ID: 904128630

View in Genome Browser
Species Human (GRCh38)
Location 1:28259892-28259914
Sequence CGCCGCCCGGGGCGAACCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904128630_904128636 -10 Left 904128630 1:28259892-28259914 CCTGCGGTTCGCCCCGGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 72
Right 904128636 1:28259905-28259927 CCGGGCGGCGTCGGCGACTCGGG 0: 1
1: 0
2: 1
3: 25
4: 182
904128630_904128639 8 Left 904128630 1:28259892-28259914 CCTGCGGTTCGCCCCGGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 72
Right 904128639 1:28259923-28259945 TCGGGCCCCGGAGAGGTAAGCGG 0: 1
1: 0
2: 1
3: 4
4: 74
904128630_904128637 -4 Left 904128630 1:28259892-28259914 CCTGCGGTTCGCCCCGGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 72
Right 904128637 1:28259911-28259933 GGCGTCGGCGACTCGGGCCCCGG 0: 1
1: 0
2: 2
3: 14
4: 149
904128630_904128640 11 Left 904128630 1:28259892-28259914 CCTGCGGTTCGCCCCGGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 72
Right 904128640 1:28259926-28259948 GGCCCCGGAGAGGTAAGCGGCGG 0: 1
1: 0
2: 1
3: 10
4: 148
904128630_904128638 1 Left 904128630 1:28259892-28259914 CCTGCGGTTCGCCCCGGGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 72
Right 904128638 1:28259916-28259938 CGGCGACTCGGGCCCCGGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904128630 Original CRISPR CGCCGCCCGGGGCGAACCGC AGG (reversed) Exonic