ID: 904130426

View in Genome Browser
Species Human (GRCh38)
Location 1:28271776-28271798
Sequence CAGAAGCTGGTAAAGTAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904130426_904130434 29 Left 904130426 1:28271776-28271798 CCTGACTACTTTACCAGCTTCTG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 904130434 1:28271828-28271850 ATGGTCCCTTGGCCAGCTCCTGG 0: 1
1: 0
2: 0
3: 18
4: 207
904130426_904130430 6 Left 904130426 1:28271776-28271798 CCTGACTACTTTACCAGCTTCTG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 904130430 1:28271805-28271827 GCACTACCTGCTGCTGCACACGG 0: 1
1: 0
2: 0
3: 16
4: 192
904130426_904130431 10 Left 904130426 1:28271776-28271798 CCTGACTACTTTACCAGCTTCTG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 904130431 1:28271809-28271831 TACCTGCTGCTGCACACGGATGG 0: 1
1: 0
2: 0
3: 11
4: 117
904130426_904130433 18 Left 904130426 1:28271776-28271798 CCTGACTACTTTACCAGCTTCTG 0: 1
1: 0
2: 0
3: 24
4: 196
Right 904130433 1:28271817-28271839 GCTGCACACGGATGGTCCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904130426 Original CRISPR CAGAAGCTGGTAAAGTAGTC AGG (reversed) Exonic
900002288 1:21355-21377 CAGAAGCTGTTATTGTAGTCAGG - Intergenic
900022007 1:191879-191901 CAGAAGCTGTTATTGTAGTCAGG - Intergenic
900749602 1:4386892-4386914 CAGCAGCTGGGAAAGGAGCCTGG - Intergenic
902124028 1:14193441-14193463 CAGAAGCTGGGAGAGTGGCCTGG + Intergenic
902454385 1:16521433-16521455 CAAAAGCTGGGAAAGAAGCCGGG + Intergenic
902498067 1:16888884-16888906 CAAAAGCTGGGAAAGAAGCCCGG - Intronic
902500750 1:16910037-16910059 CAAAAGCAGGGAAAGAAGTCGGG + Intronic
904130426 1:28271776-28271798 CAGAAGCTGGTAAAGTAGTCAGG - Exonic
906518634 1:46454210-46454232 CAGAAGCTGGTAAACCTTTCTGG - Intergenic
907035829 1:51215360-51215382 CAGAAGCTTGTAAGCTATTCTGG - Intergenic
908697684 1:66863029-66863051 AAGAAGCTTGTATAGTAGTACGG + Intronic
910289865 1:85589280-85589302 CAGCAGGTGGTAAAGCAGCCAGG - Intergenic
910529789 1:88222811-88222833 CAGAGGCTAGAAAAGTAGGCAGG + Intergenic
910994674 1:93091402-93091424 CAGAAGTTAGAAAACTAGTCTGG - Intronic
911559453 1:99386039-99386061 CAGAAGCTGGGAAGGGTGTCTGG + Intergenic
914006532 1:143736769-143736791 CAAAAGCTGGGAAAGAAGCCAGG + Intergenic
914302996 1:146392652-146392674 CAAAAGCAGGGAAAGAAGTCGGG + Intergenic
916323864 1:163535238-163535260 CAGAAGCTGGAGAGGTAGTTGGG + Intergenic
916324735 1:163544312-163544334 CTGAAGATGCTAAAGTTGTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
920336049 1:205246075-205246097 CAGAAGCTGTTGAACTACTCTGG + Intronic
923341383 1:233010056-233010078 CAGAATCTGATAAAGTAAACAGG - Intronic
924607148 1:245544591-245544613 CAGAAGCAGGGCAAGAAGTCAGG + Intronic
924895303 1:248332247-248332269 CAGAGGGTGGTAAAGTATTGAGG - Intergenic
