333-60748355 CAGTTTTCTCAGGGTGAAGAGGG + Intergenic
1069150166 10:64950398-64950420 CTGGCTTCATAGAATGAATAGGG + Intergenic
1069325682 10:67228954-67228976 CTGGCTTCATAGAGTGAATTAGG - Intronic
1070494087 10:77005528-77005550 CTGCTTTCCTAGAGTTAAGTTGG - Intronic
1071753868 10:88513531-88513553 ATGGATTCATAGAGTGATGAAGG - Intronic
1072215093 10:93281202-93281224 CTGTTTTCTTAAAGAAAAGAGGG - Intergenic
1073022821 10:100460727-100460749 CTGTTATCCTAGAGGGGAGAAGG + Intergenic
1074692727 10:116021199-116021221 CTTTATTCATAGTGTGAAAATGG - Intergenic
1074930100 10:118116303-118116325 CTGTTTTCATACATAAAAGAGGG - Intergenic
1075283314 10:121160247-121160269 TTGTTTTAATAAAGTGGAGATGG - Intergenic
1076465745 10:130680548-130680570 CTGTTTCCATTGAGTGATGAGGG + Intergenic
1077737898 11:4810756-4810778 CTGTTCAGATTGAGTGAAGAGGG - Intronic
1078075237 11:8153116-8153138 CTATTTTCAAAGACAGAAGAGGG + Intronic
1078293962 11:10046266-10046288 CTGGCCTCATAGAATGAAGAAGG - Intronic
1078348799 11:10575370-10575392 CTGTTTTCAAAGAGAGAATAGGG + Exonic
1079565152 11:21873425-21873447 AGATTTTCATAGAGTTAAGAAGG + Intergenic
1081012820 11:37836714-37836736 CTGTTTGCATATAGTGGAGCTGG + Intergenic
1081316271 11:41634656-41634678 CAGTTTTAATAGTGTGAATATGG + Intergenic
1082583186 11:54899425-54899447 CTGTTTTCGTAGAATGTAGTAGG + Intergenic
1082917370 11:58451970-58451992 CTGTTTTCCTAGAGTCGTGATGG - Intergenic
1086258032 11:84903247-84903269 CTGTGTTCAGAGAGTAAAGAAGG - Intronic
1086287308 11:85264423-85264445 CTGTTTTGATGGTGAGAAGAAGG - Intronic
1087133139 11:94686550-94686572 CTCTTATCCTAGAGTTAAGAGGG - Intergenic
1089071939 11:115707369-115707391 CTGTCCTCATAGAGTGGACAGGG + Intergenic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1089134988 11:116241864-116241886 CTATTTTCATAGTGTGATCAGGG - Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1092069843 12:5623615-5623637 CTGTTTCCATAGGATTAAGATGG - Intronic
1093205411 12:16242945-16242967 CTGCTATTATAGAGTCAAGAGGG + Intronic
1093367556 12:18322747-18322769 ATGATTTTATGGAGTGAAGATGG - Intronic
1093448625 12:19289723-19289745 TTCTTTTCCCAGAGTGAAGAAGG + Intronic
1096957164 12:55538293-55538315 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1097771424 12:63590965-63590987 CTGTCTTCATATATTGCAGAGGG - Intronic
1099112756 12:78582931-78582953 CTGTCTTCATAAAGTGGAGGAGG - Intergenic
1099860989 12:88226003-88226025 CTGTTTTCATATAGTGAGTGAGG - Intergenic
1100290689 12:93211742-93211764 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1104568710 12:129906849-129906871 GTATTGTCATAGAGAGAAGACGG - Intergenic
1105240680 13:18607121-18607143 CTGTCTTCATAGAATGAGTATGG - Intergenic
1105850429 13:24329400-24329422 CTGTTTTCGTGGGGAGAAGAGGG + Intergenic
