ID: 904128723

View in Genome Browser
Species Human (GRCh38)
Location 1:28260187-28260209
Sequence AAGGATCCGCGGCCCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904128723_904128732 0 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128732 1:28260210-28260232 CCTCGGCTCCCTCGGACTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 244
904128723_904128736 10 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128736 1:28260220-28260242 CTCGGACTCCTGGCCAATGAGGG 0: 1
1: 0
2: 0
3: 17
4: 236
904128723_904128739 23 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128739 1:28260233-28260255 CCAATGAGGGAGAAGCCTTCTGG 0: 1
1: 0
2: 3
3: 12
4: 143
904128723_904128740 26 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128740 1:28260236-28260258 ATGAGGGAGAAGCCTTCTGGAGG 0: 1
1: 0
2: 0
3: 18
4: 227
904128723_904128729 -8 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128729 1:28260202-28260224 GGATCCTTCCTCGGCTCCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 135
904128723_904128735 9 Left 904128723 1:28260187-28260209 CCACCCCAGGGCCGCGGATCCTT 0: 1
1: 0
2: 0
3: 6
4: 96
Right 904128735 1:28260219-28260241 CCTCGGACTCCTGGCCAATGAGG 0: 1
1: 0
2: 0
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904128723 Original CRISPR AAGGATCCGCGGCCCTGGGG TGG (reversed) Intronic
900159570 1:1217142-1217164 ACGGAGCGGCGGCCCTGGGAGGG + Exonic
901654765 1:10762940-10762962 AAGCATCCTCTGCCCTGGGCAGG - Intronic
903788231 1:25875361-25875383 AAGGCTCCGCGGGGCAGGGGCGG - Intergenic
904128723 1:28260187-28260209 AAGGATCCGCGGCCCTGGGGTGG - Intronic
906090231 1:43172524-43172546 AAGGAGCCGCGGGGGTGGGGTGG + Exonic
908772659 1:67610431-67610453 AAGGATCCTCTGCCCTTGTGAGG + Intergenic
915262245 1:154685295-154685317 AAAACTCTGCGGCCCTGGGGAGG - Intergenic
924406607 1:243754510-243754532 CACCATCCGCGGCCCAGGGGTGG - Intronic
1066620550 10:37345002-37345024 CAGGATCCAGGGTCCTGGGGAGG - Intronic
1069805885 10:71124822-71124844 AAGAATCCACTGCCCTGGGTTGG + Intergenic
1072806204 10:98425403-98425425 AAGGATCGTAGGCCCGGGGGAGG + Intronic
1076835770 10:133020346-133020368 AAGGACCCGAGTCGCTGGGGTGG + Intergenic
1077162744 11:1121138-1121160 AGGGATGGGCAGCCCTGGGGCGG + Intergenic
1083950633 11:65953690-65953712 AGGGAGCCGGGGCCCTGGGGCGG + Exonic
1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG + Exonic
1092160010 12:6310861-6310883 AGGGCTACGCGGCCCGGGGGCGG + Intronic
1100141522 12:91624644-91624666 AAGGAGTCGCGGCCCTCAGGTGG - Intergenic
1100186394 12:92145056-92145078 AAGGAGCCGTGGGGCTGGGGTGG - Intronic
1103570816 12:121843675-121843697 CAGGATCCGCAGCCTTGTGGGGG - Intronic
1105022901 12:132828969-132828991 GAGGGTCCCCGGCCCTAGGGTGG - Intronic
1105307844 13:19181601-19181623 AAGGATGCGGGGCCCAGGGCGGG - Intronic