1063823398 10:9864052-9864074 CGGAAGCTGGTATAGTAGTTTGG + Intergenic
1064696022 10:17966148-17966170 AAAAAGCAGGTAAGGTAGTCAGG - Intronic
1064947267 10:20804948-20804970 CAGAAGCAGGCAAACCAGTCAGG + Intronic
1065511061 10:26478791-26478813 GAGAAGCTGGTAAGGTAGATAGG + Intronic
1065803184 10:29371025-29371047 TAAAAGCTGGTAAAGTACACAGG + Intergenic
1066746896 10:38610078-38610100 CAGAAGCTGGAAAACAAGTTAGG + Intergenic
1067193187 10:44089820-44089842 CATAGGCTGGGAAAGGAGTCAGG + Intergenic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069378690 10:67820075-67820097 CACAAACTGGCCAAGTAGTCAGG + Intronic
1069444957 10:68464535-68464557 CAAAAACTGGTAAGGTAGGCCGG + Intronic
1069746808 10:70720297-70720319 CAGCAGCTGAGAAAGAAGTCGGG + Intronic
1078938290 11:15972108-15972130 CAGAAAATGGTAAGGTACTCAGG - Exonic
1079574431 11:21985827-21985849 CAGAAGCTAGGAAAGTAGCTTGG + Intergenic
1080134745 11:28841571-28841593 CCCAAGCTGGTAAATGAGTCTGG + Intergenic
1081019188 11:37922154-37922176 CAGATACTGGTATAGTAGTTTGG - Intergenic
1083059612 11:59856240-59856262 CAGAAGCTTATAAACTAGTTTGG + Intronic
1087307941 11:96506218-96506240 CAGAAGCTGCTAAAGGAACCTGG - Intronic
1087392134 11:97549663-97549685 GAGAAGGTAGTAAAGTAGTGAGG + Intergenic
1087546837 11:99595045-99595067 CAGAGGCTGGTAAGGTAGTGGGG + Intronic
1088697094 11:112376947-112376969 AAAAAGCTGGTAAAGTTTTCAGG - Intergenic
1090187699 11:124749031-124749053 CAGAAACTGGCAATGGAGTCGGG + Intronic
1090991878 11:131825096-131825118 CAGAAGCTGGACAAGAAGCCTGG - Intronic
1091375706 12:23417-23439 CAGAAGCTGTTATTGTAGTCAGG - Intergenic
1092026676 12:5246567-5246589 CAGAAGCTAGAAAAGAGGTCTGG - Intergenic
1095848770 12:46777405-46777427 CAGAAGCTTTTCAGGTAGTCTGG - Intronic
1097016041 12:55987849-55987871 CAAAATCTGGTAAAATAGGCTGG + Intronic
1097950948 12:65427723-65427745 CAGATTCTTGTAAAGTAGCCGGG + Intronic
1098330501 12:69347459-69347481 AAGTAGTTGGTAAAGTAGGCCGG + Intergenic
1099978307 12:89569805-89569827 TAGAAGCTCGTAATGTAGCCAGG + Intergenic
1100840726 12:98609466-98609488 CAGAAACTTGTGTAGTAGTCAGG - Intergenic
1101933321 12:109033767-109033789 CAGAAGCTGGTAAAGAGGTGAGG + Intronic
1103797355 12:123513518-123513540 CCGAAGCTGGGATAGGAGTCAGG - Intronic
1105559228 13:21474807-21474829 CAGAAGCTCATATAGTAATCAGG - Intergenic
1110393857 13:75007426-75007448 CAGAAACTATTAAAATAGTCTGG - Intergenic
1110853792 13:80275358-80275380 CAGAAGCTTTTAAAGGAGTGAGG - Intergenic
1111854620 13:93622020-93622042 CAGAAGCTGGGAAGGGTGTCTGG - Intronic
1113035332 13:106041449-106041471 CAGAACCTTGTAGAGTAGTTTGG - Intergenic
1113338841 13:109402557-109402579 CAGAAGAGTGTAAATTAGTCAGG + Intergenic
1114542116 14:23468759-23468781 CACAAGCTGGTGAAGTAGGTTGG - Intergenic