1106181412 13:27372604-27372626 TTGTTTTCAGAGAGAGAGGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108023333 13:46151913-46151935 CTGTTTACATACAGATAAGATGG + Intronic
1108194382 13:47977417-47977439 CTGGCTTCATAGAGTGAGTATGG - Intronic
1108866344 13:54927660-54927682 CTGCTTTCATAGAGTGTACAAGG - Intergenic
1109867267 13:68281701-68281723 CTGTTTTGACAGAGTGCTGATGG + Intergenic
1110355704 13:74564522-74564544 CAGTTTTCATAGACTTCAGAGGG - Intergenic
1110945530 13:81410782-81410804 CTGTGTTCATACAGTGAATTAGG + Intergenic
1112299588 13:98217959-98217981 GTGTTTTCACAGCGTGAAGGTGG + Intronic
1113005124 13:105692535-105692557 GTTTTTTAATTGAGTGAAGATGG - Intergenic
1114353680 14:21883361-21883383 CTGTTTTCATGGAATGTGGAAGG + Intergenic
1115539935 14:34411096-34411118 TTATTTAAATAGAGTGAAGAAGG + Intronic
1115977699 14:39014740-39014762 ATATTTTCATCTAGTGAAGAAGG - Intergenic
1117157504 14:52955299-52955321 CTGTTTTCACAGACCAAAGAAGG + Intergenic
1118422791 14:65625596-65625618 CTGTTTTAAAAGGGTGAAAATGG + Intronic
1119574488 14:75706468-75706490 CTGTATGCAAAGAGTGAATAAGG - Intronic
1120261626 14:82192254-82192276 CTGGTTTCAAAGAAGGAAGATGG + Intergenic
1120316289 14:82897745-82897767 CTGGTTTCATAAAATGAACAAGG - Intergenic
1120439373 14:84516518-84516540 CTGGTTTCATAGAATGAGTATGG + Intergenic
1120632008 14:86903155-86903177 CTGTTTTCAAAGAAAGCAGATGG - Intergenic
1120813155 14:88825291-88825313 CTGTTGTCCAAGAGTGAAGGAGG + Intronic
1120906403 14:89624854-89624876 GTGACTTCATAGGGTGAAGACGG - Intergenic
1202900137 14_GL000194v1_random:31168-31190 CTGGCTTCATAGAATGAATAAGG + Intergenic
1124685344 15:31777538-31777560 CTGCCTTCATAGGGTGAAGAAGG - Intronic
1126624892 15:50677187-50677209 GTGTCTTCACACAGTGAAGAGGG + Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1127073463 15:55304891-55304913 AAGATTTCATAGAGTGAAAACGG + Intronic
1130677495 15:85966336-85966358 CCGTTTTGATAGAGTGATGGGGG - Intergenic
1131005537 15:88974440-88974462 CTGTTTTCCTACAGGGCAGACGG - Intergenic
1131082946 15:89552294-89552316 CTGTTTTAACAGACTCAAGAGGG - Intergenic
1132323862 15:100949514-100949536 CTGGTTTCATAGACTGAATTGGG - Intronic
1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG + Intergenic
1133518155 16:6530143-6530165 CTTTTATCTTAGAATGAAGAGGG + Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1138406677 16:56800863-56800885 CCATTTTCATAAAGGGAAGAGGG - Intronic
1139204721 16:65016190-65016212 CTGCTTTCTTAAAATGAAGAGGG - Intronic
1140446024 16:75028699-75028721 CTGTTTCAATTGAGTGATGAGGG - Intronic
1140810913 16:78576958-78576980 CTAATTACATGGAGTGAAGATGG - Intronic
1144431602 17:15197497-15197519 TTGTTTACAGAGAGTCAAGAAGG - Intergenic
1148278328 17:46326518-46326540 CTGTTTTCATAGTCTTAATATGG + Intronic
1148300539 17:46544373-46544395 CTGTTTTCATAGTCTTAATATGG + Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1149030778 17:52079993-52080015 CTATTTCCAAAGAGAGAAGATGG + Intronic
