ID: 904128767

View in Genome Browser
Species Human (GRCh38)
Location 1:28260348-28260370
Sequence GCGGAGTCCCTTCCTCTTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904128753_904128767 16 Left 904128753 1:28260309-28260331 CCGGAGCGGCCAGACCACTCCTC 0: 1
1: 0
2: 2
3: 12
4: 103
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128754_904128767 7 Left 904128754 1:28260318-28260340 CCAGACCACTCCTCCTCCCCGCC 0: 1
1: 1
2: 5
3: 75
4: 763
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128751_904128767 21 Left 904128751 1:28260304-28260326 CCCGGCCGGAGCGGCCAGACCAC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128758_904128767 -6 Left 904128758 1:28260331-28260353 CCTCCCCGCCCCCTTCCGCGGAG 0: 1
1: 0
2: 2
3: 41
4: 396
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128752_904128767 20 Left 904128752 1:28260305-28260327 CCGGCCGGAGCGGCCAGACCACT 0: 1
1: 0
2: 0
3: 2
4: 65
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128759_904128767 -9 Left 904128759 1:28260334-28260356 CCCCGCCCCCTTCCGCGGAGTCC 0: 1
1: 0
2: 1
3: 18
4: 199
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128755_904128767 2 Left 904128755 1:28260323-28260345 CCACTCCTCCTCCCCGCCCCCTT 0: 1
1: 2
2: 48
3: 562
4: 3785
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128760_904128767 -10 Left 904128760 1:28260335-28260357 CCCGCCCCCTTCCGCGGAGTCCC 0: 1
1: 0
2: 1
3: 20
4: 243
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82
904128756_904128767 -3 Left 904128756 1:28260328-28260350 CCTCCTCCCCGCCCCCTTCCGCG 0: 1
1: 2
2: 21
3: 162
4: 1549
Right 904128767 1:28260348-28260370 GCGGAGTCCCTTCCTCTTCGCGG 0: 1
1: 1
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904128767 Original CRISPR GCGGAGTCCCTTCCTCTTCG CGG Intronic