1115069339 14:29302145-29302167 CAGAAGCTGGTAGAGTACATCGG - Intergenic
1116753670 14:48918854-48918876 CAGAAGCTTTTAATTTAGTCAGG - Intergenic
1117750249 14:58914481-58914503 CAGAAGCTGGTGCACTTGTCTGG - Intergenic
1118640391 14:67787032-67787054 CAGAGGCTGGGAAGGTAGTAAGG + Intronic
1118968816 14:70613933-70613955 CAGAAGCAGGGATAGTAATCAGG - Intergenic
1125158712 15:36618823-36618845 GAGAAACTGGTATAGTTGTCTGG - Intronic
1127703326 15:61523568-61523590 CAGCATCTGGTAATGTAGTAAGG + Intergenic
1131879546 15:96848019-96848041 CAGAGGCTGGGAAGGTAGTGGGG + Intergenic
1132163279 15:99563141-99563163 GAGAAGCTGGCCAAGTCGTCAGG + Intergenic
1132451223 15:101969584-101969606 CAGAAGCTGTTATTGTAGTCAGG + Intergenic
1133508105 16:6431738-6431760 ACAAAGCTGGTAAAGTAGCCAGG - Intronic
1134232960 16:12443285-12443307 CAGGGGTTGGTAGAGTAGTCAGG - Intronic
1134306506 16:13037873-13037895 AAGAAACTGGTGGAGTAGTCAGG - Intronic
1135209860 16:20515977-20515999 CAGAGTCTGGAAAAGGAGTCTGG + Intergenic
1136736166 16:32469564-32469586 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
1141921220 16:87136823-87136845 TTGAAGCTGGAAAGGTAGTCTGG - Intronic
1203016906 16_KI270728v1_random:360010-360032 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1203035241 16_KI270728v1_random:633168-633190 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1143275455 17:5706510-5706532 CAGATGCTGGTAAAGTAAGTGGG - Intergenic
1144406768 17:14959442-14959464 CAGATGCTGATGCAGTAGTCTGG - Intergenic
1144853690 17:18256895-18256917 CAGAAGCTGGTAAGGGGGTTTGG - Exonic
1145074218 17:19837820-19837842 CAGAAGCTGGGAGACTAATCAGG - Intronic
1148004870 17:44418916-44418938 CAGAAGCTGATTAAGTATTTTGG - Intronic
1150667255 17:67152829-67152851 CAGAAGCTGGGAAAGGAGCCTGG + Intronic
1151037169 17:70814133-70814155 CAGAGGCTGGCGAAGTGGTCTGG + Intergenic
1151176714 17:72294639-72294661 CAGAAGCTGGAAAACTAGACTGG - Intergenic
1156349378 18:36290240-36290262 CAGAGGCTGGGAAAGTGGTGAGG + Intergenic
1160366783 18:78333138-78333160 CAGAAGATGGTAAAACAGCCTGG - Intergenic
1160634041 19:62963-62985 CAGAAGCTGTTATTGTAGTCAGG - Intergenic
1160818680 19:1047891-1047913 CAGAAGCTGGCACAGTCGCCGGG + Intronic
1165183437 19:33994245-33994267 CAGAGGCTGGGAACGTAGTGGGG + Intergenic
925232779 2:2250503-2250525 CAGAGGCTGGGACAGTAGTAAGG + Intronic
925708308 2:6712430-6712452 AAGAAGCTGCCAAAGTAGCCTGG + Intergenic
929167733 2:38900641-38900663 CAGAATCTGGAAAGGTTGTCTGG - Intronic
930875508 2:56211033-56211055 CATAAGTTGGTAAAGCAGCCTGG - Intronic
931234485 2:60401700-60401722 CAGAAGCAGGTAAGGCAGACTGG + Intergenic
931847666 2:66221494-66221516 CAGGAGCAGGGAAAGTACTCTGG + Intergenic
934187332 2:89758678-89758700 CAGAAGCTGGAAAACAAGTGGGG - Intergenic