1149152715 17:53588459-53588481 CTGGTTTCATAGAATGAATTAGG - Intergenic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1149335296 17:55629457-55629479 CTGTTTGCTTAGAGTGAAAGGGG + Intergenic
1149337932 17:55656701-55656723 CTGTTTTCATACACTGCAGCAGG + Intergenic
1150766879 17:68009403-68009425 CTCTTTTCCTAGCTTGAAGACGG + Intergenic
1152949444 17:83219970-83219992 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1153388106 18:4522575-4522597 CTTTTTTAGTAGAGTGATGAGGG + Intergenic
1153779347 18:8480184-8480206 CTGTTTTCCATGAGTGAAAACGG + Intergenic
1154448200 18:14451968-14451990 CTGTCTTCATAGAATGAGTATGG + Intergenic
1154498752 18:14982808-14982830 CTGCTTTCATAGAATGAATCAGG - Intergenic
1155456832 18:26025801-26025823 CTGGTTTCATAGAGTGAGTTGGG - Intronic
1156735842 18:40258231-40258253 CTGTTTTCATAGGTTGAAAGAGG + Intergenic
1157935714 18:51870483-51870505 CTGGTTTCATAGAGTGAGTTAGG + Intergenic
1157939217 18:51908678-51908700 CTGTACTCAAAGAGTGAAAATGG + Intergenic
1159441595 18:68487151-68487173 CTGTTTTCATAGGATGCAGAGGG - Intergenic
1159755668 18:72361027-72361049 CTGTTGTCATTATGTGAAGAAGG - Intergenic
1160379014 18:78435806-78435828 CTGAATTCAGAGAGTGCAGAGGG + Intergenic
1166897683 19:46034112-46034134 CTGTTTTCATAGCATGTAGGTGG - Intergenic
1166917357 19:46204408-46204430 CTCTTTACATAGAGGGAATAGGG + Intergenic
1167560447 19:50223740-50223762 CTGTTTTCCTGCACTGAAGACGG + Intronic
1202647345 1_KI270706v1_random:154500-154522 CTGGCTTCATAGAATGAATAAGG - Intergenic
925479024 2:4249780-4249802 TTTTCTTCTTAGAGTGAAGATGG + Intergenic
926126617 2:10276362-10276384 CCGTTTTCATGAACTGAAGAGGG + Intergenic
927278983 2:21287140-21287162 CTATTTTTATAAAGTAAAGAAGG - Intergenic
927408510 2:22799060-22799082 CTATTTTCCTAGAGTCATGATGG - Intergenic
927440060 2:23108441-23108463 GTGATTTCATCAAGTGAAGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
928856267 2:35806273-35806295 CTGGCTTCATAGAATGAAGTAGG - Intergenic
929008250 2:37416177-37416199 GTGATTTGATAGAGTGGAGAGGG + Intergenic
929141729 2:38672423-38672445 CTATTTTCAGAAAGAGAAGAAGG + Intronic
929967570 2:46547120-46547142 CTACTTTCAGAGAGTTAAGATGG + Intronic
930551230 2:52837156-52837178 CTGGCTTCAAAGAGTGAGGAAGG - Intergenic
930982897 2:57549461-57549483 ATGTTTTCATGGAATTAAGAAGG - Intergenic
931095872 2:58940204-58940226 CTGGTTTCATAGAATGAGGTGGG + Intergenic
932201904 2:69836052-69836074 CTGTGTTCATAGAGTGGAGAAGG + Intronic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
935954308 2:108360371-108360393 CTGTCTTCATAGAATGAATTAGG - Intergenic
936633715 2:114232657-114232679 CTGGTTTCATAGAGTGATTTGGG + Intergenic
937672055 2:124548423-124548445 CTGGTTTCATGGAGTGAACTGGG - Intronic
937874680 2:126813906-126813928 CTGTTTTCATAGAATCAAGTAGG + Intergenic
