ID: 904128723

View in Genome Browser
Species Human (GRCh38)
Location 1:28260187-28260209
Sequence AAGGATCCGCGGCCCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904128723_904128735 9 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128735 1:28260219-28260241 CCTCGGACTCCTGGCCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123
904128723_904128729 -8 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128729 1:28260202-28260224 GGATCCTTCCTCGGCTCCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 135
904128723_904128732 0 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128732 1:28260210-28260232 CCTCGGCTCCCTCGGACTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 244
904128723_904128740 26 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128740 1:28260236-28260258 ATGAGGGAGAAGCCTTCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 227
904128723_904128736 10 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128736 1:28260220-28260242 CTCGGACTCCTGGCCAATGAGGG 0: 1
1: 0
2: 0
3: 17
4: 236
904128723_904128739 23 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128739 1:28260233-28260255 CCAATGAGGGAGAAGCCTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904128723 Original CRISPR AAGGATCCGCGGCCCTGGGG TGG (reversed) Intronic