934309302 2:91849260-91849282 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
934658091 2:96127225-96127247 CAGAAGCAGGTAAGGTAGTGAGG + Intronic
935560926 2:104559050-104559072 CATAAGCTGCTAAATTGGTCTGG + Intergenic
936567439 2:113592065-113592087 CAGAAGCTGTTATTGTAGTCAGG + Intergenic
938141489 2:128798319-128798341 CAGAAGCTGGAAAAGAACCCAGG - Intergenic
939205675 2:139099565-139099587 CAGGAGCTGATAAAGGATTCTGG - Intergenic
941778591 2:169419752-169419774 CAGAAGCAGCTAAAATAGTAGGG + Intergenic
942044406 2:172090948-172090970 TGGAAGCAGGGAAAGTAGTCGGG + Intergenic
942198545 2:173547448-173547470 CTGAAAATGGTAAAGCAGTCGGG + Intergenic
943581350 2:189687128-189687150 CAGAAGCTGGGAAAGGTGGCAGG - Intronic
945541028 2:211086974-211086996 CAGAAGTTGGTAAAATTTTCTGG + Intergenic
947570421 2:231229394-231229416 CAGAAGCTTTTAAAGAAGACAGG + Intronic
1168868218 20:1107238-1107260 CACAATCTGGTCAAGCAGTCAGG - Intergenic
1170076904 20:12429500-12429522 CAGAAGCAGATAAAATAATCTGG - Intergenic
1170269902 20:14514272-14514294 GAGAAACTGGAAATGTAGTCTGG - Intronic
1175052026 20:56164568-56164590 AAGAAGCTGGTAAGGTGATCAGG - Intergenic
1179879461 21:44287333-44287355 CCGGAGCTGGTGAAGTAGGCGGG + Intronic
1180536385 22:16396370-16396392 CAGAAGCTGGAAAACAAGTGGGG + Intergenic
1181642826 22:24213513-24213535 AAGAAGTTAGTAAAGTAGGCTGG - Intergenic
949171274 3:1000250-1000272 CAGTAGCTGGGAAAGAAGTATGG + Intergenic
950682075 3:14592404-14592426 CTCCAGCTGGTAAAGGAGTCGGG + Intergenic
950869769 3:16218741-16218763 CAGAAGCTGGCAAAATGGTGGGG - Intronic
951661582 3:25072542-25072564 CAGAAGCTCTTAAAATAGTATGG - Intergenic
952593531 3:34987850-34987872 CAGAAGCTGGGAAAGATGTGTGG + Intergenic
954213649 3:49112158-49112180 CAGAGCCTGGTAAAGTAGGGTGG + Intronic
956505129 3:69929756-69929778 CAGAAGCAGGTAGAAGAGTCAGG + Intronic
960626250 3:119685112-119685134 CAGAAGCTGGGAGGGTAGTAGGG - Intergenic
961322837 3:126089584-126089606 TAGAAGCTGGAATACTAGTCAGG + Intronic
961626033 3:128264423-128264445 CAGAAGCTTGGAATGCAGTCAGG + Intronic
965307018 3:167078547-167078569 CAGGAGCCCTTAAAGTAGTCAGG - Intergenic
965760743 3:172073433-172073455 CAGAAGCTGGTACTGCAGCCAGG - Intronic
966647208 3:182259809-182259831 CAGCAGCTGGTGGAGGAGTCAGG + Intergenic
967780253 3:193430755-193430777 GTGAAGTTGGTGAAGTAGTCAGG + Intronic
967804865 3:193706782-193706804 CAGAAGCAGGTAAGATAATCCGG + Intergenic
968334899 3:197905074-197905096 CAGAAGCTGGGAAGGTAGTGGGG + Intronic
971481316 4:27117363-27117385 GAGAAGCTGGTAAAGGAATCGGG - Intergenic
971682016 4:29712186-29712208 CAGAAGCTGGAAAGGTTGTGTGG - Intergenic
971961213 4:33489348-33489370 CAGCAGCTGGTTAAGTTGTTAGG - Intergenic
972543227 4:40057022-40057044 CAGAAGCAGGTAAAGGCGGCGGG + Exonic
973551097 4:52037091-52037113 CAGAAGCTGATAACTTAGGCGGG + Intronic