938226694 2:129622847-129622869 GTGTCTCCATAGAGTGAAGCAGG + Intergenic
939802143 2:146722733-146722755 CTGTTTTCTTATTGTGAGGATGG - Intergenic
939831290 2:147074697-147074719 CTGGCTTCATAGAGTGAGTAAGG + Intergenic
940157090 2:150668963-150668985 CTGGTTTCATAGAATGAATTAGG - Intergenic
941188039 2:162341973-162341995 CTATTTTTATAAAGTAAAGAAGG + Intronic
941844745 2:170121583-170121605 CTGTCCTCATAGGGTGAATAGGG + Intergenic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
943352067 2:186806929-186806951 CTGCTTTCATGGAGAGGAGAAGG - Intergenic
943924254 2:193751544-193751566 TTCTTTTGAAAGAGTGAAGATGG + Intergenic
945075446 2:206034234-206034256 CTGGCTTCATAGAATGAAGTAGG - Intronic
945545336 2:211143360-211143382 CTGGTTTCATAGAAAGAGGAAGG + Intergenic
946223471 2:218248875-218248897 CTGTTTTCACAGTGAGAATATGG + Intronic
946629218 2:221648069-221648091 CTGTCTTTAAACAGTGAAGACGG - Intergenic
946989642 2:225313968-225313990 CTCTTTTGATAGATTTAAGAAGG + Intergenic
948226890 2:236318235-236318257 CTGTTTACATCGAGTGCAGCGGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170440377 20:16373396-16373418 ATGTTTAAATGGAGTGAAGAAGG + Intronic
1170897291 20:20427160-20427182 CTGTTTTCATAGAAAGCTGAAGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1174886374 20:54339647-54339669 CTGTTTTCTTGGCTTGAAGATGG - Intergenic
1174935382 20:54862084-54862106 CTGTTGTCATAGAGAGGAGCTGG + Intergenic
1176604519 21:8818272-8818294 CTGGCTTCATAGAATGAATAAGG + Intergenic
1176619510 21:9045946-9045968 CTGGCTTCATAGAATGAATAAGG + Intergenic
1177514607 21:22132838-22132860 CAGTTTTCATACAGTTACGAGGG + Intergenic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1178830326 21:36050928-36050950 ATGTGTTCATTGAGTGAACAAGG + Intronic
1180346810 22:11709880-11709902 CTGGCTTCATAGAATGAATAAGG + Intergenic
1180354567 22:11827996-11828018 CTGGCTTCATAGAATGAATAAGG + Intergenic
1180383688 22:12164363-12164385 CTGGCTTCATAGAATGAATAAGG - Intergenic
1181847996 22:25728635-25728657 CCTTTTTCAAAGAGTGAAGGTGG - Exonic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183781830 22:40003675-40003697 CTGATTTCAGAGAATGAACAAGG - Intronic
1184625614 22:45726157-45726179 CTGGCTTCATAGAGTGAATTAGG + Intronic
949799449 3:7887520-7887542 CTGGTTTCATAGAATGATGTAGG - Intergenic
950799836 3:15541495-15541517 TTATTTTCTCAGAGTGAAGAAGG + Intergenic
951582507 3:24180990-24181012 ATGTTTTCAGAATGTGAAGAGGG + Intronic
952523996 3:34190569-34190591 CTGTTTTCACAGAGACAACACGG + Intergenic
953737381 3:45508022-45508044 CTGATCTCATTCAGTGAAGATGG - Intronic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
956177423 3:66486087-66486109 TATTTTTCATAGAGTTAAGATGG + Intronic
956995368 3:74821149-74821171 CTGGTTTCATAGAATGAATTAGG + Intergenic
957324388 3:78674314-78674336 CTGTTTGCAAACAGTAAAGAAGG + Intronic