1112416188 13:99205327-99205349 GAGGATCCGGGGCCCAGGGCAGG + Intronic
1119709673 14:76812689-76812711 GGGGCTCCGCGGGCCTGGGGCGG - Intronic
1122967481 14:105138092-105138114 AAGGAGCCTGGTCCCTGGGGGGG - Intergenic
1129983638 15:79897070-79897092 GTGGATCCGCGGCCTAGGGGCGG + Intronic
1130296025 15:82647610-82647632 AAGGCGCCGCAGCCCTGCGGGGG - Intronic
1132684489 16:1156616-1156638 AGGGATGCGGGGCCCTGCGGAGG - Intronic
1132977136 16:2716475-2716497 AAGCACCCAGGGCCCTGGGGTGG - Intronic
1138598602 16:58042222-58042244 CAGAACCAGCGGCCCTGGGGAGG - Exonic
1141892784 16:86938231-86938253 AGGCATCCGTGACCCTGGGGAGG - Intergenic
1142195359 16:88737029-88737051 ATGAAGCCACGGCCCTGGGGTGG - Intronic
1143731601 17:8885487-8885509 CAGGAGGCGGGGCCCTGGGGAGG - Intronic
1143731752 17:8885832-8885854 CAGGAGGCGGGGCCCTGGGGAGG - Intronic
1144516082 17:15918222-15918244 AAGGAGCTGGGGCCTTGGGGAGG - Intergenic
1145246927 17:21275626-21275648 CACGGTCCGCGGCCCTCGGGAGG + Intergenic
1145267182 17:21385535-21385557 AAGGCTCCCAGGGCCTGGGGAGG - Intronic
1151153064 17:72104569-72104591 AAGGAGCAGCGGCCATGGGAGGG - Intergenic
1152419260 17:80183206-80183228 AAGGCTCCGCGGCCCTGCCAAGG - Intronic
1154157547 18:11955827-11955849 CAGGATCTGGGGGCCTGGGGAGG + Intergenic
1160662499 19:307567-307589 CAGGATCCGCGGCTGTGGGCAGG - Intronic
1160927907 19:1555864-1555886 AAGGATACGGGGCCCTGCGGGGG + Exonic
1163257437 19:16165311-16165333 AAGGAACTGAGGCCCTGGGAGGG + Intronic
1165060936 19:33204934-33204956 AGGGAGCCGGGGCCCTGTGGAGG - Intronic
1165774034 19:38394757-38394779 GAGGAGCGGCGGCGCTGGGGGGG - Exonic
1167644684 19:50699515-50699537 AAGGATCCTAGGAGCTGGGGAGG + Intronic
1168241989 19:55093043-55093065 AAGGCCCCGCGTCCCTGGAGTGG - Exonic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925030872 2:649145-649167 AAGGCTCCGCTCCCCTGTGGTGG + Intergenic
927897487 2:26793246-26793268 GAGGATCCGGGGCCTTGAGGAGG + Exonic
934304430 2:91809820-91809842 AAGAAGCCGCGGCGGTGGGGGGG - Intergenic
934328827 2:92042930-92042952 AAGAAGCCGCGGCGGTGGGGGGG + Intergenic
937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG + Intergenic
943309348 2:186307656-186307678 AAGGATTTGCAGTCCTGGGGTGG - Intergenic
945522708 2:210848172-210848194 AAGGGTCTGCCGCCCTTGGGTGG - Intergenic
947842054 2:233214129-233214151 CAGGATGCGGGGCCCTGGGCTGG - Intronic
948887512 2:240891569-240891591 AAGGATCCTCAGCCAAGGGGTGG - Exonic
1172840999 20:37902869-37902891 CGGGAACCGCGTCCCTGGGGTGG + Intergenic
1175763055 20:61574053-61574075 GAGGACCCACAGCCCTGGGGTGG + Intronic
1176005876 20:62861946-62861968 AAGCATCCGCCGACGTGGGGCGG - Intergenic
1176025833 20:62985163-62985185 AAGGATGAGAGGCCCTGGGAGGG + Intergenic
1176583438 21:8550968-8550990 AAGGATCCAGGGTCCTGTGGGGG + Intergenic
1179791760 21:43759901-43759923 AAGGACCCCAGGCCCTGGGGAGG + Exonic
