ID: 904130925

View in Genome Browser
Species Human (GRCh38)
Location 1:28274563-28274585
Sequence ACTGCCCTCGTGGAATCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 3, 3: 2, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904130925_904130931 1 Left 904130925 1:28274563-28274585 CCTCAAGATTCCACGAGGGCAGT 0: 1
1: 0
2: 3
3: 2
4: 81
Right 904130931 1:28274587-28274609 GGGTCCCTGTGAATCCTTAAGGG 0: 1
1: 0
2: 1
3: 8
4: 86
904130925_904130939 27 Left 904130925 1:28274563-28274585 CCTCAAGATTCCACGAGGGCAGT 0: 1
1: 0
2: 3
3: 2
4: 81
Right 904130939 1:28274613-28274635 CATCTATACCCTAAGCTCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 98
904130925_904130936 25 Left 904130925 1:28274563-28274585 CCTCAAGATTCCACGAGGGCAGT 0: 1
1: 0
2: 3
3: 2
4: 81
Right 904130936 1:28274611-28274633 CCCATCTATACCCTAAGCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
904130925_904130930 0 Left 904130925 1:28274563-28274585 CCTCAAGATTCCACGAGGGCAGT 0: 1
1: 0
2: 3
3: 2
4: 81
Right 904130930 1:28274586-28274608 GGGGTCCCTGTGAATCCTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 112
904130925_904130938 26 Left 904130925 1:28274563-28274585 CCTCAAGATTCCACGAGGGCAGT 0: 1
1: 0
2: 3
3: 2
4: 81
Right 904130938 1:28274612-28274634 CCATCTATACCCTAAGCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904130925 Original CRISPR ACTGCCCTCGTGGAATCTTG AGG (reversed) Intronic
902740739 1:18436363-18436385 ACTGCCTTCCTGGAATACTGGGG - Intergenic
904130925 1:28274563-28274585 ACTGCCCTCGTGGAATCTTGAGG - Intronic
921941060 1:220840197-220840219 AGTGACCTCGTAGAATCTTTTGG - Intergenic
923810759 1:237312381-237312403 ACTGTCTTCTTGTAATCTTGTGG + Intronic
1065392079 10:25193164-25193186 CCTGTCCTCATGGACTCTTGTGG + Intronic
1065916732 10:30359436-30359458 GCTGTCCTTGTGGAGTCTTGTGG + Intronic
1067495087 10:46754403-46754425 AATGCCCTCCTGGAAGCTGGTGG - Intergenic
1067599568 10:47585993-47586015 AATGCCCTCCTGGAAGCTGGTGG + Intergenic
1071651098 10:87393877-87393899 AATGCCCTCCTGGAAGCTGGTGG + Intergenic
1073442430 10:103560319-103560341 AGTCCCCTCCTGGAATCTTGAGG + Intronic
1076754419 10:132561810-132561832 ACAACCCTGGTGGAATTTTGGGG + Intronic
1078253524 11:9638109-9638131 ACTGCCCTCGTTAAATGGTGTGG + Intergenic
1084734373 11:71094832-71094854 GCTGCCCGCCTGGACTCTTGGGG - Intronic
1091034858 11:132223985-132224007 AAAGCCCTCGATGAATCTTGAGG + Intronic
1091233255 11:134001944-134001966 CCTGCCCTCATGGAGTCTAGAGG - Intergenic
1096150114 12:49304246-49304268 ACAGCCATTGTGGAATCATGAGG - Intergenic
1104153085 12:126104161-126104183 ACTGCCCTCATGGTATTTTATGG + Intergenic
1107162464 13:37247150-37247172 ATTGCCCTCGTGGGACCTGGGGG + Intergenic
1109448910 13:62483213-62483235 AGTGCCCCCATGGAATCTTCAGG - Intergenic
1109992351 13:70074502-70074524 AATGCCCTCTTGGAATCTCTTGG - Intronic
1112177257 13:97038203-97038225 ACAGCCCTCTTAGAATCTTTCGG - Intergenic
1115496189 14:34007121-34007143 CCTGCCCTCATGGAAGCTTCAGG + Intronic
1119624350 14:76159267-76159289 ACTGCCCACTTGAATTCTTGTGG + Intronic
1124490163 15:30150537-30150559 GCTGTCCTCTTGGAGTCTTGTGG - Intergenic
1124753369 15:32387790-32387812 GCTGTCCTCTTGGAGTCTTGTGG + Intergenic
1124975112 15:34523494-34523516 GCTGTCCTCTTGGAGTCTTGTGG + Intergenic
1129210533 15:74065512-74065534 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1129403479 15:75299817-75299839 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1129419562 15:75413163-75413185 ACTGCAATGGTGCAATCTTGGGG + Intronic
1129727733 15:77910149-77910171 ACTGTCCTTGTGGAATCTTGTGG + Intergenic
1129840162 15:78738746-78738768 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130271847 15:82455829-82455851 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1130345189 15:83037785-83037807 CCTGGCCTGGTGGAATCTTTAGG - Intronic