957880784 3:86210105-86210127 CTCTTTTCATAGAAAGTAGAAGG + Intergenic
958445673 3:94211587-94211609 CTGGTTTCATAGAATGAATTAGG - Intergenic
960524735 3:118696526-118696548 CTGGTTTCATAGAATGAATTAGG - Intergenic
961982952 3:131100746-131100768 CTGGCTTCATAGAGTGAATTAGG + Intronic
962123458 3:132589070-132589092 CTGTCCTCATATAGTGAAAAAGG - Intronic
963899607 3:150721439-150721461 CTGTTGTAATAGGTTGAAGATGG - Intergenic
963912606 3:150827448-150827470 ATGGTTTTATAGAGTGAAGATGG - Intergenic
964456782 3:156877327-156877349 CTGGTTTCATAGAATGATGTAGG + Intronic
965052437 3:163668154-163668176 CTGGTTTCATAAAGTGAATTAGG + Intergenic
965085412 3:164089550-164089572 TAGTTTTCATAGAGGAAAGAAGG - Intergenic
965728181 3:171742424-171742446 CTATGTTCATAGAGTGAATGTGG - Intronic
966119558 3:176506972-176506994 CTGTTATAATACAATGAAGATGG - Intergenic
966299102 3:178459021-178459043 CTGGTTTCATAGAGTAGAGGTGG + Intronic
967475761 3:189915519-189915541 CAGTTTTCCTAGAATGATGAGGG - Intergenic
967786419 3:193501794-193501816 CTAATTTAATAGGGTGAAGAGGG + Intronic
967862103 3:194160088-194160110 CAGATTTCCTAGAGTGAGGAAGG + Intergenic
970604807 4:17669087-17669109 CTAGTTACATAGAGTAAAGAGGG - Intronic
971900775 4:32655302-32655324 CTGGTTTCATAGAATGAATTAGG + Intergenic
972103942 4:35459353-35459375 CTGTTTTCTTTTAGTGAAGGTGG + Intergenic
972680524 4:41302201-41302223 CTGGTTTCATAGAATGAATTAGG + Intergenic
973124020 4:46561270-46561292 CTTTTCTCAGAGAGTGTAGAAGG + Intergenic
973165494 4:47071893-47071915 CTATTTTAATTGAGTGATGAGGG + Intronic
973373601 4:49272667-49272689 CTGGCTTCATAGAATGAATAAGG - Intergenic
973387414 4:49522544-49522566 CTGGCTTCATAGAATGAATAAGG + Intergenic
973616277 4:52681458-52681480 CTGATTTCATAGGCTCAAGAGGG - Intergenic
976387139 4:84474116-84474138 CAGCTTTCATACAGTGAAGGTGG + Intergenic
977496795 4:97785512-97785534 TTGTGTTCATACAATGAAGAAGG + Intronic
978461436 4:108957835-108957857 CTATTTTAAAAGAGTGATGAGGG - Intronic
978795571 4:112705223-112705245 ATGCTTTCTTACAGTGAAGAAGG + Intergenic
979188214 4:117824954-117824976 CTGTTTTCAAAGAGGAAAGGTGG + Intergenic
980238143 4:130135161-130135183 CTGTCTTCATAGAATGAATTAGG - Intergenic
980302182 4:131009839-131009861 CTGTTTGCATACAGTCAAGCAGG - Intergenic
980543799 4:134230627-134230649 CTGTCTTCATAGAATGATTAAGG + Intergenic
981015979 4:139974893-139974915 CTGTTTACTAAGAGTGCAGAGGG + Intronic
982298123 4:153851012-153851034 CTGTTTTCCTACAGTCCAGATGG - Intergenic
982353956 4:154446377-154446399 TGCTTTACATAGAGTGAAGAAGG + Intronic
982477822 4:155874213-155874235 GTGTTTGCATAAAGTGCAGAAGG + Intronic
982556593 4:156874294-156874316 CCTTTTTCATAGAATTAAGAAGG + Intronic
982734602 4:158992622-158992644 TTGTTTTCATACAGTTATGAAGG + Intronic
983489204 4:168368492-168368514 CTGTTCTCAGGCAGTGAAGAAGG + Intronic