974991678 4:69099277-69099299 AAGAAGCAGGTAAAGTGGTCAGG + Intronic
975562768 4:75723200-75723222 CAGGAGCTGAAAAAGTAGGCAGG + Intronic
977005853 4:91569094-91569116 CAGAAGGTGGTACATTAGTGAGG + Intronic
977939217 4:102840553-102840575 CAGAAGCTGGGAAAGGTGTCTGG + Intronic
978287375 4:107094923-107094945 CAGATGCTGGGAAAGTACTCAGG + Intronic
980935744 4:139224137-139224159 TAGAAGCTGGTGTATTAGTCAGG + Intergenic
981488749 4:145317578-145317600 AAGAAGGTGGTAAAAGAGTCTGG + Intergenic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
986059946 5:4178576-4178598 CAGAAGCTGGGAGAGAGGTCTGG + Intergenic
986478349 5:8159039-8159061 AAGAAGCAGGTTAAGAAGTCTGG + Intergenic
986892388 5:12324792-12324814 CAGAGGCTGAGAAAGTAGTGGGG + Intergenic
987803656 5:22732743-22732765 CAGAAGCTAGTAGAGAAGTATGG + Intronic
989685748 5:44085020-44085042 CAGTAGCTGGAAAAGCAGACAGG - Intergenic
991487732 5:67155596-67155618 CAGAGGCTGGTAAAGTTTTACGG - Intronic
993584393 5:89705998-89706020 CATTATCTGGTAAAGTAGCCAGG - Intergenic
994520837 5:100832860-100832882 CGGAAGGTGGTAGAGTAGTAAGG - Intronic
995545255 5:113223716-113223738 CAGAAACTGGTAAACTGGTCAGG + Intronic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
996137382 5:119860806-119860828 CAGATGCTCATAAAGTAGCCAGG + Intergenic
999564539 5:152842827-152842849 CAGAAACAGGTAGACTAGTCAGG + Intergenic
999776925 5:154819355-154819377 GAGAAACTGGTAAAGCATTCGGG + Exonic
1000356078 5:160397191-160397213 CACAACCTGGTTAAGTAGTCAGG + Intronic
1000433074 5:161174337-161174359 TAGAAGCTGTTAAAGCAGGCAGG + Intergenic
1005610705 6:27521682-27521704 CAGAATCTGTTAAAATAGGCCGG + Intergenic
1007132062 6:39484550-39484572 AAGAAGCTGGAAATGTAGACAGG + Intronic
1007219312 6:40265900-40265922 CTGAGGCTGGGAAGGTAGTCAGG - Intergenic
1007788495 6:44295725-44295747 CAGCAGCTGGCTAAGTACTCAGG + Intronic
1008628825 6:53344757-53344779 CAGAAGCTGGTTTAGAAGGCAGG - Intronic
1010611633 6:77960820-77960842 CAGATGCTGGTAAAGCTGTGGGG - Intergenic
1011024934 6:82857293-82857315 CAGAGGCTGGGAAGGTAGTTGGG + Intergenic
1011824274 6:91287983-91288005 TAGAAGCTGGTAGACTAGTAAGG + Intergenic
1012408030 6:98923244-98923266 GAGAAGCTAGTAAAGGAGTAGGG - Intronic
1012769662 6:103415704-103415726 CAGAAGCAGGGAAAGAACTCAGG - Intergenic
1015809914 6:137151951-137151973 CAGATGCTTTGAAAGTAGTCTGG + Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1017730114 6:157307918-157307940 CAGAAGCTGGTAGAGATCTCTGG + Intronic
1017813782 6:158002506-158002528 AAGAAACTGGAAAAGTAGCCAGG + Intronic
1017956646 6:159183724-159183746 CAGAAGCTAGTCTAGTGGTCAGG + Intronic
1019730805 7:2628375-2628397 CAGAAGCTGGCAGAGAAGCCTGG - Intergenic
1020419955 7:7991595-7991617 CAGTAGTTGGTAAGGTAGTGTGG + Intronic