1182639315 22:31753947-31753969 AAGGAGGCGGGGCCCCGGGGCGG + Intronic
953819102 3:46188929-46188951 CAGGTTCCGGGGCCCTGTGGTGG + Intronic
954421859 3:50423096-50423118 AGGGAGCCACAGCCCTGGGGAGG - Intronic
956826018 3:72997209-72997231 AGGGCTCCCCGCCCCTGGGGAGG - Intronic
965596985 3:170419657-170419679 AAGGCTCGGCGCCCCGGGGGAGG - Intronic
966808662 3:183825279-183825301 AAGGATCCGCCGCCGGGGCGCGG - Exonic
968983728 4:3864525-3864547 GGGCATCCGCGGCCCTGGGCTGG + Intergenic
972776649 4:42247502-42247524 AAGGCTCAGGGGCACTGGGGCGG - Intergenic
975974488 4:80079448-80079470 AGGGATCGGCGGCTGTGGGGCGG - Intronic
985478970 5:95417-95439 AAGCCTCTCCGGCCCTGGGGAGG + Intergenic
985947162 5:3194818-3194840 AAGGATCCGCCGTCCTCTGGGGG - Intergenic
989333538 5:40288041-40288063 TCAGATACGCGGCCCTGGGGAGG - Intergenic
992627497 5:78648686-78648708 GAGGGTCCGCGGCGCGGGGGAGG + Exonic
1002574071 5:180161659-180161681 CAGGAGCCGCGGGGCTGGGGAGG - Intronic
1003058288 6:2842024-2842046 AAGAAGCCGCGCCCCTGAGGAGG - Intergenic
1003513741 6:6802175-6802197 ACGCATCCTCGGCCCAGGGGTGG + Intergenic
1004193837 6:13487152-13487174 AAGCCTCCGGCGCCCTGGGGGGG - Exonic
1005882933 6:30074404-30074426 AAGGAGCCGGGGCCCAGGAGAGG + Intronic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1006888114 6:37399304-37399326 AAGGAGCTGCTGCCCTTGGGTGG + Intergenic
1007597430 6:43060066-43060088 AAGGAACCGCGGCGCTGGAGTGG - Exonic
1018778035 6:167036412-167036434 TAGGAGCAGAGGCCCTGGGGAGG + Intronic
1019198462 6:170295982-170296004 AAGGAGCCGCGGCGCAGAGGAGG - Intronic
1025793704 7:64718169-64718191 ATGGAGCGGCTGCCCTGGGGGGG - Intergenic
1029701452 7:102249041-102249063 GAGGGGCCGCGGCCCTGGGGCGG + Exonic
1033339187 7:140478952-140478974 AGGGCTCCGCGGCCCAGCGGGGG + Intronic
1034163738 7:149010620-149010642 AAGGGTCTGTGGTCCTGGGGTGG - Intronic
1035239317 7:157519751-157519773 AATGATCACCGGCCCTGGGAGGG + Intergenic
1038017622 8:23528893-23528915 CAGGCGCCGCGGCCCCGGGGAGG + Exonic
1038238714 8:25787888-25787910 AAGGAGCCACGGTCGTGGGGTGG + Intergenic
1043979173 8:86618279-86618301 ACTGATCTGTGGCCCTGGGGTGG + Intronic
1045500937 8:102743884-102743906 AAGGATCCCTGGTCCTGGTGGGG + Intergenic
1049655610 8:143795633-143795655 CAGGAGCCGCGTCCCTGGGCAGG + Intronic
1057494835 9:95552949-95552971 ATGGATCCACGGCTCTGCGGAGG + Intergenic
1057797470 9:98169202-98169224 AAGGATGGGCGGCGCGGGGGCGG - Intronic
1060544843 9:124453700-124453722 AAGGATTCGGGGCCATGGGGTGG - Intronic
1061057905 9:128233923-128233945 AGGGATCCGCGGCGCAGGGTGGG - Intronic
1061191462 9:129085086-129085108 CAGGAGCCACGGCCCTGTGGAGG + Exonic
1061380811 9:130255976-130255998 AAGGACCAGGGGACCTGGGGAGG - Intergenic
1061836635 9:133333858-133333880 AGGGATTCGTGGCCCTAGGGAGG - Intronic
1062583035 9:137236717-137236739 AAGGAATGGCGGGCCTGGGGGGG + Intergenic