984722021 4:182981893-182981915 CTGGTTTCATAGAATGAATTAGG - Intergenic
985093201 4:186385070-186385092 CTGGTTTCATAGAATGAATTAGG - Intergenic
985131144 4:186739993-186740015 CTATTTTCAATGAGTGAAGACGG + Intergenic
985354171 4:189099444-189099466 TTGTCTTCCTGGAGTGAAGAAGG - Intergenic
986975212 5:13386146-13386168 CTGGCTTCATAGAATGAATATGG - Intergenic
988362357 5:30253036-30253058 CTGGTTTCATAGAATGAGGGAGG + Intergenic
989171292 5:38472266-38472288 CTGTTGTCAAAGAGGTAAGAAGG + Intergenic
990511156 5:56490283-56490305 CCCTTTTCAAAGAGTGCAGAAGG - Intergenic
990712536 5:58601349-58601371 CTGGCTTCATAGAATGAAGTAGG + Intronic
990837616 5:60040008-60040030 CAGTTTTGATAGAGTGAATGGGG - Intronic
990864095 5:60361469-60361491 CTGATTTATTAGAGTGGAGAAGG - Intronic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
995163509 5:109009890-109009912 GTGTTTTAAGACAGTGAAGATGG + Intronic
995486335 5:112643950-112643972 CTGTTCTCATAGAGTGGTCATGG - Intergenic
995835130 5:116393073-116393095 ATTTTTTCATTGATTGAAGAAGG + Intronic
995900191 5:117056542-117056564 ATGTCTTTATAGAATGAAGAAGG - Intergenic
995968897 5:117942862-117942884 CTGTTTTCATTCTGTGGAGAAGG - Intergenic
996875992 5:128241221-128241243 CTCCTTTCATTGAATGAAGATGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999650541 5:153763152-153763174 CTGTCTGCCTAGAGTGAAAAGGG + Intronic
999819044 5:155206499-155206521 CTGGTTTCATAGAATGAATTAGG - Intergenic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1000364665 5:160479659-160479681 CTTTTTTAATCGAGTGAGGATGG + Intergenic
1000418605 5:161011438-161011460 CTGATTTCAGAGAGAAAAGATGG + Intergenic
1001922831 5:175613941-175613963 CTGTGTTCAGAGAGTGGAGGAGG + Intergenic
1002743675 5:181453785-181453807 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1002814196 6:663424-663446 CTGGTTTCATAGAATGAATTAGG - Intronic
1003263974 6:4550222-4550244 CCGATTTCATAAAGTGCAGAGGG + Intergenic
1003707121 6:8545300-8545322 CTGTCTTCATTGTGTGAGGATGG + Intergenic
1004291006 6:14367288-14367310 TTGTTTTCTTTGAGGGAAGAGGG - Intergenic
1004661025 6:17709338-17709360 TGGGTCTCATAGAGTGAAGAGGG - Intergenic
1005065032 6:21809345-21809367 CAGATTTAATAGAGTGCAGAGGG - Intergenic
1005321650 6:24661553-24661575 CTGATTTCATAGAATGAAAGGGG - Intronic
1006234604 6:32617688-32617710 CTGTTTTCATACAGTGGAAGTGG + Intergenic
1006711206 6:36073133-36073155 CTGTTGTCACTGAGTGAACATGG - Intronic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1007764506 6:44152753-44152775 CTGCATTCCTAGAGTGGAGAGGG - Intronic
1008783510 6:55137315-55137337 CTGTTTTCAGAGTGTAAGGAAGG - Intronic
1009773763 6:68178410-68178432 CTGGTTTCATAGAGAGGAGCTGG - Intergenic
1010340697 6:74749003-74749025 CTGTTTCCTTAGAATGAACATGG + Intergenic
1010547594 6:77176921-77176943 CTATTTTCTTTGAGTGAAAAAGG + Intergenic