1130464198 15:84183216-84183238 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1130488489 15:84411603-84411625 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130500068 15:84490319-84490341 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1130586495 15:85187851-85187873 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic
1133002812 16:2859692-2859714 ACTGCCCTCATGGAGGCTTCGGG + Intergenic
1133039918 16:3055193-3055215 ACTGCCCTCTGGGAATCTTGTGG + Intronic
1135899911 16:26447789-26447811 CCTGCCCTCTAGGGATCTTGGGG - Intergenic
1138346665 16:56324493-56324515 GCTGACCTCGGGCAATCTTGGGG - Intronic
1138907367 16:61353527-61353549 ACTGCCATCCTGAAATCTGGAGG + Intergenic
1139372341 16:66476943-66476965 ACTGCCCTTTAGGTATCTTGGGG - Intronic
1146158807 17:30547993-30548015 TCTACCATCCTGGAATCTTGGGG + Intergenic
1156487762 18:37477442-37477464 TCTGCCCTGGCTGAATCTTGTGG + Intronic
1161725072 19:5923888-5923910 ACTGACCTCGTTTAATTTTGGGG + Exonic
1162028580 19:7907736-7907758 ACAGCCCTCGAGGAGTCCTGTGG - Intronic
1166703959 19:44898058-44898080 AGTGCCCTGGTGGCATCTTCTGG - Intronic
1168284849 19:55325942-55325964 TCTGCCCTCGTGCAATTGTGAGG + Intronic
925247139 2:2393925-2393947 GCTGCCCTGGTGAAAGCTTGGGG + Intergenic
928103583 2:28453439-28453461 ACTGCCCCCGTGGCTTCTAGGGG + Intergenic
929093398 2:38241387-38241409 ACTGCTCTCGTGAAATCATATGG - Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
935833397 2:107023810-107023832 CCTGGCCTCATGGATTCTTGGGG - Intergenic
941654203 2:168125826-168125848 CCTACCCTCGTGGAATTATGTGG + Intronic
1172101333 20:32485026-32485048 ACTGCCCTCGTGGAATTCTGTGG + Intronic
1178844662 21:36164500-36164522 CCCGCCCTCGTGGATTCTGGGGG - Intronic
1184175705 22:42787636-42787658 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
969126375 4:4951297-4951319 AGTGGCCTCCTGGAATCCTGGGG - Intergenic
969503890 4:7571512-7571534 ACTGCCCAGGTAGAATTTTGCGG - Intronic
981288188 4:143044759-143044781 TCTGCCTTTGTGGAATGTTGGGG + Intergenic
998094579 5:139390014-139390036 AATGCCCACGTGGCATCTTCGGG - Intronic
1012731357 6:102886783-102886805 ACTGCCCTCTAGGAATCCTTAGG - Intergenic
1016489859 6:144587316-144587338 ACTTCCCAGGTGGAATCTTCTGG - Intronic
1026384353 7:69831310-69831332 ACTGCCCTCATAGAGGCTTGGGG + Intronic
1026671222 7:72392306-72392328 CCTGCGCTTGTGGAATCTCGAGG - Intronic
1026827833 7:73595360-73595382 ACTGCCCTCGGGGCTTCCTGAGG + Intronic
1029021964 7:97373996-97374018 ACTGATCTCATGGAAGCTTGTGG - Intergenic
1035531262 8:353191-353213 AATGCCCTCCTGGACTCTTCTGG + Intergenic
1038262934 8:26013345-26013367 ACTGCCCTCGTGAGTTCCTGTGG + Intronic
1049128213 8:140811187-140811209 ACTGCACTTGTGGAGTGTTGGGG - Intronic
1049195306 8:141312550-141312572 ACTGCCCTCTTTGGACCTTGTGG + Intergenic
1049261505 8:141641585-141641607 AGTGCCCCCGTGGAGTCTGGAGG + Intergenic
1050460641 9:5874752-5874774 ACTGCCCTCCAGGAATCTCCAGG - Intergenic
1052807349 9:33025072-33025094 CCGGCGCTCGTGGAATCTTCTGG - Intronic
1057218513 9:93243098-93243120 ACTGCTCTTGTAGAATCCTGGGG - Intronic
1057668027 9:97061741-97061763 ACTCCCCTGTTGGAATCTTCTGG + Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1061173994 9:128981061-128981083 ACTGCCCTTGTGGAGTGATGGGG + Intronic
1189155575 X:38753267-38753289 ACATCACTCGCGGAATCTTGTGG + Intergenic
1191249522 X:58253808-58253830 ACTGGCCCCGTGGGATCATGGGG - Intergenic
1195362138 X:104093274-104093296 ATTGCCCTTGTGGGATCTGGGGG + Intergenic
1195535842 X:106008485-106008507 ACTGGCTTCTTGGAAACTTGTGG + Intergenic
1196833441 X:119793988-119794010 CCTGCCCTCTTGGAGTCTTGTGG + Intergenic
1198695199 X:139328973-139328995 ACTGGCCTTGTAGAATCTTTTGG - Intergenic
1202371020 Y:24195422-24195444 GCTGTCCTTGTGGAGTCTTGTGG - Intergenic
1202499764 Y:25474695-25474717 GCTGTCCTTGTGGAGTCTTGTGG + Intergenic