1020914372 7:14174078-14174100 GAGAAGCTTGAAAGGTAGTCAGG + Intronic
1022244983 7:28550552-28550574 GAGATGCAGGGAAAGTAGTCGGG - Intronic
1022318861 7:29269203-29269225 CAGAGGCTGGCAGAGTAGTGGGG - Intronic
1023747423 7:43334174-43334196 CAGAAGCTGCGAAAGTACTCAGG - Intronic
1024593192 7:50907876-50907898 CAGAAGCTGGCAAGGTTGTAGGG + Intergenic
1024999952 7:55307446-55307468 CAGAAGCTGGGAAATGAGACTGG + Intergenic
1027555963 7:79665118-79665140 CAGATGCTTGTGAAGTATTCAGG - Intergenic
1030476338 7:110037643-110037665 CAGAGGCTGGGAAGGTAGTGAGG - Intergenic
1030932736 7:115545108-115545130 CAGAAGGTGGGAAAGGAGTAAGG + Intergenic
1031181542 7:118424046-118424068 CAGAAGCTAATGAACTAGTCGGG + Intergenic
1031987130 7:128170461-128170483 GAGAAGCTTGGAAAGTGGTCAGG - Intergenic
1033327622 7:140392534-140392556 CAGAAGCTGTCAAGGTAGGCAGG - Intronic
1035399530 7:158555671-158555693 CAGAAGCTGGCAACAGAGTCAGG + Intronic
1036175188 8:6531048-6531070 CAGAAGCATGTAAAGAAGCCAGG + Intronic
1039307805 8:36282434-36282456 CAGAGGCTGGGAAGGTAGTTGGG - Intergenic
1040726641 8:50388658-50388680 CAGAAGCTGATGATGCAGTCTGG + Intronic
1042119749 8:65473847-65473869 AAGAAGCTGATAATGTAGTTGGG - Intergenic
1044653374 8:94522541-94522563 CAGAAACTGGTAAATTAGGAAGG - Intronic
1045033490 8:98159666-98159688 CAGCAGGTGGTACAGTAGTCAGG + Exonic
1048077985 8:131094190-131094212 CAGGACCTGGGAAAGTAGCCTGG + Intergenic
1049885095 9:21468-21490 CAGAAGCTGTTATTGTAGTCAGG - Intergenic
1051510252 9:17869466-17869488 CAGTAGCTGCTAAAGTATTCCGG - Intergenic
1056891621 9:90499519-90499541 CAGAAGCTGGGAAAGAGGCCTGG - Intergenic
1058352681 9:104044515-104044537 CAGAAGTTGGTAAATCAGTTGGG + Intergenic
1058805229 9:108584242-108584264 GAGTAGCTGTTTAAGTAGTCTGG + Intergenic
1186526879 X:10257095-10257117 CAGAAGGTGGAAAAGGATTCAGG - Intergenic
1186876151 X:13820185-13820207 TAGAGGCTGGCAAACTAGTCAGG + Intronic
1187385936 X:18848367-18848389 CAGAGGCTGGAAAAGCAGTGAGG + Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1192656007 X:72995654-72995676 CAGAGGCTGGAAAAGTAGTGGGG + Intergenic
1195879850 X:109581186-109581208 CAAAAGCTGTCAAAATAGTCAGG - Intergenic
1195959551 X:110371536-110371558 CAGAGGCTGGGAAGGTAGTGGGG - Intronic
1197177373 X:123500303-123500325 CACAAGCTGGCAAAGCAGTGGGG + Intergenic
1197890658 X:131267083-131267105 CAGAAGCTGGGAGGGTAGTTGGG + Intergenic
1198809629 X:140522581-140522603 CAGCAGCTGCTGAAGTAGACAGG + Intergenic
1199338634 X:146649266-146649288 CAGATGCTGGTGAAGTTGTGTGG + Intergenic
1199780105 X:151050681-151050703 AAGATTCTGGTAAACTAGTCTGG + Intergenic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1200008499 X:153103893-153103915 CAGAAGCTGGTAAACTCTTTAGG + Intergenic
1200112550 X:153749199-153749221 CAGAAGCTGGAAAACAAGTGGGG + Intergenic