1010610496 6:77948933-77948955 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1011889000 6:92133288-92133310 TTGTTTGCATATAGAGAAGATGG - Intergenic
1011965547 6:93153056-93153078 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1015362077 6:132351646-132351668 CTGGTTTCATAGAATGAATTAGG + Intronic
1017227181 6:152035878-152035900 GTTTTTACATAGAGTAAAGAAGG - Intronic
1017347558 6:153402352-153402374 CTGACTTCCTAGAGTGCAGAAGG + Intergenic
1017866259 6:158445921-158445943 GTGGTTTCCTAGAGAGAAGAGGG + Intronic
1018139160 6:160810086-160810108 CTGATTTCCTAGTGTGCAGAAGG - Intergenic
1019248533 6:170727014-170727036 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1021268929 7:18560722-18560744 CTGTTTTGATAGAGGGAACGTGG + Intronic
1021466275 7:20947317-20947339 CTGGCTTCATAGAGTGAATTAGG - Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1022931022 7:35114745-35114767 CTGTCTTCATATATTGCAGAGGG - Intergenic
1023445158 7:40223412-40223434 CTGATTCCATTGAGTGACGAAGG + Intronic
1023484189 7:40666517-40666539 ATGTTTTCAAAGAATGAAGAAGG + Intronic
1024394177 7:48847289-48847311 CTGTTTTCATGCAGTAAAGAAGG - Intergenic
1024401060 7:48925125-48925147 CTGTTTTCATGCAGTAAAGAAGG + Intergenic
1024711729 7:52022830-52022852 CTGATTTCTTTGGGTGAAGATGG - Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1025796522 7:64742767-64742789 TTGTCTTCACAGAGTGACGAGGG - Intergenic
1026422842 7:70258290-70258312 CTGTGTTCATAGGGGAAAGATGG + Intronic
1027356404 7:77360337-77360359 TTGTTTTCATTGAGTAAATATGG - Intronic
1028038206 7:86012850-86012872 ATGTTTTCATAGTGTGATCATGG + Intergenic
1028083285 7:86603207-86603229 CTGACTTCATAGAGTTAGGAGGG - Intergenic
1028412141 7:90541439-90541461 CTGTTTTCATGGAATGAATTTGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1031740838 7:125428258-125428280 CTGTTCTCACAGACTGGAGAAGG + Intergenic
1032814816 7:135462417-135462439 CTTTTCTCTTAGAGTGCAGATGG - Intronic
1034205871 7:149314698-149314720 CTGTTTTCATAGAATGAGTTAGG + Intergenic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1035489603 7:159261814-159261836 CTGTTGTCACTGTGTGAAGATGG + Intergenic
1035499513 8:80321-80343 TTGATTTCAGAGAGAGAAGAGGG - Intergenic
1037136472 8:15468511-15468533 CTAATTTGACAGAGTGAAGAGGG - Intronic
1038141680 8:24851792-24851814 CGATTTTCATAGTGGGAAGAAGG + Intergenic
1038152876 8:24958077-24958099 CTGTTTTCAAATAGAGAAGCCGG + Intergenic
1040617445 8:49051698-49051720 CTGCTTTCATAGAATGAGGTAGG + Intergenic
1041282157 8:56221321-56221343 CTTTTTTCATAGAGTGTTAATGG + Intergenic
1044081760 8:87894255-87894277 ATGTTTTCATGAAATGAAGAAGG - Intergenic
1044256177 8:90064995-90065017 CTGTTATATTAGATTGAAGAAGG - Intronic
1044831377 8:96253331-96253353 CTGTTGTCATGGAGTGAGGCAGG + Intronic
1045642264 8:104263666-104263688 CTTTTTTCCTAGAATGTAGATGG - Intergenic
1047416229 8:124666828-124666850 GAGTTTTCAAAGAGGGAAGAGGG + Intronic
1048075061 8:131061204-131061226 CCTTTTTCATAGAGTGTAAATGG - Intergenic
1048455738 8:134576736-134576758 CTCTTATCATAAATTGAAGAAGG + Intronic
1048640678 8:136356509-136356531 CTGATTTCATAGAGTGAGTTTGG + Intergenic
1050581463 9:7061812-7061834 CTAATTTCATAGACTGAAGAAGG + Intronic
1050914201 9:11110567-11110589 CTGTTTTCCTCTAGTGAAGTTGG - Intergenic
1051513162 9:17902633-17902655 CAATTTTCATAGAGTGATGGTGG + Intergenic
1052261728 9:26524658-26524680 CTGTTTTCATAGACTGGAATGGG - Intergenic
1052346862 9:27418321-27418343 CTGGCTTCATAGAGTGAATTAGG - Intronic
1052626950 9:30987770-30987792 CTTTATTCAGAGAGTAAAGATGG - Intergenic
1055911174 9:81353857-81353879 CTGTCTTCATAGAATGAATTAGG + Intergenic
1057506537 9:95638337-95638359 GTGTCTTCATATAGTGGAGATGG + Intergenic
1057610793 9:96541825-96541847 CTGTTTTCATGCAGTAAAGAAGG - Exonic
1059114316 9:111587118-111587140 CTGTGTTAATAGAGTGGAAAAGG - Intronic
1059252519 9:112898705-112898727 CTGATTTCAGGGAGTGAAAAGGG + Intergenic
1061319083 9:129816284-129816306 CTGCTTTAATAGAGTGGACAGGG - Intronic
1203697304 Un_GL000214v1:110671-110693 CTGGCTTCATAGAATGAATAAGG - Intergenic
1203551908 Un_KI270743v1:170356-170378 CTGGCTTCATAGAATGAATAAGG + Intergenic
1203609493 Un_KI270748v1:84278-84300 TTGATTTCAGAGAGAGAAGAGGG + Intergenic
1186119155 X:6339830-6339852 CTGGTTTCATAGAGTCCAGTGGG + Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1188119771 X:26289987-26290009 CTGGTTTCATAGAATGAATTAGG + Intergenic
1189408008 X:40743337-40743359 CTGTTTTTATAGCATGAGGATGG + Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1191021709 X:55867513-55867535 CTGTTTTCTAAGAATGAAGCAGG + Intergenic
1191067414 X:56364941-56364963 CTGGTTTCATAGAATGAATTAGG + Intergenic
1191202667 X:57801485-57801507 CTGGTTTCATAGAATGAATTAGG - Intergenic
1191901588 X:66046303-66046325 ATGTCCTCATAGGGTGAAGAAGG + Intergenic
1192061166 X:67828161-67828183 CTGGTTTCATAGAATGAAATAGG - Intergenic
1192904041 X:75530638-75530660 CTGGTTTCATAGAATGAATTAGG + Intergenic
1193019109 X:76770471-76770493 AAGTCTTCATAGAGTGAAGTAGG + Intergenic
1197227047 X:123964367-123964389 CTGTTTTCAAAGAATTAAAAAGG - Intronic
1197602390 X:128545743-128545765 CTGTCTTCCTTTAGTGAAGATGG + Intergenic
1197887304 X:131231773-131231795 CAGATTTCAGGGAGTGAAGAAGG + Intergenic
1199398831 X:147373070-147373092 CTGGCTTCATAGAGTGAATTAGG + Intergenic
1199427075 X:147715106-147715128 CTGTATTCAGTGAGTGAACATGG - Intergenic
1199507212 X:148577499-148577521 CTGCTTTCCTAGACTGATGAAGG + Intronic
1199582907 X:149378151-149378173 CTGTCTTCATATAATGGAGAGGG - Intergenic
1201153177 Y:11105937-11105959 CTGGCTTCATAGAATGAATAAGG + Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic